Glucagon-like peptide-1 (GLP-1) is an incretin hormone capable of restoring normal glucose tolerance in aging glucose-intolerant Wistar rats. Whether the antidiabetic properties of GLP-1 are exclusively due to its insulin secretory activity remains to be determined. A GLP-1–dependent differentiation of pancreatic precursor cells into mature β-cells has recently been proposed. The aim of this study was to investigate whether pancreatic ductal epithelial cells could be differentiated into insulin-secreting cells by exposing them to GLP-1. Rat (ARIP) and human (PANC-1) cell lines, both derived from the pancreatic ductal epithelium, were used to test this hypothesis. A major difference distinguishes these two cell lines: whereas ARIP cells spontaneously express the β-cell differentiation factor islet duodenal homeobox-1 (IDX-1), PANC-1 cells are characteristically IDX-1 negative. GLP-1 induced the differentiation of ARIP cells into insulin-synthesizing cells, although it did not affect the phenotype of PANC-1 cells, as determined by fluorescence-activated cell sorting (FACS) analysis. Differentiation of ARIP cells by exposure to human GLP-1 occurs in a time- and dose-dependent manner, and this is associated with an increase in IDX-1 and insulin mRNA levels. Secretion of insulin was also induced in a parallel manner, and it was regulated by the concentration of glucose in the culture medium. Interestingly, PANC-1 cells, when stably transfected with human IDX-1, gained responsiveness to GLP-1 and were able to differentiate into β-cells, as determined by FACS analysis, insulin gene expression, intracellular insulin content, and insulin accumulation in the culture medium. Finally, we demonstrated that the receptor for GLP-1 is constitutively expressed by ARIP and PANC-1 cells and that the mRNA level for this transcript was increased by cellular transfection with human IDX-1. In summary, our study provides evidence that GLP-1 is a differentiation factor for pancreatic ductal cells and that its effect requires the expression of IDX-1.

Endocrine and exocrine cells originate from a precursor epithelial cell during pancreatic organogenesis (1,2). Various differentiation factors are required to achieve the mature phenotype characteristic of islet β-cells. The use of a knockout mouse model for islet duodenal homeobox-1 (IDX-1) (also termed IPF-1/STF-1 and PDX-1) has significantly contributed to the elucidation of the specific role played by different genes in the differentiation of insulin-secreting cells. Mice lacking IDX-1 fail to develop a pancreas (3). Islet-1, a homeodomain-containing protein, is necessary for the development of the dorsal pancreas and is required for the generation of islet cells (4). Inactivation of NeuroD/Beta2 or Pax4 genes cause a striking reduction in the number of insulin-producing cells and a failure to develop mature islets (5,6).

Growth and differentiation of islet β-cells is not limited to the embryological state. A constant remodeling of size and function of the islets of Langerhans occurs during the entire life of individuals and is likely to play an essential role in the prevention of diabetes. In adult rats, two independent pathways are used for the proliferation of pancreatic endocrine cells. In the first pathway, new endocrine cells arise from the division and differentiation of cells within the islets, whereas in the second pathway of proliferation, the islets cells originate from precursor cells located in the pancreatic ductal epithelium (7). It is likely that a coordinated activation of multiple differentiation factors—in a fashion similar to the sequence of events occurring during fetal development—is required for the cellular growth of the endocrine pancreas of adults. The mechanism(s) for the activation of such a complex regulatory network in adulthood is not known. Recently, Xu et al. (8) demonstrated that an analog of the incretin hormone glucagon-like peptide (GLP)-1, termed exendin-4, was able to increase islet mass in adult animals previously subjected to subtotal pancreatectomy. Similarly, we recently demonstrated that the treatment of glucose-intolerant aging Wistar rats with GLP-1 restored normal glucose tolerance and induced islet cell proliferation (9). These studies suggest that exogenously administered stimuli are able, in vivo, to increase the mass of insulin-secreting cells and ameliorate glucose tolerance by inducing neogenesis of islet cells. In the present study, we investigated the ability of human recombinant GLP-1 to differentiate ductal epithelial cells into insulin-secreting cells.

Cell culture.

Rat (ARIP) and human (PANC-1) ductal cell lines were provided by Dr. J.M. Egan (National Institute on Aging, Baltimore, MD) or purchased from ATCC (American Type Culture Collection, Manassas, VA), respectively. ARIP cells were cultured in F12 medium (Gibco-BRL, Gaithersburg, MD) containing 100 μg/ml penicillin, 50 μg/ml streptomycin, and 10% fetal calf serum (FCS) (Gibco-BRL) at 37°C under a humidified condition of 95% air and 5% CO2. PANC-1 cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with antibiotics and FCS, as indicated for F12 medium. Treatment with human GLP-1 (H-6795; Bachem, King of Prussia, PA) was carried out using cells grown to 80% confluence after washing the cell layer with serum-free medium and a “wash-out” incubation for 6 h with serum-free medium. To determine dose response to GLP-1, cells were cultured with fresh serum-free medium containing increasing concentrations of GLP-1 (0.1, 1, 10, and 20 nmol/l) or vehicle alone. At the completion of the experiment, media and cells were collected. To determine the time course of response, cells were cultured in serum-free medium with GLP-1 (10 nmol/l) for 0, 12, 24, 48, 72, or 96 h. Control dishes were cultured with vehicle alone or with the peptide receptor antagonist of GLP-1, exendin-9 (100 nmol/l), for 72 h (provided by Dr. J.M. Egan). The glucose concentration in the culture medium was 12 mmol/l for both cell lines.

Cell transfection with human IDX-1 cDNA.

PANC-1 cells were transfected with a pcDNA3 construct (Invitrogen, Carlsbad, CA) harboring the wild-type full-length IDX-1 cDNA using LipoTAXI (catalog number 204110, Mammalian Transfection Kit; Stratagene, La Jolla, CA). Control cells were transfected with the vector alone. The selection of positive (i.e., transfected) cells was carried out by culturing the cells in the presence of 400 μg/ml of G418 sulfate (GN-04; Omega, Tarzana, CA).

Immunocytochemistry and immunofluorescence microscopy.

Cells were cultured on monocoated chamber slides (Nalge Nunc International, Naperville, IL) in the presence of GLP-1 (10 nmol/l) or vehicle for 72 h.

For the detection of insulin, cells were washed and fixed with 3% paraformaldehyde for 4 h at room temperature in phosphate-buffered saline (PBS) solubilized with 0.1% (vol/vol) Triton X-100 in PBS for 5 min. Cells were then incubated sequentially with an anti-insulin antibody and a secondary antibody, as described by the manufacturer (Biomeda, Foster City, CA). The cells were examined using a Ziess Axiophoto microscope (Ziess, New York).

For the detection of IDX-1, slightly different conditions were used. Briefly, the concentration of paraformaldehyde was decreased to 2%, and the concentration of Triton to permeabilize the cells was raised to 0.2% Triton X-100. Cells were then washed with 0.01 mol/l PBS three times for 3–5 min, and nonspecific binding was inhibited by using 5% chick serum in 0.01 mol/l PBS at room temperature for 60 min in a humid chamber. A rabbit IDX-1 antibody directed against the NH2-terminus of the frog homologue of the IDX-1 gene was used as the primary antibody (1:500 diluted with 0.1% Triton X-100 and 1% bovine serum albumin in 0.01 mol/l PBS), and slides were incubated at 4°C overnight in a humid chamber. After washing, cells were incubated with a fluorescein-conjugated goat anti-rabbit IgG antibody (Molecular Probes, Eugene, OR) and incubated at room temperature for 1 h in a humid chamber. Nuclei of cells stained with anti–IDX-1 antibody were visualized with Hoechst 33242 dye (Sigma, St. Louis, MO). The percentage of IDX-1–containing cells was evaluated by counting the number of IDX-1–positive cells divided by the total number of cells identified by nuclear staining.

Insulin immunofluorescence, for co-immunostaining with IDX-1, was carried out using the same primary antibody described in the previous paragraph, whereas the secondary antibody was a goat anti-guinea pig IgG (Molecular Probes). The cells were examined using a using a fluorescent microscope (E-800; Nikon, Tokyo).

Staining for insulin and IDX-1 experiments was repeated at least three times using independent cell cultures. Hematoxylin and eosin staining was used in some experiments to show the morphological changes observed under the experimental conditions hereafter described.

Measurement of insulin secretion.

PANC-1 (parental, IDX-1–transfected, and neomycin-transfected) cells and ARIP (only parental) cells were plated at a density of 106 cells per well in a six-well plate. Once the cells reached 80% of confluence, they were washed with serum-free medium containing 12 mmol/l glucose and exposed to fresh serum-free medium for an increasing length of time (0, 12, 24, 48, 72, and 96 h) in the presence of different concentrations of GLP-1 (0.1, 1, 10, and 20 nmol/l) or vehicle. Glucose-dependent insulin secretion was evaluated by culturing the cells in the presence of a determined concentration of GLP-1 (10 nmol/l for 72 h) with an increasing concentration of glucose in the culture medium (0, 0.1, 1, 3, 6, 10, and 20 nmol/l). Insulin released into the medium was measured by radioimmunoassay (RIA) (Linco Research, St. Charles, MA). Total insulin accumulation in the culture medium was then normalized for total cellular protein content per each individual culture.

Protein assay.

Total cellular protein content was measured using the Bradford method (Bio-Rad, Richmond, CA). The amount of proteins measured was used as a correction factor for determining the relative amount of medium to be assayed for each individual RIA for insulin.

RNA isolation and Northern blot analysis.

Cellular RNA was extracted as routinely described. Northern blots were hybridized with 1) a full-length rat insulin II cDNA probe, 2) human IDX-1 cDNA, and 3) a rat β-actin cDNA probe. All cDNA probes were labeled with [32P]dCTP (Amersham Life Science, Arlington Heights, IL) by the random priming procedure using the enzyme sequenace (United States Biochemical, Cleveland, OH). Hybridization and washing conditions were carried out as previously described (9). Messenger RNA levels for individual transcripts were evaluated by densitometric analysis and normalized for the relative abundance of β-actin mRNA.

Reverse transcription–polymerase chain reaction and Southern blot analysis.

After the treatment of ARIP and PANC-1 cells with GLP-1, exendin-9, or vehicle for the described length of time and the various doses, the culture medium was removed and the cells were washed twice with serum-free medium. Total RNA was isolated using the TRiazol-method (Gibco-BRL) and treated with DNase (Amplification Grade, Gibco/BRL) in 20 mmol/l Tris-HCl (pH 8.4), 2 mmol/l MgCl2, and 50 mmol/l KCl to remove any traces of contaminating genomic DNA. RNA (2.5 μg) was then subjected to reverse transcription (RT) (RT reagents; Promega, Madison, WI). RT–polymerase chain reaction (PCR) was undertaken in a volume of 50 μl of buffer containing 50 mmol/l KCl, 10 mmol/l Tris-HCl, 3.5 mmol/l MgCl2, 200 μmol/l each dNTPs, and 0.4 μmol/l each of sense and antisense primers to rat or human insulin (depending on the specific cell from which the RNA was extracted). Amplification was performed for 30 cycles at a denaturing temperature of 94°C for 1 min, an annealing temperature of 60°C for 45 s, and an extension temperature of 72°C for 1 min. For the amplification of GLUT2 and glucokinase mRNAs, we used the same PCR conditions described above in the presence of gene-specific primers. For β-actin, the annealing temperature was raised to 64°C for 1 min, and gene-specific primers were used. For GLP-1 receptor (GLP-R), the annealing temperature used was 55°C. All other experimental conditions to amplify GLUT2, glucokinase, and GLP-R mRNAs were identical to those described for the amplification of insulin mRNA. Primer sequences for human and rat insulin, GLUT2, glucokinase, GLP-R, and β-actin are presented in Table 1. RT and PCR conditions for human transcripts were identical to those described for rat mRNAs.

Southern blotting with species-specific full-length cDNA probes for insulin, GLUT2, glucokinase, GLP-R, and β-actin was performed as previously described (9).

Flow cytometric analysis.

For fluorescence-activated cell sorting (FACS) analysis, cells were cultured in the presence of GLP-1 (10 nmol/l) or vehicle for 72 h and then washed with cold PBS (pH 7.4; three times) and incubated overnight on ice in PBS with 2% paraformaldehyde. After centrifugation, the cell pellet was resuspended in 400 μl of cold 0.1% Triton diluted in FACS buffer (PBS with 2% FCS). After several centrifugation cycles and washes, the cells were resuspended in the assay buffer with 10 μl of fluorescent-conjugated insulin antibody (catalog number FM205, FITC; Chromaprobe, Mountain View, CA) in the presence of 10 μl blocking antibody (anti-mouse IgG; Organon Teknika-Cappel, West Chester, PA). Control samples were treated with PBS, without the primary antibody, and then incubated with an isotope-matched fluorescein isothiocyanate (FITC)-conjugated control antibody (murine IgG; Chromaprobe). Flow cytometric analysis was performed with a FACScan[R] cytometer, using the LYSYS II program (10). Cell viability was evaluated by the Trypan blue dye (Gibco-BRL) exclusion technique.

Statistical analysis.

The data were expressed as means ± SE. Significance of the data were evaluated by the unpaired Student’s t test. One-way analysis of variance (ANOVA) was used to evaluate statistical significance when more than two data points were analyzed. Statistical analyses by unpaired Student’s t test or ANOVA are explicitly identified in the text or in the figure legends.

Morphological changes of ARIP cells induced by GLP-1.

Various changes in the morphology of ARIP cells resulted from the treatment with GLP-1 (10 nmol/l) for 72 h. GLP-1 primarily affected the relationship between cells within a given culture dish, with an additional, although much less evident, effect on the appearance of individual cells. Whereas naive ARIP cells characteristically grew as individual cells, forming a fine monolayer (Fig. 1A), treatment with GLP-1 promoted the aggregation of cells in small clusters (Fig. 1B). This was not a function of cell density: treatment with GLP-1 induced ARIP cells to aggregate in patches even when plated at a very low density. Although the majority of GLP-treated cells tended to grow in semispherical patches of cells, a small percentage of cells continued to grow as sparse and isolated cells, indicating that there was heterogeneity of response to GLP-1. The morphology of individual cells revealed some additional, although less evident, changes. These included more irregular and variable cell shapes, with a cytoplasm less homogenous and rougher in appearance than control culture.

Morphological changes of PANC-1 cells induced by GLP-1.

Parental (nontransfected) PANC-1 cells did not respond to GLP-1 (10 nmol/l for 72 h) with any morphological change (Fig. 1C for vehicle alone; Fig. 1D for GLP-1 treatment). Transfection with human IDX-1 induced clear changes in the shape of individual cells as well as in the relationship between cells (Fig. 1D). IDX-1–transfected cells grew in patches rather than in isolation and were surrounded by a large amount of extracellular matrix (Fig. 1E). Treatment of IDX-1–transfected PANC-1 cells with GLP-1 (10 nmol/l for 72 h) further promoted the tendency of forming aggregates with few cells (Fig. 1F). In addition, we observed that GLP-1 induced an increase in the size of individual cells (Figs. 1E and F).

Immunocytochemistry for insulin.

Treatment with GLP-1 induces the differentiation of ductal epithelial cells into insulin-producing cells. Figure 2 illustrates a series of cell cultures grown with or without GLP-1 (10 nmol/l) for 72 h. Using anti-insulin antibody, a positive immunoreactivity for insulin was detected in GLP-1–treated ARIP cells (Fig. 2B); in contrast, no insulin immunoreactivity was observed in ARIP cells cultured with vehicle alone (Fig. 2A). Preabsorption of the antibody with an excess of human recombinant insulin prevented the staining of insulin-positive GLP-1–treated cells (data not shown). Although treatment with GLP-1 turned the majority of ARIP cells into insulin-producing cells, a minority of cells never acquired these features in response to GLP-1 and never gained the ability to synthesize insulin.

No positive insulin immunostaining was observed with parental PANC-1 cells cultured in the presence or absence of GLP-1 (Figs. 2C and D). Transfection of human PANC-1 cells with human IDX-1 was able to render these cells capable of synthesizing insulin when exposed to GLP-1 (Fig. 2F). In contrast, PANC-1 cells cultured with vehicle alone were insulin negative, even when transfected with human IDX-1 (Fig. 2E). A negative control was obtained by solely using the secondary antibody to stain a culture of PANC-1/IDX-1–transfected cells cultured in the presence of GLP-1 (10 nmol/l) for 72 h (Fig. 2G). A section of rat pancreas was used as a positive control for insulin immunostaining (Fig. 2H).

Immunofluorochistochemistry for IDX-1.

ARIP and PANC-1 (parental- and IDX-1–transfected) cells were cultured as described for insulin immunostaining and subjected to immunofluorescence study for IDX-1. Control nuclear staining was performed for all culture conditions. Using anti–IDX-1 antibody, a positive immunoreactivity for IDX-1 was detected in ARIP cells treated with vehicle alone (Fig. 3, A1 and A2) or GLP-1 (Fig. 3, B1 and B2). No positive IDX-1 staining was observed with parental PANC-1 cells cultured with vehicle alone or GLP-1 (Fig. 3, C1, C2, D1, and D2). Transfection of human PANC-1 cells with human IDX-1 induced, as expected, the expression of the counterpart protein (Fig. 3, E1, E2, F1, and F2). Treatment with GLP-1 (10 nmol/l for 72 h) promoted a further increase the expression level of IDX-1 for both ARIP and PANC-1/IDX-1–transfected cultures (Fig. 3, pictures B and F). It appeared that GLP-1 increased the level of expression of IDX-1 rather than number of IDX-1–expressing cells. Counting of 400 cells from several independent cultures of ARIP and PANC-1/IDX-1 cells treated with GLP-1 or vehicle revealed that ∼70% of ARIP and 100% of PANC-1/IDX-1 cells expressed IDX-1.

Double immunofluorescence for insulin and IDX-1 of PANC-1/IDX-1–transfected cells cultured with GLP-1 (10 nmol/l for 72 h) demonstrated that the two proteins were coexpressed under the experimental conditions described (Fig. 3G, staining for insulin; Fig. 3H, staining for IDX-1; Fig. 3I, double immunostaining for insulin and IDX-1). Approximately 85% of IDX-1–containing cells were also positive for the presence of intracellular insulin. All insulin-containing cells were positive for IDX-1 staining; the anti-insulin antibody did not stain some weakly IDX-1–positive cells (∼20% of PANC-1/IDX-1 cells).

Insulin release in the culture medium.

ARIP cells cultured in the presence of GLP-1 exhibited a dose-dependent response of insulin secretion (Fig. 4A). The minimum concentration of GLP-1 required to transform rat pancreatic (ARIP) ductal cells into insulin-producing cells was 1 nmol/l. A linear increase of insulin accumulation into the culture medium was observed with increasing doses, and a plateau of this response was detected with 20 nmol/l of GLP-1. Analysis of the time course of the insulin secretory response of ARIP cells cultured in the presence of GLP-1 (10 nmol/l) revealed that the maximal secretion was observed at 48 h, with a plateau at 72 h, followed by an early decline at later time points (Fig. 4B).

The results described above for ARIP cells treated with GLP-1 were not confirmed when a different ductal cell line (human PANC-1) was used to perform a similar set of experiments. PANC-1 cells did not secrete insulin in response to GLP-1 (Fig. 5A). However, cellular transfection of PANC-1 cells with the human β-cell differentiation factor IDX-1 rendered the human ductal cells capable of responding to GLP-1 and induced the synthesis and secretion of insulin. A 1 nmol/l concentration of GLP-1 in the culture medium was required to induce insulin secretion and to promote a dose-dependent accumulation of insulin in the culture medium (Fig. 5B). The time course of the GLP-1 response revealed a peak secretion within 48 h, with a plateau at 72 h and an early decline after 96 h from the first exposure to GLP-1 (Fig. 5C).

Cell culturing in the presence of an increasing concentration of glucose with a constant concentration of GLP-1 (10 nmol/l for 72 h), or vehicle, revealed that both ARIP and PANC-1/IDX-1–transfected cells were able to release insulin in a glucose-dependent manner when exposed to GLP-1 (Figs. 6A and B). No insulin secretory response was observed with wild-type PANC-1 cells cultured in the presence of GLP-1 (10 nmol/l for 72 h) with an increasing concentration of glucose in the culture medium (data not shown). For both ARIP and PANC-1/IDX-1 cells, the lowest concentration of glucose required to induce the secretion of insulin was 3 mmol/l. A linear increase of insulin accumulation into the culture medium was observed with increasing doses (P < 0.001), and a plateau of this response was detected with glucose concentrations between 10 and 20 mmol/l (Figs. 6A and B).

Messenger RNA levels of β-cell–specific genes.

Rat (ARIP) and human (PANC-1) ductal epithelial cells were subjected to Northern blot analysis for detection of IDX-1, insulin, and β-actin mRNA levels. Whereas ARIP cells showed that the IDX-1 gene was constitutively transcribed, PANC-1 cells were IDX-1–negative (Fig. 7). Hybridization of the same blot with insulin cDNA probe was negative for both ARIP and PANC-1 cells (Fig. 7).

To analyze the ability of GLP-1 to induce the differentiation of ductal cells into insulin-producing cells, we began RT-PCR analysis to achieve maximum sensitivity for the detection of insulin mRNA, as well as the mRNA for other β-cell–specific transcripts. RT-PCR analysis was performed using RNA isolated from at least five different cultures for each experimental condition, and each PCR was repeated more than two times.

RT-PCR analysis of ARIP cells demonstrated that the lowest concentration of GLP-1 required for the initial detection of insulin mRNA was that of 1 nmol/l (data not shown). To evaluate the time course of response to GLP-1, ARIP cells were cultured in serum-free medium with GLP-1 (10 nmol/l) for an increasing length of time (Fig. 8A). A clear band at 187 bp corresponding to rat insulin I and II mRNA was detected first in ARIP cells cultured with GLP-1 for 48 h. This was followed by a plateau at 72 h, with insulin mRNA levels remaining constant up to 96 h after the first GLP-1 exposure. No RT-PCR products were detected in the negative control or in non–GLP-1–treated cells. RT-PCR for GLUT2 revealed the presence of this transcript (343 bp) after only 24 h of treatment with GLP-1, preceding the earliest detection of insulin mRNA by ∼1 day. After the initial expression at 24 h, GLUT2 mRNA remained constant over time, in a fashion similar to insulin. Glucokinase mRNA was detectable at 72 h, 24 h after the appearance of insulin mRNA, indicating that the glucose-sensing ability of insulin-secreting cells was a late event in the differentiation process. Glucokinase mRNA levels remained unchanged after the 72-h detection. No RT-PCR products were detected in the negative control or in non–GLP-1–treated cells. This leaves the sequence of gene expression as GLUT2 at 24 h, insulin at 48 h, and glucokinase at 72 h. RT-PCR for β-actin was used as a control for RNA loading.

RT-PCR for insulin using RNA extracts obtained from PANC-1 cells treated for 96 h with GLP-1 (10 nmol/l) were consistently negative (Fig. 8B). Transfection of PANC-1 cells with human IDX-1 was not able per se to induce insulin gene transcription; however, it was sufficient to render PANC-1 cells responsive to GLP-1. The lowest dose of GLP-1 required to detect insulin mRNA was 1 nmol/l (data not shown). This was followed by a progressive dose-dependent increase of insulin mRNA levels, reaching a peak at 10 nmol/l and a plateau at 20 nmol/l (data not shown). The time course of response in PANC-1 cells transfected with human IDX-1 and cultured with GLP-1 (10 nmol/l) revealed the earliest detection of insulin after 48 h, followed by a plateau at 72 h. RT-PCR for β-actin was used as a control for RNA loading. The pattern of expression for GLUT2 and glucokinase mRNAs was similar to that described for ARIP cells treated with GLP-1, with GLUT2 preceding the earliest insulin gene expression by 24 h and glucokinase appearing only 24 h after the first detection of insulin mRNA. This leaves the sequence of β-cell–specific genes in PANC-1 as GLUT2 at 24 h, insulin at 48 h, and glucokinase at 72 h.

Treatment of either ARIP or PANC-1/IDX-1 cells with the GLP-R antagonist exendin-9 inhibited the expression of GLUT2, insulin, and glucokinase (Figs. 8A and B), demonstrating that the β-cell–like phenotype observed under the experimental conditions described in the present study was specifically induced by GLP-1.

Detection of GLP-R by RT-PCR with gene-specific primers revealed that both ARIP and PANC-1 cells constitutively (i.e., before the treatment with GLP-1 or transfection with the IDX-1 gene) expressed the receptor for GLP-1. Cellular transfection of PANC-1 cells with the IDX-1 gene increased the mRNA level for GLP-R (P < 0.01 comparing PANC-1/IDX-1 cells with either wild-type PANC-1 or ARIP cells after 25 PCR cycles). Treatment with GLP-1 (10 nmol/l for 72 h) promoted a further modest increase (not statistically significant) in GLP-R mRNA levels in both transfected and nontransfected cells (Fig. 9).

Flow cytometric analysis.

The ability of GLP-1 to promote the differentiation of IDX-1–positive ductal epithelial cells into insulin-synthesizing cells was further confirmed by FACS analysis. This procedure was used to provide a quantitative measure of the ability of GLP-1 to induce the differentiation of insulin-secreting cells.

ARIP cells cultured for 72 h in the presence of GLP-1 (10 nmol/l) were able to transcribe and translate the insulin gene, such that 72.6% of them reacted with an anti-human insulin antibody, demonstrating that they were able to synthesize insulin (Fig. 10). PANC-1 cells cultured in the presence or absence of GLP-1 showed that only 1.4% of the entire culture population contained insulin in the cytoplasm—a percentage equivalent to the background level of the assay. Stable transfection with human IDX-1, although not capable of inducing cells to synthesize insulin, was sufficient to render them responsive to GLP-1. Transfection with IDX-1 was not able, per se, to differentiate PANC-1 cells into insulin-producing cells; however, treatment with GLP-1 (10 nmol/l for 72 h) converted 61.7% of the cultured cells from insulin-negative to insulin-positive (Fig. 10). FACS analysis of PANC-1 cells treated with GLP-1 and stained solely with an unspecific isotype-matched FITC-conjugated antibody, without the primary antibody, was used as a negative control (Fig. 10).

The present study demonstrates that the treatment of pancreatic ductal epithelial cells with the gastrointestinal incretin hormone GLP-1 promotes their differentiation into pancreatic β-like cells. GLP-1 requires the gene expression of the islet differentiation factor IDX-1 to exert its differentiation promoting activity.

Insulin, GLUT2, and glucokinase mRNAs (the three main gene transcripts that define the physiology of normal β-cells) were transcribed by epithelial ductal cells after exposure to GLP-1. In conjunction with the induction of the gene expression for insulin, we showed that GLP-1–treated cells contain and secrete the counterpart protein, as demonstrated by immunocytochemistry, RIA, and FACS analysis. GLUT2 was the first β-cell–specific transcript we detected in GLP-1–treated pancreatic ductal cells. This was followed by insulin and, finally, by the glucose-phosphorylating enzyme glucokinase. The specificity of the effect of GLP-1 was validated by experiments demonstrating that treatment of cells (ARIP or PANC-1) with the GLP-R antagonist exendin-9 inhibited the expression of β-cell–specific genes.

The mechanisms regulating proliferation and differentiation of the pancreatic hormone-producing cells and the chronology of these biological events are still largely undetermined. The sequence of events hereby described leads us to speculate that the ability to regulate glucose uptake by the islet-specific glucose transporter GLUT2 is the first step necessary for the “sensitization” of the regulatory region(s) of the insulin gene to glucose. This would then promote the transcription of insulin mRNA. GLP-1–dependent activation of IDX-1 would further commit these cells toward a β-cell–like pathway of differentiation by inducing the synthesis of glucokinase, the chief element of the “glucose-sensing machine” of the islets of Langerhans.

The homeodomain protein IDX-1 is an insulin gene transcription factor expressed in the early pancreatic gland of the embryo. During pancreatic islet development, IDX-1 plays an important role in determining islet cell differentiation (11). It is the early IDX-1 gene expression during embryogenesis, coupled with the activation of other transcription factors (i.e., NeuroD/Beta 2, Pax 4, etc.), that determine the pancreatic endocrine hormone production (5,6). In adult (mature) animals, the expression of IDX-1 is repressed in the majority of pancreatic cells, with the exception of the β- and δ-cells (somatostatin-secreting cells) of the islets of Langerhans (12).

In this study, we demonstrated that only those pancreatic epithelial cells that express IDX-1 are susceptible to undergoing differentiation into insulin-secreting cells once they are treated with GLP-1. Interestingly, the overexpression of human IDX-1, by means of stable cellular transfection, is not sufficient per se to induce the differentiation of these cells into a β-cell–like phenotype. It is only when IDX-1–positive cells are exposed to GLP-1 that they acquire the ability to synthesize insulin. Similarly, it is not the presence of receptors for GLP-1 per se that allows the differentiation of GLP-1–treated cells into insulin-secreting cells. Indeed, although only parental ARIP cells were able to differentiate into insulin-secreting cells after treatment with GLP-1, both ARIP and PANC-1 cells constitutively expressed receptors for GLP-1. PANC-1 cells responded to GLP-1 by means of differentiation into insulin-secreting cells only when transfected with human IDX-1. A potential interplay between IDX-1 and GLP-1 is further suggested by our data demonstrating that treatment with GLP-1 increases IDX-1 mRNA levels and transfection with IDX-1 induces an increase in GLP-R mRNA levels. Although these findings may require additional studies for further characterization, they clearly indicate that GLP-1 is able to induce a β-cell–like phenotype only in cells that are genetically susceptible to acquiring that phenotype, and IDX-1 is a key player in this process.

Our interest in studying pancreatic ductal cells derives from studies demonstrating that it is from this cell type that pancreatic endocrine cells derive (1,7,13). This has been proposed to occur both during pancreatic organogenesis and islet cell proliferation after injury in mature animals. In adult animals, the removal of 90% of the pancreas (8,14), or the treatment with the toxic agent streptozotocin (15,16), are two known models to induce hyperglycemia by dramatically reducing the islet β-cell mass. In both of these experimental models, the destruction of islet mass is followed by a compensatory attempt to replace the normal population of insulin-secreting cells. New β-cells are formed from existing islets and from ductal epithelial cells (7). The latter source has greater intrinsic biological relevance. Indeed, the possibility of differentiating insulin-secreting cells from nonendocrine cells supports the hypothesis that the biological source (pancreatic ductal epithelium) for this compensatory mechanism may be present even in the setting of a generalized destruction of the entire population of islet β-cells. This is strongly supported by recent studies demonstrating that primary cultures of epithelial ductal cells (from human and mouse pancreas) are susceptible to undergoing differentiation into endocrine cells (17,18).

In the normal ductal epithelium, it remains to be determined whether there are different populations of cells, some of which are capable of differentiating into endocrine cells, whereas others have merely a structural role in defining the epithelial wall. Alternatively, it could be speculated that all pancreatic ductal epithelial cells could represent a not-fully-differentiated population of cells capable of acquiring a new phenotype under specific stimuli.

In summary, pancreatic ductal cell lines are capable, under specific stimuli, of converting into pancreatic endocrine cells. In this study, we demonstrated that human GLP-1 is capable, when acting on IDX-1–positive cells, of promoting a β-cell–like phenotype. This model system may provide a basis for elucidating the minimum biological requirements for a non–β-cell to become a fully functioning β-cell.

FIG. 1.

Morphological changes of ARIP and PANC-1 cells treated with GLP-1. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured in serum-free medium with or without GLP-1 (10 nmol/l) for 72 h and stained with hematoxylin and eosin. A and B represent ARIP cells cultured with vehicle (A) or medium containing GLP-1 (B). E and F represent PANC-1 cells transfected with human IDX-1 cultured in the absence (E) or in the presence (F) of GLP-1.

FIG. 1.

Morphological changes of ARIP and PANC-1 cells treated with GLP-1. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured in serum-free medium with or without GLP-1 (10 nmol/l) for 72 h and stained with hematoxylin and eosin. A and B represent ARIP cells cultured with vehicle (A) or medium containing GLP-1 (B). E and F represent PANC-1 cells transfected with human IDX-1 cultured in the absence (E) or in the presence (F) of GLP-1.

FIG. 2.

Immunocytochemistry for insulin of ARIP and PANC-1 cells treated with or without GLP-1. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured with or without GLP-1 (10 nmol/l) for 72 h and subjected to immunostaining with an anti-human insulin antibody. A and B represent ARIP cells cultured in serum-free medium in the absence (A) or presence (B) of GLP-1. C and D represent nontransfected PANC-1 cells cultured in the absence (C) or presence (D) of GLP-1. E and F represent PANC-1/IDX-1 cells cultured in the absence (E) or presence (F) of GLP-1. PANC-1/IDX-1 cells, treated with GLP-1 (10 nmol/l for 72 h) and stained solely with secondary antibody, were used as a negative control (G). Rat pancreas was used as a positive control (H) (original magnification ×200).

FIG. 2.

Immunocytochemistry for insulin of ARIP and PANC-1 cells treated with or without GLP-1. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured with or without GLP-1 (10 nmol/l) for 72 h and subjected to immunostaining with an anti-human insulin antibody. A and B represent ARIP cells cultured in serum-free medium in the absence (A) or presence (B) of GLP-1. C and D represent nontransfected PANC-1 cells cultured in the absence (C) or presence (D) of GLP-1. E and F represent PANC-1/IDX-1 cells cultured in the absence (E) or presence (F) of GLP-1. PANC-1/IDX-1 cells, treated with GLP-1 (10 nmol/l for 72 h) and stained solely with secondary antibody, were used as a negative control (G). Rat pancreas was used as a positive control (H) (original magnification ×200).

FIG. 3.

Immunofluorocytochemistry for IDX-1 of ARIP and PANC-1 cells treated with or without GLP-1. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were treated with or without GLP-1 (10 nmol/l) for 72 h and subjected to immunostaining with an anti–IDX-1 antibody (1) and with the nuclear dye Hoechst 33242 (2). A1/A2 and B1/B2 represent ARIP cells cultured in serum-free medium in the absence (A1/A2) or presence (B1/B2) of GLP-1. C1/C2 and D1/D2 represent nontransfected PANC-1 cells cultured in the absence (C1/C2) or presence (D1/D2) of GLP-1. E1/E2 and F1/F2 represent PANC-1/IDX-1 cells cultured in the absence (E1/E2) or presence (F1/F2) of GLP-1. G–I show PANC-1/IDX-1 cells stained for insulin alone (G), IDX-1 alone (H), or costained for both IDX-1 and insulin (I).

FIG. 3.

Immunofluorocytochemistry for IDX-1 of ARIP and PANC-1 cells treated with or without GLP-1. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were treated with or without GLP-1 (10 nmol/l) for 72 h and subjected to immunostaining with an anti–IDX-1 antibody (1) and with the nuclear dye Hoechst 33242 (2). A1/A2 and B1/B2 represent ARIP cells cultured in serum-free medium in the absence (A1/A2) or presence (B1/B2) of GLP-1. C1/C2 and D1/D2 represent nontransfected PANC-1 cells cultured in the absence (C1/C2) or presence (D1/D2) of GLP-1. E1/E2 and F1/F2 represent PANC-1/IDX-1 cells cultured in the absence (E1/E2) or presence (F1/F2) of GLP-1. G–I show PANC-1/IDX-1 cells stained for insulin alone (G), IDX-1 alone (H), or costained for both IDX-1 and insulin (I).

FIG. 4.

Dose- and time-dependent insulin accumulation in the culture medium of ARIP cells. A: Dose-dependent insulin secretion into the medium of ARIP cells cultured in serum-free medium containing 12 mmol/l glucose in the presence or absence of various concentrations of GLP-1 for 72 h. First lane on the right: fresh unused culture medium; other lanes: the insulin level in the culture media from ARIP cells cultured in the presence of the indicated concentrations of GLP-1. B: Time course of insulin secretion in medium containing 12 mmol/l glucose in the presence of GLP-1 (10 nmol/l) for various lengths of time. Values represent the amount of insulin in the medium after an indicated time. Each experiment was repeated at least four times, and the data plotted on the graph represent the mean ± SD. Statistical significance of the data was evaluated by unpaired Student’s t test: *P < 0.05, **P < 0.01; ***P < 0.0001. In A, the significance of the data was evaluated by comparison of each sample with untreated ARIP cells; in B, the data were evaluated by analyzing the significance of the curve itself by ANOVA.

FIG. 4.

Dose- and time-dependent insulin accumulation in the culture medium of ARIP cells. A: Dose-dependent insulin secretion into the medium of ARIP cells cultured in serum-free medium containing 12 mmol/l glucose in the presence or absence of various concentrations of GLP-1 for 72 h. First lane on the right: fresh unused culture medium; other lanes: the insulin level in the culture media from ARIP cells cultured in the presence of the indicated concentrations of GLP-1. B: Time course of insulin secretion in medium containing 12 mmol/l glucose in the presence of GLP-1 (10 nmol/l) for various lengths of time. Values represent the amount of insulin in the medium after an indicated time. Each experiment was repeated at least four times, and the data plotted on the graph represent the mean ± SD. Statistical significance of the data was evaluated by unpaired Student’s t test: *P < 0.05, **P < 0.01; ***P < 0.0001. In A, the significance of the data was evaluated by comparison of each sample with untreated ARIP cells; in B, the data were evaluated by analyzing the significance of the curve itself by ANOVA.

FIG. 5.

Dose- and time-dependent insulin accumulation in the culture medium of PANC-1 cells. A: Dose-dependent insulin secretion in the medium of PANC-1 cells cultured in serum-free medium containing 12 mmol/l glucose in the presence of various concentrations of GLP-1. First lane on the right: fresh unused culture medium; other lanes: the insulin level in the culture media from PANC-1 cells cultured in the presence of the indicated concentrations of GLP-1. B: Dose-dependent insulin secretion of PANC-1 cells transfected with human IDX-1 and cultured in serum-free medium containing 12 mmol/l glucose in the presence of various concentrations of GLP-1 for 72 h. First lane on the right: fresh unused culture medium; other lanes: the insulin level in the culture media from cells cultured in the presence of various concentrations of GLP-1. C: Time course of insulin secretion into the medium of PANC-1 cells transfected with human IDX-1 and cultured in serum-free medium containing 12 mmol/l glucose in the presence of GLP-1 (10 nmol/l). Each experiment was repeated at least four times and the data plotted on the graph represent the mean ± SD. Statistical significance of the data were evaluated by unpaired Student’s t test: *P < 0.05, **P < 0.01; ***P < 0.0001. No statistical significance was determined for the data presented in A. In B, the significance of the data was evaluated by comparison of each sample with untreated PANC-1 cells; in C, the data were evaluated by analyzing the significance of the curve itself by ANOVA.

FIG. 5.

Dose- and time-dependent insulin accumulation in the culture medium of PANC-1 cells. A: Dose-dependent insulin secretion in the medium of PANC-1 cells cultured in serum-free medium containing 12 mmol/l glucose in the presence of various concentrations of GLP-1. First lane on the right: fresh unused culture medium; other lanes: the insulin level in the culture media from PANC-1 cells cultured in the presence of the indicated concentrations of GLP-1. B: Dose-dependent insulin secretion of PANC-1 cells transfected with human IDX-1 and cultured in serum-free medium containing 12 mmol/l glucose in the presence of various concentrations of GLP-1 for 72 h. First lane on the right: fresh unused culture medium; other lanes: the insulin level in the culture media from cells cultured in the presence of various concentrations of GLP-1. C: Time course of insulin secretion into the medium of PANC-1 cells transfected with human IDX-1 and cultured in serum-free medium containing 12 mmol/l glucose in the presence of GLP-1 (10 nmol/l). Each experiment was repeated at least four times and the data plotted on the graph represent the mean ± SD. Statistical significance of the data were evaluated by unpaired Student’s t test: *P < 0.05, **P < 0.01; ***P < 0.0001. No statistical significance was determined for the data presented in A. In B, the significance of the data was evaluated by comparison of each sample with untreated PANC-1 cells; in C, the data were evaluated by analyzing the significance of the curve itself by ANOVA.

FIG. 6.

Glucose-dependent insulin secretion. ARIP (A) and PANC-1 cells (transfected with human IDX-1) (B) were cultured in serum-free medium with GLP-1 (10 nmol/l for 72 h), or vehicle, in the presence of various concentrations of glucose (0, 0.1, 1, 3, 6, 10, and 20 mmol/l). Each experiment was repeated three times, and the data plotted on the graph represent the mean ± SD. Insulin levels were normalized for total protein content in each individual sample of culture medium. Statistical significance of the data was evaluated by ANOVA.

FIG. 6.

Glucose-dependent insulin secretion. ARIP (A) and PANC-1 cells (transfected with human IDX-1) (B) were cultured in serum-free medium with GLP-1 (10 nmol/l for 72 h), or vehicle, in the presence of various concentrations of glucose (0, 0.1, 1, 3, 6, 10, and 20 mmol/l). Each experiment was repeated three times, and the data plotted on the graph represent the mean ± SD. Insulin levels were normalized for total protein content in each individual sample of culture medium. Statistical significance of the data was evaluated by ANOVA.

FIG. 7.

Northern blot analysis for islet cell transcripts. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured in serum-free medium with or without GLP-1 (10 nmol/l for 72 h) and subjected to Northern blot analysis for the detection of IDX-1, insulin, and β-actin mRNAs. Rat pancreas was used as a positive control and rat kidney as a negative control. Lanes 1 and 2: ARIP cells cultured in the absence (1) or presence (2) of GLP-1; lanes 3 and 4: PANC-1 cells cultured in the absence (3) or presence (4) of GLP-1; lanes 5 and 6: PANC-1 cells transfected with human IDX-1 and cultured in the absence (5) or presence (6) of GLP-1; lane 7: rat kidney; lane 8: rat pancreas. Each experiment was repeated three times using RNA samples from independent cultures.

FIG. 7.

Northern blot analysis for islet cell transcripts. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured in serum-free medium with or without GLP-1 (10 nmol/l for 72 h) and subjected to Northern blot analysis for the detection of IDX-1, insulin, and β-actin mRNAs. Rat pancreas was used as a positive control and rat kidney as a negative control. Lanes 1 and 2: ARIP cells cultured in the absence (1) or presence (2) of GLP-1; lanes 3 and 4: PANC-1 cells cultured in the absence (3) or presence (4) of GLP-1; lanes 5 and 6: PANC-1 cells transfected with human IDX-1 and cultured in the absence (5) or presence (6) of GLP-1; lane 7: rat kidney; lane 8: rat pancreas. Each experiment was repeated three times using RNA samples from independent cultures.

FIG. 8.

RT-PCR analysis of islet β-cell–specific transcripts. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured in serum-free medium and treated with GLP-1 (10 nmol/l), vehicle alone, or exendin-9 (100 nmol/l) and subjected to RT-PCR for insulin, glucokinase (GK), the β-cell glucose transporter GLUT2, and β-actin. A: Lane 1: ARIP cells treated with vehicle alone; lane 2: ARIP cells cultured in the presence of exendin-9 (100 nmol/l) for 72 h; lanes 3–6: ARIP cells treated with GLP-1 for 24 h (lane 3), 48 h (lane 4), 72 h (lane 5), and 96 h (lane 6). B: Lanes 1 and 2: PANC-1 cells treated with vehicle alone (lane 1) or GLP-1 (lane 2); lanes 3–7: PANC-1 cells transfected with human IDX-1 and treated with exendin-9 for 72 h (lane 3) or GLP-1 for 0 h (lane 4), 24 h (lane 5), 48 h (lane 6), 72 h (lane 7), and 96 h (lane 8). Each experiment was repeated three times using RNA samples from independent cultures.

FIG. 8.

RT-PCR analysis of islet β-cell–specific transcripts. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured in serum-free medium and treated with GLP-1 (10 nmol/l), vehicle alone, or exendin-9 (100 nmol/l) and subjected to RT-PCR for insulin, glucokinase (GK), the β-cell glucose transporter GLUT2, and β-actin. A: Lane 1: ARIP cells treated with vehicle alone; lane 2: ARIP cells cultured in the presence of exendin-9 (100 nmol/l) for 72 h; lanes 3–6: ARIP cells treated with GLP-1 for 24 h (lane 3), 48 h (lane 4), 72 h (lane 5), and 96 h (lane 6). B: Lanes 1 and 2: PANC-1 cells treated with vehicle alone (lane 1) or GLP-1 (lane 2); lanes 3–7: PANC-1 cells transfected with human IDX-1 and treated with exendin-9 for 72 h (lane 3) or GLP-1 for 0 h (lane 4), 24 h (lane 5), 48 h (lane 6), 72 h (lane 7), and 96 h (lane 8). Each experiment was repeated three times using RNA samples from independent cultures.

FIG. 9.

GLP-R expression in ARIP and PANC-1 cells. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured in serum-free medium and treated with GLP-1 (10 nmol/l), or vehicle alone, for 72 h. RT-PCR for GLP-R and β-actin was performed with a cycle-titration PCR (15, 20, 25, and 30 PCR cycles) to assess the relative abundance of GLP-R transcript. Primers for both transcripts were added together in a single PCR for each individual sample. A: ARIP cells cultured with vehicle alone or GLP-1; B: PANC-1 cells cultured with vehicle alone or GLP-1; C: PANC-1/IDX-1 cells culture with vehicle alone or GLP-1. Each experiment was repeated four times, using RNA samples from independent cultures. The blots on the left represent one individual experiment, whereas the graphs on the right are the average of four independent experiments. The numeric values in the graphs represent the ratio of GLP-R mRNA to actin mRNA.

FIG. 9.

GLP-R expression in ARIP and PANC-1 cells. ARIP and PANC-1 cells (transfected with human IDX-1 or solely with the neomycin-resistant gene) were cultured in serum-free medium and treated with GLP-1 (10 nmol/l), or vehicle alone, for 72 h. RT-PCR for GLP-R and β-actin was performed with a cycle-titration PCR (15, 20, 25, and 30 PCR cycles) to assess the relative abundance of GLP-R transcript. Primers for both transcripts were added together in a single PCR for each individual sample. A: ARIP cells cultured with vehicle alone or GLP-1; B: PANC-1 cells cultured with vehicle alone or GLP-1; C: PANC-1/IDX-1 cells culture with vehicle alone or GLP-1. Each experiment was repeated four times, using RNA samples from independent cultures. The blots on the left represent one individual experiment, whereas the graphs on the right are the average of four independent experiments. The numeric values in the graphs represent the ratio of GLP-R mRNA to actin mRNA.

FIG. 10.

Flow cytometric analysis. ARIP and PANC-1 (parental- and IDX-1–transfected) cells were treated with GLP-1 (10 nmol/l) or vehicle for 72 h and stained with fluorescent antibodies against insulin. AG show a representative experiment for each individual experimental condition of five replicate analyses that were performed. A and B: ARIP cells cultured in the presence of vehicle (A) or GLP-1 (B). C and D: parental PANC-1 cells cultured in the presence of vehicle (C) or GLP-1 (D). E and F: PANC-1 cells transfected with the human IDX-1 gene cultured in the presence of vehicle (E) or GLP-1 (F). G: PANC-1 cells cultured in the presence of GLP-1 and stained solely with an unspecific isotype-matched FITC-conjugated antibody without the primary antibody. A summary of independent experiments is presented in the lower section of the figure.

FIG. 10.

Flow cytometric analysis. ARIP and PANC-1 (parental- and IDX-1–transfected) cells were treated with GLP-1 (10 nmol/l) or vehicle for 72 h and stained with fluorescent antibodies against insulin. AG show a representative experiment for each individual experimental condition of five replicate analyses that were performed. A and B: ARIP cells cultured in the presence of vehicle (A) or GLP-1 (B). C and D: parental PANC-1 cells cultured in the presence of vehicle (C) or GLP-1 (D). E and F: PANC-1 cells transfected with the human IDX-1 gene cultured in the presence of vehicle (E) or GLP-1 (F). G: PANC-1 cells cultured in the presence of GLP-1 and stained solely with an unspecific isotype-matched FITC-conjugated antibody without the primary antibody. A summary of independent experiments is presented in the lower section of the figure.

TABLE 1

PCR information

Target genePrimer sequenceSize of PCR product (bp)
Rat 
 Insulin CCTGCCCAGGCTTTTGTCAA(+) 187 
 CTCCAGTGCCAAGTCTGAA(−) 
 GLUT2 TTAGCAACTGGGTCTGCAAT(+) 343 
 GGTGTAGTCCTACACTCATG(−) 
 GK AAGGGAACAACATCGTAGGA(+) 136 
 CATTGGCGGTCTTCATAGTA(−) 
 β-Actin CGTAAAGACCTCTATGCCAA(+) 349 
 AGCCATGCCAAATGTCTCAT(−) 
 GLP-R TCTCTTCTGCAACCGAACCT(+) 350 
 CTGGTGCAGTGCAAGTGTCT(−) 
Human 
 Insulin CTCACACCTGGTGGAAGCTC(+) 212 
 AGAGGGAGCAGATGCTGGTA(−) 
 GLUT2 AGCTTTGCAGTTGGTGGAAT(+) 300 
 AATAAGAATGCCCGTGACGA(−) 
 GK TGGACCAAGGGCTTCAAGGCC(+) 207 
 CATGTAGCAGGCATTGCAGCC(−) 
 β-Actin GTGGGGCGCCCCAGGCACCA(+) 392 
 CTCCTTAATGTCACGCACGATTTC(−) 
 GLP-R GTGTGGCGGCCAATTACTAC(+) 347 
 CTTGGCAAGTCTGCATTTGA(−) 
Target genePrimer sequenceSize of PCR product (bp)
Rat 
 Insulin CCTGCCCAGGCTTTTGTCAA(+) 187 
 CTCCAGTGCCAAGTCTGAA(−) 
 GLUT2 TTAGCAACTGGGTCTGCAAT(+) 343 
 GGTGTAGTCCTACACTCATG(−) 
 GK AAGGGAACAACATCGTAGGA(+) 136 
 CATTGGCGGTCTTCATAGTA(−) 
 β-Actin CGTAAAGACCTCTATGCCAA(+) 349 
 AGCCATGCCAAATGTCTCAT(−) 
 GLP-R TCTCTTCTGCAACCGAACCT(+) 350 
 CTGGTGCAGTGCAAGTGTCT(−) 
Human 
 Insulin CTCACACCTGGTGGAAGCTC(+) 212 
 AGAGGGAGCAGATGCTGGTA(−) 
 GLUT2 AGCTTTGCAGTTGGTGGAAT(+) 300 
 AATAAGAATGCCCGTGACGA(−) 
 GK TGGACCAAGGGCTTCAAGGCC(+) 207 
 CATGTAGCAGGCATTGCAGCC(−) 
 β-Actin GTGGGGCGCCCCAGGCACCA(+) 392 
 CTCCTTAATGTCACGCACGATTTC(−) 
 GLP-R GTGTGGCGGCCAATTACTAC(+) 347 
 CTTGGCAAGTCTGCATTTGA(−) 

GK, glucokinase.

This study was supported in part by the American Federation for Aging Research.

We would like to thank Rita Velikina and Dr. Run Yu for their technical support. We are very grateful to Patricia Merkel for the critical reading of the manuscript.

1.
Teitelman G, Lee JK: Cell lineage analysis of pancreatic islet cell development: glucagon and insulin cells arise from catecholaminergic precursor present in the pancreatic duct.
Dev Biol
121
:
454
–466,
1987
2.
Pictet RL, Clark WR, Williams RH, Rutter WJ: An ultrastructual analysis of the developing embryonic pancreas.
Dev Biol
29
:
436
–467,
1972
3.
Jonsson J, Carlsson L, Edlund T, Edlund H: Insulin-promoter factor 1 is required for pancreas development in mice.
Nature
371
:
606
–609,
1994
4.
Ahlgren U, Pfaff SL, Jessell TM, Edlund T, Edlund H: Independent requirement for ISL1 in formation of pancreatic mesenchyme and islet cells.
Nature
385
:
257
–260,
1997
5.
Naya FJ, Huang HP, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB, Tsai MJ: Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/NeuroD-deficient mice.
Genes Dev
11
:
2323
–2334,
1997
6.
Sosa-Pineda B, Chowdhury K, Torres M, Oliver G, Gruss P: The Pax4 gene is essential for differentiation of insulin-producing β cells in the mammalian pancreas.
Nature
386
:
399
–402,
1997
7.
Bonner-Weir S, Baxter LA, Schuppin GT, Smith FE: A second pathway for regeneration of adult exocrine and endocrine pancreas: a possible recapitulation of embryonic development.
Diabetes
42
:
1715
–1720,
1993
8.
Xu G, Stoffers DA, Habener JF, Bonner-Weir S: Exendin-4 stimulates both β-cell replication and neogenesis, resulting in increased β-cell mass and improved glucose tolerance in diabetic rats.
Diabetes
48
:
2270
–2276,
1999
9.
Wang Y, Perfetti R, Greig NH, Holloway HW, DeOre KA, Montrose-Rafizadeh C, Elahi D, Egan JM: Glucagon-like peptide-1 can reverse the age-related decline in glucose tolerance in rats.
J Clin Invest
99
:
2883
–2889,
1997
10.
Elstner E, Linker-Israeli M, Le J, Umiel T, Michl P, Said JW, Binderup L, Reed JC, Koeffler HP: Synergistic decrease of clonal proliferation, induction of differentiation, and apoptosis of acute promyelocytic leukemia cells after combined treatment with novel 20-epi vitamin D3 analogs and 9-cis retinoid acid.
J Clin Invest
99
:
349
–360,
1997
11.
Kaneto H, Miyagawa J, Kajimoto Y, Yamamoto K, Watada H, Umayahara Y, Hanafusa T, Matsuzawa Y, Yamasaki Y, Higashiyama S, Taniguchi N: Expression of heparin-binding epidermal growth factor-like growth factor during pancreas development: a potential role of PDX-1 in transcriptional activation.
J Biol Chem
272
:
29137
–29143,
1997
12.
Habener JF, Stoffers DA: A newly discovered role of transcription factors involved in pancreas development and the pathogenesis of diabetes mellitus.
Proc Assoc Am Phys
110
:
12
–21,
1998
13.
Bouwens L: Transdifferentiation versus stem cell hypothesis for the regeneration of islet β-cells in the pancreas.
Microsc Res Tech
43
:
332
–336,
1998
14.
Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC: Chronic hyperglycemia triggers loss of pancreatic β cell differentiation in an animal model of diabetes.
J Biol Chem
274
:
14112
–14121,
1999
15.
Finegood DT, Weir GC, Bonner-Weir S: Prior streptozotocin treatment does not inhibit pancreas regeneration after 90% pancreatectomy in rats.
Am J Physiol
276
:
E822
–E827,
1999
16.
Wang RN, Bouwens L, Kloppel G: β-Cell growth in adolescent and adult rats treated with streptozotocin during the neonatal period.
Diabetologia
39
:
548
–557,
1996
17.
Ramiya VK, Maraist M, Arfors KE, Schatz DA, Peck AE, Conrnelius JG: Reversal of insulin-dependent diabetes using islets generated in vitro from pancreatic stem cells.
Nat Med
6
:
278
–282,
2000
18.
Bonner-Weir S, Taneja M, Weir GC, Tatarkiewicz K, Song KH, Sharma A, O’Neil JJ: In vitro cultivation of human islets from expanded ductal tissue.
Proc Natl Acad Sci U S A
97
:
7999
–8004,
2000

Address correspondence and reprint requests to Riccardo Perfetti, MD, Div. Endocrinology and Metabolism, Becker Building, Room B-131, Department of Medicine, Cedars-Sinai Medical Center, 8700 Beverly Blvd., Los Angeles, CA 90048. E-mail: perfettir@cshs.org.

Received for publication 21 April 2000 and accepted in revised form 12 December 2000.