Role of Electrostatic and Hydrophobic Interactions in Ca²⁺-Dependent Phospholipid Binding by the C₂A-Domain From Synaptotagmin I

The synaptotagmin I C₂A-domain expression vector (pGEX65–4; residues 140–267) was described previously (5). Mutant synaptotagmin I C₂A-domain expression vectors were obtained using site-directed mutagenesis with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Mutagenesis of M173 into alanine was performed using primers A versus B and pGEX65–4 as a template (sequences: A = GCCCTGGACGCGGGGGGTACCTCCGATCCATACG, B = CGTATGGATCGGAGGTACCCCCCGCGTCCAGGGCG). The resulting construct (pGEXSytIC2AM173A) was used for the subsequent mutagenesis of F234 into alanine using primers C versus D (sequences: C = GACTTTGATCGAGCCTCCAAGCACG, D = CGTGCTTGGAGGCTCGATCAAAGTC), resulting in pGEXSytIC2AM173A/F234A. Substitutions of M226, V228, and F231 for tryptophan were performed using primers E versus F, G versus H, and I versus J, and pGEX65–4 as a template (sequences: E = GCAAAACACTAGTGTGGGCTGTGTATGACTTTG, F = CAAAGTCATACACAGCCCACACTAGTGTTTTGC, G = CACTAGTGATGGCTTGGTATGACTTTGATCG, H = CGATCAAAGTCATACCAAGCCATCACTAGTG, I = GATGGCTGTGTATGACTGGGATCGATTCTCCAAG, J = CTTGGAGAATCGATCCCAGTCATACACAGCCATC). All plasmids were verified by sequencing. Recombinant glutathione S-transferase (GST)-fusion proteins were purified on glutathione-agarose by standard procedures (32) and used for phospholipid-binding measurements with GST-fusion proteins immobilized on glutathione-agarose (5). Amounts, purity, and integrity of proteins used were standardized by SDS-PAGE and Coomassie blue staining.

Phospholipids (1.75 mg total; Avanti Polar Lipids, Alabaster, AL) were solubilized in chloroform, mixed in the indicated weight ratios with addition of a trace of [³H]-labeled phosphatidylcholine (PC) (<0.01% of total; Amersham Pharmacia Biotech, Piscataway, NJ), and dried under nitrogen. Dried lipids were resuspended in 10 ml of 50 mmol/l HEPES-NaOH, pH 7.4, 0.1 mol/l NaCl by vigorous vortexing (1 min), sonicated (5 min) in a waterbath sonicator (model G112PIG; output: 80 kc, 80 W; Laboratory Supply, Hicksville, NJ), and centrifuged (15 min) at ∼5,000g to remove aggregates. Beads containing ∼25 μg recombinant protein (1 g/l wet glutathione beads) were equilibrated in 0.1 ml of the respective binding buffers (50 mmol/l HEPES-NaOH, pH 6.8; 0.1 mol/l NaCl [if not indicated differently]; 4 mmol/l Na₂EGTA; 8.75 μg phospholipids with 0.025 μCi [³H]-labeled PC). For Ca titrations, the binding buffers contained Ca/EGTA concentrations calculated using a commercial software (EqCal for Windows, Biosoft, Ferguson, MO). The mixture was incubated for 10 min at room temperature with vigorous shaking in an Eppendorf shaker, briefly centrifuged, and washed three times with 800 μl of the respective binding buffers. Phospholipid binding was quantified by scintillation counting of the beads (LS6000SC; Beckman Instruments, Fullerton, CA). All buffers were made in high-resistance MilliQ water using a 1 mol/l Ca standard solution (Fluka Chemical, Rankonkoma, NY). The half-maximal concentration (EC₅₀) and the Hill coefficient were calculated from the binding data with the GraphPad Prism program (GraphPad Software, San Diego, CA).

SDS-PAGE was performed as described elsewhere (33). Protein concentrations were determined by comparison of samples run on SDS-PAGE with known amounts of bovine serum albumin standards analyzed on the same gels.

Two hydrophobic residues are exposed at the tip of the Ca²⁺-free and Ca²⁺-bound C₂A-domain, methionine 173 and phenylalanine 234 (9,15). These residues could potentially mediate hydrophobic interactions between the C₂A-domain and the phospholipid bilayer (Fig. 1B). To test this, we replaced these residues, individually and in combination, with alanine residues. Alanine was chosen as the substituent because this amino acid has a short hydrophobic side chain and is thus unlikely to disrupt the secondary structure of the C₂A-domain when inserted instead of methionine 173 or phenylalanine 234. The M173A single mutant and the M173A/F234A double mutant were stably expressed at high levels, consistent with efficient folding of these mutants in the bacteria. The F234A single mutant, however, was unstable, and could not be analyzed in the current experiments (data not shown). We then measured Ca²⁺-dependent phospholipid binding by these mutants in the presence of increasing concentrations of NaCl (Fig. 2). Because increasing concentrations of NaCl disrupt electrostatic interactions but stabilize hydrophobic interactions, they can be used as a method of testing which kind of interaction predominates. In these experiments, we included a nominally “0 mol/l NaCl” condition, which contains no additional NaCl (but still has appreciable ionic strength due to the buffer components 50 mmol/l HEPES-NaOH, 4 mmol/l EGTA ± 4.5 mmol/l CaCl₂), to control for the possibility that the hydrophobic mutations may destabilize the binding even at physiological ionic strength.

As described previously (24,28,29), phospholipid binding to the wild-type C₂A-domain of synaptotagmin I was stable at NaCl concentrations of up to 0.3 mol/l. Phospholipid binding was completely abolished when the NaCl concentration was raised to 0.6 mol/l, indicative of an essential electrostatic interaction (Fig. 2). At nominally 0.0 mol/l NaCl, phospholipid binding to the wild type C₂A-domain was severely inhibited, presumably because of a “salt in” effect. A very different picture emerged for the M173A point mutation. Here, Ca²⁺-dependent phospholipid binding was severely depressed at all NaCl concentrations tested (Fig. 2). The highest degree of binding was detected at nominally 0.0 mol/l NaCl, whereas at physiological ionic strength, binding was depressed by >80%. This inhibition was even stronger for the M173A/F234A double mutant, which displayed significant Ca²⁺-dependent phospholipid binding only at nominally 0.0 mol/l NaCl. It should be noted, however, that residual Ca²⁺-dependent binding was detected for both mutants, suggesting that the mutant C₂A-domains were still capable of Ca²⁺ binding. Together these results indicate that the hydrophobic residues projecting from the tip of the C₂A-domain are essential for tight and stable phospholipid binding.

We next examined the possibility that making the tip of the C₂A-domain more hydrophobic may increase phospholipid binding. For this purpose, three hydrophobic residues in the sixth β-strand or the third top loop (M226, V228, and F231) were individually replaced with tryptophan, the most bulky, highly hydrophobic amino acid. All three mutant proteins were produced at high levels, and were employed in phospholipid binding measurements (Fig. 3). Again, we not only measured the absolute amount of phospholipid binding, but also the effect of increasing NaCl concentrations. Substitution of M226 for tryptophan had no apparent effect on the magnitude or NaCl dependence of phospholipid binding, indicating that this residue in the middle of β6 is not directly involved in Ca²⁺-dependent phospholipid binding (Fig. 3). The V228W mutant, however, was severely impaired in Ca²⁺-dependent phospholipid binding. Although the hydrophobicity of this mutant domain was higher than that of the wild-type C₂A-domain, its residual phospholipid binding was more NaCl sensitive, possibly because the mutation destabilizes the domain at high NaCl concentrations. The most interesting result, however, was obtained with the F231W mutant. Here, Ca²⁺-dependent phospholipid binding was indistinguishable from the wild-type C₂A-domain except for high NaCl concentrations. At 0.6 mol/l NaCl, phospholipid binding by the wild-type C₂A-domain was <5% of the binding obtained at physiological ionic strength (Fig. 2), whereas phospholipid binding by the F231W mutant was ∼50% of that observed at physiological ionic strength (Fig. 3), suggesting that the increased hydrophobicity enhanced hydrophobic interactions. This conclusion agrees well with the exposed location of F231 on the top surface of the C₂A-domain (13,15).

To gain further insight into the changes induced into the C₂A-domain by the various mutations changing the hydrophobicity of the domain, we determined the apparent Ca²⁺ affinity of two key mutants, M173A and F231W, in the presence of phospholipids (Fig. 4). Similar to previous results (14,28), wild-type C₂A-domain exhibited an overall Ca²⁺ affinity of ∼12 μmol/l Ca²⁺ (Fig. 4). Although the small amount of residual Ca²⁺-dependent phospholipid binding was severely impaired in the M173A mutant, the residual binding was sufficient for accurate Ca²⁺ titrations, revealing a twofold lower apparent Ca²⁺ affinity. By contrast, the F231W displayed an increase in Ca²⁺ affinity. These changes were confirmed in multiple independent experiments performed to test the statistical significance of the observed changes in apparent Ca²⁺ affinity (Fig. 5). The F231W mutation (which enhances the hydrophobicity of the top loops of the C₂A-domain) increased the apparent Ca²⁺ affinity by ∼25%, whereas the M173A mutation (which lowers the hydrophobicity of the top loops) decreased the apparent Ca²⁺ affinity by ∼100%. Thus, hydrophobic interactions significantly contribute to the mechanism of phospholipid binding by the synaptotagmin C₂A-domain.

Synaptotagmin I is a Ca²⁺-binding protein that is an abundant component of synaptic vesicles in neurons and secretory granules in endocrine cells (reviewed in reference 34) and is essential for fast Ca²⁺-dependent neurotransmitter release (6). In mice, a mutation that decreases the apparent Ca²⁺ affinity of synaptotagmin approximately twofold causes a corresponding twofold decrease in the synaptic release probability, suggesting that Ca²⁺ binding to synaptotagmin I triggers neurotransmitter release (14). The mechanism of action of synaptotagmin I in neurotransmitter release is unclear, but several lines of evidence suggest that Ca²⁺-dependent phospholipid binding is a key component of its function. First, the Ca²⁺-binding affinity of synaptotagmin is unphysiologically high in the absence of phospholipid membranes but closely resembles physiologically relevant concentrations in the presence of phospholipids (5,15,24). Second, the synaptotagmin mutation that decreases release probability has a selective effect on the Ca²⁺ affinity in the presence of phospholipids, but not, for example, on Ca²⁺-dependent syntaxin binding by synaptotagmin I (14). Third, the only known physiological function of C₂-domains in other proteins, such as perforin and phospholipase A2, is to bind to phospholipids as a function of Ca²⁺ (see, for example, references 25,35–37). Together, these findings suggest that Ca²⁺-dependent phospholipid binding by the C₂-domains of synaptotagmin is a central component of its function.

Extensive previous studies on the mechanism of Ca²⁺-dependent phospholipid binding to the synaptotagmin I C₂A-domain have led to a model whereby the phospholipid bilayer is attached to the entire top surface of the C₂A-domain by multiple electrostatic interactions that are mediated by the bound Ca²⁺ ions and by positively charged residues surrounding the bound Ca²⁺ ions (14,24). However, this model leaves several questions unanswered, one of which is the question whether hydrophobic interactions participate in phospholipid binding in addition to electrostatic interactions. We have now addressed this question by mutagenesis of key residues in the top Ca²⁺-binding loops of the C₂A-domain. Our results reveal that changes in the hydrophobicity of the top surface of C₂A-domain have a profound influence on Ca²⁺-dependent phospholipid binding. The observed alterations went in both directions: decreasing the apparent hydrophobicity impaired phospholipid binding, and increasing the hydrophobicity enhanced it, suggesting that phospholipid binding involves both electrostatic and hydrophobic interactions, as postulated in the initial description of phospholipid binding by synaptotagmin I (4). In evaluating these results, it is important to recall that the atomic structures of the Ca²⁺-bound and Ca²⁺-free forms of the C₂A-domain of synaptotagmin I revealed the same surface exposure of the hydrophobic methionine 173 and phenylalanine 234 residues at the tip of the C₂A-domain (see Fig. 1B) (9,15). Thus, these hydrophobic residues are not exposed on the C₂A-domain as a result of a Ca²⁺-dependent conformational change but are always exposed on the surface of the C₂A-domain, and the Ca²⁺ trigger for phospholipid binding consists entirely of an electrostatic change, not a hydrophobic change, even though hydrophobic interactions are then required for efficient binding.

The dual mode of the Ca²⁺-dependent interaction of the C₂A-domain with phospholipids makes maximal use of the amphipathic nature of phospholipid bilayers, which incorporate both a polyanionic surface and a hydrophobic core. As a result, the C₂A-domain interacts with phospholipid bilayers more specifically, since a simple polyanionic surface would not suffice for binding. This is biologically important in view of the role of synaptotagmin I in membrane fusion, which is, after all, a reaction involving the mixing of phospholipids from different bilayers. Furthermore, our results provide further evidence for the role of the phospholipid bilayer in shaping the Ca²⁺ affinity of synaptotagmin I. The changes in apparent Ca²⁺ affinity in the hydrophobicity mutants (Figs. 4 and 5) are best explained when one considers that these mutants change the stability with which the C₂A-domain is attached to the phospholipid bilayer. Since the phospholipid headgroups of the bilayer in turn contribute to coordinating Ca²⁺ ions, changes in the stability of phospholipid attachment obviously translate into changes in Ca²⁺ affinity. This explains why residues that are not directly involved in Ca²⁺ binding are nevertheless important in determining the apparent Ca²⁺ binding affinity.

We would like to thank Dr. X. Zhang for the initial mutagenesis experiments. This study was supported by grants from the National Institutes of Health (NS40944 to J.R. and T.C.S.) and the Welch Foundation (I-1304 to J.R.) and a fellowship from the Deutsche Forschungsgemeinschaft to S.H.G.