Impairment of the fibrinolytic system, caused primarily by increases in the plasma levels of plasminogen activator inhibitor (PAI) type 1, are frequently found in diabetes and the insulin-resistance syndrome. Among the factors responsible for the increases of PAI-1, insulin has recently attracted attention. In this study, we analyzed the effects of insulin on PAI-1 biosynthesis in HepG2 cells, paying particular attention to the signaling network evoked by this hormone. Experiments performed in CHO cells overexpressing the insulin receptor indicate that insulin increases PAI-1 gene transcription through interaction with its receptor. By using inhibitors of the different signaling pathways evoked by insulin-receptor binding, it has been shown that the biosynthesis of PAI-1 is due to phosphatidylinositol (PI) 3-kinase activation, followed by protein kinase C and ultimately by mitogen-activated protein (MAP) kinase activation and extracellular signal–regulated kinase 2 phosphorylation. We also showed that this pathway is Ras-independent. Transfection of HepG2 cells with several truncations of the PAI-1 promoter coupled to a CAT gene allowed us to recognize two major response elements located in the regions between −804 and −708 and between −211 and −54. Electrophoretic mobility shift assay identified three binding sites for insulin-induced factors, all colocalized with putative Sp1 binding sites. Using supershifting antibodies, the binding of Sp1 could only be confirmed at the binding site located just upstream from the transcription start site of the PAI-1 promoter. A construct comprising four tandem repeat copies of the −93/−62 region of the PAI-1 promoter linked to CAT was transcriptionally activated in HepG2 cells by insulin. These results outline the central role of MAP kinase activation in the regulation of PAI-1 induced by insulin.

Insulin is the most important hormone regulating energy metabolism. Since its discovery, insulin has been subjected to extensive research to elucidate its activity in a variety of metabolic processes, including glucose homeostasis, substrate metabolism, gene transcription, protein synthesis, and protein degradation (1). A considerable body of evidence supports the hypothesis that hyperinsulinemia is a risk factor for the development of macrovascular disease, manifesting mostly as coronary artery disease (2,3,4). Hyperinsulinemia has been associated with coronary heart disease in nondiabetic people (5). Although many mechanisms are responsible, one factor implicated is impaired fibrinolysis, secondary to overexpression of the primary physiological inhibitor of plasminogen activator, plasminogen activator inhibitor (PAI) type 1 (6). Plasma PAI-1 activity and concentration parallel the extent of hyperinsulinemia in several metabolic conditions, and insulin has been implicated as the major physiological regulator of PAI-1 (7). PAI-1 in blood may derive from endothelial cells, adipocytes, and hepatocytes. A direct effect of insulin in stimulating PAI-1 production has been reported in various cell types (8,9,10). Moreover, insulin has been shown to induce PAI-1 secretion in human hepatocytes in vitro as well as in human umbilical vein endothelial cells genotyped by a HindIII restriction fragment–length polymorphism (11).

The signal transduction pathway evoked by insulin has recently been partially disentangled (12). However, no information is yet available that identifies the signaling network as well as the transcriptional machinery evoked by insulin in the induction of PAI-1 biosynthesis. In this study, we have investigated the receptor-mediated mechanisms involved in insulin activation of the PAI-1 gene. The data indicate that PAI-1 induction is the result of phosphatidylinositol (PI) 3-kinase and protein kinase (PK)-C, whereas Ras does not play an obligatory role in this pathway. Mitogen-activated protein (MAP) kinase activation and extracellular signal–regulated kinase (ERK) 2 phosphorylation (a downstream event of PKC stimulation) result in activation of nuclear transcription factors—of which Sp1 is the most likely candidate—leading to PAI-1 gene induction.

Materials.

Minimal essential medium (MEM) and fetal calf serum (FCS) were from Gibco, Life Technologies (Milan, Italy). Mycoplasma detection kit and anti-mouse IgG–horseradish-peroxidase antibody were from Boehringer Mannheim (Mannheim, Germany). Plastic ware for cell culture was from Costar (Cambridge, MA). F1–5 enzyme-linked immunosorbent assay (ELISA) for PAI-1 antigen detection was from Monozyme (Copenhagen). [γ-32P]ATP (specific activity 3,000 Ci/mmol) and the ECL detection system were from Amersham (Milan, Italy). Rabbit polyclonal antibody against phosphospecific p44/p42 MAPK was from New England Biolabs, Celbio (Milan, Italy). Antibody anti–AP-1 (sc-44x) and anti-Sp1 (sc-59x), which is not reactive to Sp2 or Sp3, were from Santa Cruz Biotechnology. Other reagents were from Sigma Chemical (St. Louis, MO). Dominant-negative p21ras mutant plasmid, p21(Asn-17)Hras, was kindly provided by Dr. A. Maggi (Milano Molecular Pharmacology Laboratory, University of Milan, Milan, Italy).

Chemicals.

1-(5-isoquinolinylsulfonyl)-2-methylpiperazine (H7), genistein, phenylmethylsulfonyl fluoride (PMSF), and phorbol 12-myristate 13-acetate(PMA), manumycin A, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one(LY294002), and N-acetyl-S-trans,trans-farnesyl-l-cysteine (ACF) were from Sigma; rapamycin and calphostin C were from Biomol Research Laboratories (Plymouth Meeting, PA); and 2′-amino-3′-methoxyflavone (PD98059) was from New England Biolabs (Beverly, MA). Simvastatin in lactone form was from Merck, Sharp & Dohme Research Laboratories (Woodbridge, NJ). H7 was dissolved in sterile distilled water, and all other chemicals were dissolved in DMSO or ethanol.

Cell culture.

HepG2 cells were cultured as previously described (13). The cell line was found free of mycoplasma infection. For the experiments, cells were plated at 1.5 × 104 in 12-well plates and used at subconfluency after a 24-h preincubation in serum-free medium. Cells were incubated in the presence or absence of insulin with appropriate chemicals or vehicle additions (DMSO or ethanol, 0.1% vol/vol). Both agents (DMSO and ethanol) did not influence biochemical response or PAI-1 by HepG2 cells and did not induce cytotoxicity, as judged by morphology and trypan blue exclusion.

Transfection of insulin receptor and selection of cell lines.

Stable transfected CHO were provided by Dr. Eric Clauser (Institut National de la Santé et de la Recherche Médicale [INSERM] U36, Chaire de Médecine Expérimentale, Collège de France, Paris). The stable transfection of CHO cells with the wild-type human insulin receptor cDNA (TBF4) and the selection of clones were achieved by the double-transfection technique with a neomycin-resistant plasmid (pSV2neo) and by selection with the neomycin analog G418, as previously described (14).

Transfection assay.

HepG2 cells were transfected using a calcium phosphate precipitation method as described by Sambrook et al. (15). pRSV-galactosidase control vector (Promega) was cotransfected as an internal control. The construction of the PAI-1 CAT plasmids has been described elsewhere (16). The 4G-PAI-pCAT construct comprises the human PAI-1 sequences −804 to 17. The truncated promoter constructs −708-PAI-pCAT, −609-PAI-pCAT, −502-PAI-pCAT, −400-PAI-pCAT, −302-PAI-pCAT, −211-PAI-pCAT, −103-PAI-pCAT, and −54-PAI-pCAT were constructed from the 4G-PAI-pCAT as previously described (16).

The (HIV)-CAT, 1xIRE-HCAT, and 4xIRE-HCAT vectors were constructed using a set of the double-stranded oligonucleotides 5′GATCCCCAGAGCCAGTGAGTGGGTGGGGCTGGAACA (upper strand) and 5′-GATCTGTTCCAGCCCCACCCACTCACTGGCTCTGGG (lower strand) constituting the −93/−62 region of the PAI-1 promoter flanked by BamHI and BglII ends. One or four double-stranded oligonucleotides were ligated head-to-tail into BamHI-restricted HIV-CAT vector (17). The correct sequence and orientation of the inserts was tested by DNA sequencing. CAT was assayed by ELISA with a commercially available kit (Boehringer Mannheim) according to the manufacturer’s instructions. β-galactosidase activity was assayed as previously described (15).

Quantification of PAI-1 antigen.

The concentration of PAI-1 in conditioned medium of HepG2 cells was assayed by specific ELISA (13). The possible interference of compounds with the assay was excluded by experiments in which PAI-1 antigen was determined in medium containing different concentrations of the compounds.

MAP kinase.

For MAP kinase activity, HepG2 cells were incubated in MEM containing 0.1% FCS for 48 h, then with medium alone for 24 h, and finally with 100 nmol/l insulin for different times. Cells were washed and scraped in 0.5 ml of homogenization buffer, and MAP kinase activity was determined as previously described (13,18).

MAP kinase immunoblotting was performed with cell lysates prepared in Laemmli’s buffer (19) as previously described (13), using an antibody against phospho-specific p44/p42 MAPK, which detects p42 and p44 MAP kinases (ERK1 and ERK2) only when activated by phosphorylation at tyrosine 204 and threonine 202. After incubation with horseradish-peroxidase–conjugated secondary antibody, the blot was developed using the Amersham enhanced chemiluminescence system.

Electromobility shift assay.

Nuclear extracts were prepared essentially as described by Alksnis et al. (20). Protein concentration was determined spectrophotometrically (21). Equal amounts of protein from nuclear extracts (1 μg) were incubated on ice with 2 μg of poly(dI-dC) and 1 μg of acetylated bovine serum albumin in binding buffer (giving the final concentrations stated below) for 10 min (22). The oligonucleotide probe (50,000 cpm in 5 μl) was added, and the reaction mixture (25 μl) was incubated for 25 min at room temperature. Final concentrations in binding reactions were as follows: 10% glycerol and (in mmol/l) 10 HEPES (pH 7.9), 60 KCl, 5 MgCl2, 0.5 EDTA, 1 dithiothreitol, and 1 PMSF. DNA-protein complexes were separated from unbound DNA probe on native 7% polyacrylamide gels (acrylamide:bisacrylamide [wt/wt 80:1] in low ionic-strength buffer containing (in mmol/l) 22.5 Tris, 22.5 borate, and 0.5 EDTA (pH 8) by electrophoresis at 200 V for 2 h. The sequences of the double-stranded oligonucleotide probes (labeled with T4 kinase and [γ-32P]ATP and purified using Pharmacia NICK Sephadex G50 columns) were as follows: 1, GCTTTTACCATGGTAACCCCTGGTCCCGTTCAGCCAC; 2, TTCAGCCACCACCACCCCACCCAGCACACCTCCAAC; 3, CCTCCAACCTCAGCCAGACAAGGTTGTTGACACAAGAGAGC; 4, CATGCCTCAGCAAGTCCCAGAGAGGGAGG; 5, CCCAGAGCCAGTGAGTGGGTG-GGGCTGGAAC; 6, GGAACATGAGTTCATCTAT; 7, TCTATTTCCTGCCCACATCTG.

For supershift analysis, 1 μg of the relevant antibodies was added after the binding buffer solution, and the incubation time on ice was increased from 10 to 35 min. Unlabeled competitor oligonucleotides were added in 50-fold excess to confirm the specificity of the binding reactions.

Statistical analysis.

Data are expressed as means ± SE. Statistical comparison of control with treated groups was performed by ANOVA repeated measures followed by Tukey’s test. The accepted level of significance was P < 0.05; n = number of individual experiments performed in duplicate or triplicate, as indicated.

Effect of insulin on PAI-1 biosynthesis.

In the present study, insulin was incubated with cells for 16 h, and PAI-1 was determined in conditioned medium. Insulin increased PAI-1 secretion from the cells with maximal effect at 100 nmol/l (Fig. 1A); this confirmed previous data (23). Transfection studies performed with a fragment (804 bp) of the PAI-1 promoter coupled to a CAT gene showed that insulin induced transcription of the PAI-1 promoter by 2.2-fold (n = 8, P < 0.01 vs. control) (Fig. 1B).

A tyrosine kinase inhibitor, genistein, added to the cells for 1 h before 100 nmol/l insulin inhibited insulin-induced PAI-1 secretion in a concentration-dependent manner, which suggests that tyrosine phosphorylation is required for PAI-1 biosynthesis (Fig. 2). We therefore investigated the possible involvement of the insulin receptor in this process. CHO cells that were stable overexpressing the insulin receptor (TBF4) were transiently transfected with the PAI-1 promoter. Insulin induced a 14-fold increase in PAI-1 transcription in cells overexpressing insulin receptor, whereas in cells stable transfected with the empty vector (pSVNeo) and in normal CHO cells, insulin only doubled PAI-1 transcription (Fig. 3).

The role of the insulin receptor was further supported by experiments in which desensitization of the insulin receptor by prior exposure of HepG2 cells to 100 nmol/l insulin for 24 h led to reduced insulin stimulation (data not shown). These data suggest that insulin increases PAI-1 biosynthesis in HepG2 cells via an interaction with its receptor. The following studies provided insight into the mechanisms participating in the insulin-induced elevation of PAI-1 expression.

Signaling pathways involved in PAI-1 secretion induced by insulin.

Role of PI 3-kinase.

PI 3-kinase activation is a critical step in the regulation of the insulin-signaling pathway and glucose uptake (24). We therefore investigated whether insulin would increase PAI-1 through stimulation of PI 3-kinase activation. LY294002, a highly specific PI 3-kinase inhibitor (25), did not influence basal PAI-1 secretion, but it prevented the effect of insulin on secretion and transcription of PAI-1 in a concentration-dependent manner (Figs. 4A and B).

Role of Ras in insulin regulation of PAI-1.

The role of Ras in the insulin regulation of PAI-1 was first investigated by blocking farnesylation of Ras with a farnesyltransferase inhibitor, manumycin A (26). At concentrations up to 5 μmol/l, manumycin A did not affect the ability of insulin to induce PAI-1 secretion; rather, manumycin A significantly increased it (Fig. 5A). Moreover, pretreatment of cells with an inhibitor of hydroxymethylglutaryl-CoA-reductase (27) at a concentration known to inhibit farnesylation of Ras proteins (simvastatin 10 μmol/l) did not influence insulin-induced PAI-1 secretion (data not shown). Similar results were obtained with ACF at concentrations known to inhibit Ras carboxyl methylation (10–50 μmol/l) (28) (Fig. 5B). PAI-1 transcription was doubled in cells cotransfected with −804 bp PAI-1 promoter and different concentrations of dominant-negative Ras, p21(Asn-17)Hras, which interferes with the activity of son-of-sevenless (SOS), preventing exchange of GDP for GTP on endogenous Ras and interfering with downstream signaling (29). Insulin further enhanced this increase in PAI-1 transcription (Fig. 5C).

Role of S6 kinase in insulin regulation of PAI-1.

S6 kinase has been shown to be a downstream target of PI 3-kinase; in several cell types, rapamycin blocks the stimulation of this enzyme by insulin (30). Rapamycin at concentrations up to 10 nmol/l did not reduce insulin-induced secretion or transcription of PAI-1, but rather increased it (Fig. 6, panel A and B). This suggests that PAI-1 biosynthesis by insulin does not involve a rapamycin-sensitive pathway in PAI-1 production.

Insulin-induced PAI-1 release is dependent on PKC.

The relationship between PKC activation and PAI-1 secretion was then investigated. The PKC inhibitors H7 (35 μmol/l) and calphostin C (2 μmol/l) completely prevented PAI-1 induction by insulin (Figs. 7A and C). In additional experiments, HepG2 cells were treated with vehicle or 100 nmol/l PMA for 24 h to downregulate PKC (31). The supernatant was then replaced with serum-free medium or supplemented with 100 nmol/l insulin or 100 nmol/l PMA. In cells preincubated with vehicle, insulin and PMA increased PAI-1 secretion by 217% ± 12 and 700% ± 90 (n = 4), respectively. After downregulation of PKC, insulin- and PMA-induced PAI-1 secretion was lowered by 70% ± 10 and 80% ± 9, respectively (P < 0.01 vs. control, n = 4), further confirming that PKC activation is involved in insulin-induced PAI-1 secretion.

PAI-1 regulation by MAP kinase.

Insulin caused MAP kinase activation within 5 min (P < 0.01) and a rapid time-dependent phosphorylation of the p42 (ERK2) isoform of MAP kinase (Figs. 8A–C). Phosphorylation of the ERK2 isoform was reduced in cells preincubated with LY294002 and H7 (Figs. 8B and C). PD98059, at a concentration known to inhibit MAP/ERK (MEK) kinase >50% (32), inhibited both basal and insulin-stimulated PAI-1 secretion and PAI-1 gene transcription by >75% (P < 0.01), which suggests that MAP kinase is necessary for insulin-induced PAI-1 (Figs. 8D and E).

Mapping of the insulin-responsive element in PAI-1 promoter.

To localize the regulatory elements responsible for the induction of PAI-1 transcriptional activation by insulin, HepG2 cells were transfected with several truncations of the promoter coupled to a CAT gene. Successive 100-bp segments were deleted from the initial promoter construct containing 804 bp of the proximal promoter (16). Figure 9 shows schematically the deletions and relative promoter activity of insulin-challenged extracts. The deletion of 100 bp starting from 5′ yielded 60% the activity of the −804 bp probe used as positive control. Further deletions up to −302 bp did not effectively modify PAI-1 transcription, but a further reduction was observed at −103 bp, with minimal promoter activity recovered with the −54 bp probe. We therefore evaluated potential binding regions for any insulin-inducible transcription factors that could mediate transcriptional activation. For this purpose, seven overlapping electromobility shift assay (EMSA) probes were constructed that covered the region from −804 to −708 and from −211 to −54 of the PAI-1 promoter. HepG2 cells were exposed to insulin from 1 to 8 h, and nuclear extracts were prepared. The specificity of the binding was analyzed by including unlabeled EMSA probes in excess as competitors. Insulin-induced binding of nuclear proteins was detected with the −777/−741, −157/−128, and −93/−62 probes (Fig. 10).

Because these probes coincide with putative Sp1 response elements, the presence of Sp1 in the insulin-induced complexes was evaluated. Excess unlabeled Sp1 oligonucleotide effectively prevented complex formation only on the −93/−62 construct, and an antibody against Sp1 supershifted the complex (Fig. 10). Jun/Fos antibody did not influence the formation of any complex with the EMSA probes tested. The induction of Sp1 was time-dependent, starting from 4 h and peaking at 8 h (Fig. 10C). Interestingly, a consensus double-stranded AP-1 oligonucleotide bound an insulin-induced factor (data not shown).

To determine whether the increased binding of Sp1 to this region was responsible for the increased function of the PAI-1 promoter in response to insulin, experiments with a reporter gene containing one or four repeats of the −93/−62 region were performed. We found a 51% ± 20 and 53% ± 20 (n = 6) stimulation of CAT synthesis by insulin in cells transfected with (HIV)-CAT and 1xIRE-HCAT plasmids, respectively. In cells transfected with a 4xIRE-HCAT construct, insulin further increased CAT synthesis (+96% ± 24, n = 6; P < 0.05 vs. HIV-CAT and 1xIRE-HCAT).

High levels of PAI-1 in plasma constitute an independent risk factor for recurrent myocardial infarction and are found elevated in type 2 diabetes, hypertriglyceridemia, and insulin-resistance syndrome. Moreover, the level of fasting insulin correlates positively with PAI-1 concentration (33,34). However, as yet there has been no evidence of a direct effect of insulin on PAI-1 in vivo in humans (35,36). Exploration of the insulin-fibrinolytic axis in vivo is a difficult task, and the negative results may derive from the study design and/or from the fact that because insulin infusion changes several metabolic variables, it is difficult to isolate the effect. Reducing insulin levels and insulin resistance by exercise, weight loss, and drugs such as metformin has, however, been shown to lower PAI-1 activity (37).

Insulin in vitro has been shown to increase PAI-1 antigen and mRNA in several cell systems (8,38), but the mechanism of the relevant signal transduction is as yet unknown. Regulation of gene expression by insulin has been studied for many years, but gaps still remain in our understanding (39).

Insulin was previously shown to increase PAI-1 protein through an effect on PAI-1 mRNA stabilization (40). We show here that insulin increases PAI-1 gene transcription and that this effect requires interaction of the hormone with its receptor. Thus, insulin may operate on two distinct mechanisms to increase the biosynthesis of this antifibrinolytic protein. Downstream of insulin receptor interaction is the activation of PI 3-kinase, which is an essential step for insulin-induced PAI-1 transcription, as we have shown. One protein lying downstream of PI 3-k is pp70 S6 kinase. This protein has been shown to be responsible for insulin-stimulated phosphorylation of the ribosomal protein S6 in vivo (41,42). Rapamycin, which blocks pp70 S6 kinase activation in several cell types, did not reduce insulin-induced PAI-1 transcription by HepG2 cells, which suggests that insulin increases PAI-1 in HepG2 cells via a rapamycin-insensitive pathway. In 3T3-L1 cells, glycogen synthase is inhibited by rapamycin (43), whereas insulin regulation of the same enzyme in PC-12 cells is rapamycin-insensitive (44). The insulin regulation of glycogen synthase kinase-3 (45), gene 33 (46), PEPCK (47), and 6-phospho-fructo-2-kinase (48) have also been shown to be rapamycin-insensitive.

Binding of PI 3-kinase to tyrosine-phosphorylated insulin receptor substrate (IRS) (49) induces its activation, with the concomitant phosphorylation of PI 4-phosphate and PI 4,5-bisphosphate to produce the physiologically significant regulators PI 3,4-diphosphate and PI 3,4,5-trisphosphate. These lipid products activate both protein kinase B and PKC. Binding of phosphoinositide 3,4-bisphosphate and/or phosphoinositide 3,4,5-triphosphate to different isoforms of PKC (ε, η, ζ, and λ) activates them (50,51). In HepG2 cells, inhibition of PKC prevented insulin-induced PAI-1 transcription, which suggests that this process also requires PKC activation, presumably occurring downstream of PI 3-kinase activation.

On the basis of different experimental approaches, the involvement of the Ras signaling pathway in insulin-induced PAI-1 biosynthesis was ruled out. Experiments in HepG2 cells transfected with dominant-negative p21(Asn-17)Hras confirm this hypothesis. Thus, insulin-induced PAI-1 transcription probably occurs as the result of PI 3-kinase activated directly via IRS-1 without the need for any additional input by activated Ras. PI 3-kinase activation may thus undergo interaction with PKC, which results in MAP kinase activation and ERK2 phosphorylation. Indeed, inhibition of PKC activation by H7 prevented ERK2 phosphorylation.

Mechanisms have been proposed for Ras-independent activation of MAP kinase (52). It has been reported (53,54) that inhibitors of PI 3-kinase inhibit insulin-induced increases in ERK1/2 activation in many cell types besides hepatocytes, similar to what we have found in our study. Moreover, inhibition of MEK kinase completely prevented insulin-induced PAI-1 transcription, indicating that MAP kinase activation is an obligatory step for this process.

Interestingly, inhibition of PI 3-kinase, PKC, and MAP kinase all resulted in the suppression of the insulin-induced secretion of PAI-1 protein. We have previously shown that with the exception of PI 3-kinase, a similar pathway (13) is responsible for PAI-1 induction by triglyceride-rich lipoproteins, which exert an additive or potentiating effect to that of insulin in inducing PAI-1 (23). Interestingly, it has been shown that when increased simultaneously, three components of the diabetic milieu (hyperglycemia, hyperinsulinemia, and hypertriglyceridemia) augment PAI-1 levels in vivo in healthy individuals (55).

Activated ERKs can translocate to the nucleus and lead to the phosphorylation and activation of transcriptional factors, with subsequent induction of several genes (56). Sequential-deletion reporter constructs of the PAI-1 gene indicated two major responsive regions located between −804 and −708 and between −211 and −54 from the start of the transcription site.

Sequences in the PAI-1 promoter region that are involved in the transcriptional regulation of PAI-1 have been identified previously. These have been shown to bind AP-1–, AP-2–, and Sp1-like proteins (57). Gel-shift experiments using nuclear extracts from HepG2 cells and labeled double-stranded oligomers representing seven regions containing putative binding sites for AP-1 and Sp1 revealed several DNA-protein complexes. Moreover, enhanced binding of nuclear factor was obtained with three of the seven oligonucleotides in cell extracts derived from insulin-treated HepG2 cells. Excess oligonucleotides representing the Sp1 consensus sequence showed competition for nuclear factors binding to the oligonucleotide covering the Sp1 region located at −93/−62 bp only. Supershift experiments confirmed that the Sp1 factor binds to this region. In contrast, the nuclear proteins recognizing oligonucleotides covering regions −777/−741 and −157/−128 could not be identified as Sp1 or AP-1. PMA, serum, and interleukin-1α have been previously reported to induce PAI-1 transcription involving the binding of Jun/Fos to putative AP-1 sites located at −58/−50 bp in PAI-1 promoter in HepG2 cells (57). Surprisingly, we could not identify any region specifically binding an AP-1 factor with nuclear extracts derived from insulin-treated cells.

Finally, insulin induced transcription was significantly increased in cells transfected with a construct bearing four copies of the −93/−62 region.

Thus, at least one Sp1 nuclear factor binding in the −93/−62 region of PAI-1 promoter may be involved in the upregulation of PAI-1 gene by insulin. Sp1 has been shown to mediate the actions of PKC on several genes. The stimulation of Sp1-mediated vascular permeability factor/vascular endothelial growth factor transcription required an interaction between Sp1 and PKCζ (58). More recently, Sp1 was shown to be essential in the 12-O-tetradecanoylphorbol-13-acetate stimulation of human lysosomal acid lipase gene activity in monocytes (59) and in the regulation of apoAI gene expression by PKA and PKC (60).

In conclusion, we have disentangled the signaling pathway evoked by the insulin-receptor interaction responsible for PAI-1 biosynthesis in HepG2 cells and identified PAI-1 promoter sequences required for this effect. We have also identified at least one Sp1 factor that could be involved in this process. Interestingly, high glucose has been shown to increase PAI-1 transcription–inducing Sp1 binding to −85/−65 region of PAI-1 promoter (61,62). Thus, Sp1 may play a pivotal role in mediating the action of both glucose and insulin in inducing PAI-1. In this context it is worth mentioning that hyperglycemia increases PAI-1 in cultured vascular smooth muscle cells, interacting with two Sp1 sites just upstream the transcription start site of PAI-1 (61). These observations may have clinical implications and suggest that a common network of transcription factors may predispose to hypofibrinolysis in hyperinsulinemia as well as in hyperglycemia.

FIG. 1.

Effect of insulin on PAI-1 secretion and gene transcription by HepG2. A: cells were kept in serum free medium for 24 h and then incubated for 16 h with 100 nmol/l of insulin. PAI-1 antigen levels were determined in cell supernatants. Data are means ± SE of five individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells. B: cells were transiently transfected with 4G-PAI-1-pCAT construct and exposed to 100 nmol/l insulin for 16 h. CAT antigen levels were determined in cell extract by ELISA and normalized for β-galactosidase activity. Values are the means ± SE of eight individual experiments performed in triplicate. *P < 0.01 vs. unstimulated cells.

FIG. 1.

Effect of insulin on PAI-1 secretion and gene transcription by HepG2. A: cells were kept in serum free medium for 24 h and then incubated for 16 h with 100 nmol/l of insulin. PAI-1 antigen levels were determined in cell supernatants. Data are means ± SE of five individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells. B: cells were transiently transfected with 4G-PAI-1-pCAT construct and exposed to 100 nmol/l insulin for 16 h. CAT antigen levels were determined in cell extract by ELISA and normalized for β-galactosidase activity. Values are the means ± SE of eight individual experiments performed in triplicate. *P < 0.01 vs. unstimulated cells.

FIG. 2.

Effect of the tyrosine phosphorylation suppressor, genistein, on PAI-1 secretion by HepG2. Cells preincubated for 1 h with genistein or vehicle were stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of genistein. PAI-1 antigen levels were determined in cell supernatants. Data are means ± SE of five individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells.

FIG. 2.

Effect of the tyrosine phosphorylation suppressor, genistein, on PAI-1 secretion by HepG2. Cells preincubated for 1 h with genistein or vehicle were stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of genistein. PAI-1 antigen levels were determined in cell supernatants. Data are means ± SE of five individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells.

FIG. 3.

Role of insulin receptor on PAI-1 secretion in HepG2. Nontransfected CHO and CHO stable transfected with insulin receptor (TBF4) or empty vector (pSVneo) were transiently transfected with 4G-PAI-1-pCAT construct and incubated with 100 nmol/l insulin for 16 h. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are expressed as a multiple of control values and are the means ± SE of five experiments. *P < 0.01 vs. unstimulated cells.

FIG. 3.

Role of insulin receptor on PAI-1 secretion in HepG2. Nontransfected CHO and CHO stable transfected with insulin receptor (TBF4) or empty vector (pSVneo) were transiently transfected with 4G-PAI-1-pCAT construct and incubated with 100 nmol/l insulin for 16 h. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are expressed as a multiple of control values and are the means ± SE of five experiments. *P < 0.01 vs. unstimulated cells.

FIG. 4.

Effect of the PI 3-kinase inhibitor LY294002 on PAI-1 biosynthesis. A: cells were kept in serum-free medium for 24 h, incubated for 1 h with the indicated concentrations of LY294002 or vehicle, and then stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of LY294002. PAI-1 antigen levels were determined in cell supernatants. Each value represents the mean ± SE of four individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.05; #P < 0.01 vs. insulin-stimulated cells. B: cells were transiently transfected with 4G-PAI-1-pCAT construct, incubated with 50 μmol/l LY294002 for 1 h, and then incubated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are the means ± SE of four experiments performed in triplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells.

FIG. 4.

Effect of the PI 3-kinase inhibitor LY294002 on PAI-1 biosynthesis. A: cells were kept in serum-free medium for 24 h, incubated for 1 h with the indicated concentrations of LY294002 or vehicle, and then stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of LY294002. PAI-1 antigen levels were determined in cell supernatants. Each value represents the mean ± SE of four individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.05; #P < 0.01 vs. insulin-stimulated cells. B: cells were transiently transfected with 4G-PAI-1-pCAT construct, incubated with 50 μmol/l LY294002 for 1 h, and then incubated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are the means ± SE of four experiments performed in triplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells.

FIG. 5.

Role of Ras. HepG2 cells were kept in serum-free medium for 24 h, incubated for 1 h with the indicated concentrations of the farnesylation blocker manumycin A (A) and the Ras carboxylmethylation inhibitor ACF (B) or vehicle, and then stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of the compounds. PAI-1 antigen levels were determined in cell supernatants. Each value represents the mean ± SE of four individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. C: HepG2 cells were transiently transfected with 4G-PAI-1-pCAT construct in the presence of different concentrations of dominant-negative Ras p21(Asn-17)Hras and empty vector to equalize the amount of plasmid used. The cells were then incubated with 100 nmol/l insulin for 16 h. CAT antigen was measured in cell lysates and normalized for β-galactosidase activity. Data are expressed as the percentage of control and are the means ± SE of five experiments. *P < 0.01 vs. control cells; §P < 0.01 vs. insulin-stimulated cells.

FIG. 5.

Role of Ras. HepG2 cells were kept in serum-free medium for 24 h, incubated for 1 h with the indicated concentrations of the farnesylation blocker manumycin A (A) and the Ras carboxylmethylation inhibitor ACF (B) or vehicle, and then stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of the compounds. PAI-1 antigen levels were determined in cell supernatants. Each value represents the mean ± SE of four individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. C: HepG2 cells were transiently transfected with 4G-PAI-1-pCAT construct in the presence of different concentrations of dominant-negative Ras p21(Asn-17)Hras and empty vector to equalize the amount of plasmid used. The cells were then incubated with 100 nmol/l insulin for 16 h. CAT antigen was measured in cell lysates and normalized for β-galactosidase activity. Data are expressed as the percentage of control and are the means ± SE of five experiments. *P < 0.01 vs. control cells; §P < 0.01 vs. insulin-stimulated cells.

FIG. 6.

Effect of the S6 kinase blocker rapamycin on PAI-1 biosynthesis. A: HepG2 cells were kept in serum-free medium for 24 h, incubated for 1 h with the indicated concentration of rapamycin or vehicle, and then stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of rapamycin. PAI-1 antigen levels were determined in cell supernatants. Each value represents the mean ± SE of four individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. B: cells were transiently transfected with 4G-PAI-1-pCAT construct, incubated with 10 nmol/l rapamycin for 1 h, and then incubated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are the means ± SE of three experiments performed in triplicate. *P < 0.01 vs. unstimulated cells.

FIG. 6.

Effect of the S6 kinase blocker rapamycin on PAI-1 biosynthesis. A: HepG2 cells were kept in serum-free medium for 24 h, incubated for 1 h with the indicated concentration of rapamycin or vehicle, and then stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of rapamycin. PAI-1 antigen levels were determined in cell supernatants. Each value represents the mean ± SE of four individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. B: cells were transiently transfected with 4G-PAI-1-pCAT construct, incubated with 10 nmol/l rapamycin for 1 h, and then incubated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are the means ± SE of three experiments performed in triplicate. *P < 0.01 vs. unstimulated cells.

FIG. 7.

Effect of the PKC inhibitors H7 and calphostin C on insulin-induced PAI-1 biosynthesis. A and B: cells preincubated for 1 h with the PKC inhibitors H7 (A) and calphostin C (B) or with vehicle were stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of the inhibitors. PAI-1 antigen levels were determined in cell supernatants. Data are the means ± SE of five individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. C: cells were transiently transfected with 4G-PAI-1-pCAT construct, incubated with 35 μmol/l H7 for 1 h, and then incubated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are the means ± SE of four experiments performed in triplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells.

FIG. 7.

Effect of the PKC inhibitors H7 and calphostin C on insulin-induced PAI-1 biosynthesis. A and B: cells preincubated for 1 h with the PKC inhibitors H7 (A) and calphostin C (B) or with vehicle were stimulated for 16 h in the absence (□) or presence ([cjs2113]) of 100 nmol/l insulin in the continued presence or absence of the inhibitors. PAI-1 antigen levels were determined in cell supernatants. Data are the means ± SE of five individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. C: cells were transiently transfected with 4G-PAI-1-pCAT construct, incubated with 35 μmol/l H7 for 1 h, and then incubated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are the means ± SE of four experiments performed in triplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells.

FIG. 8.

Effect of insulin on MAP kinase activation in HepG2 cells. A: cells were kept in medium containing 0.1% FCS for 48 h and then stimulated with 100 nmol/l insulin for the indicated times. MAP kinase activity was determined in cell lysates. Data are the means ± SE of three individual experiments. *P < 0.01 vs. unstimulated cells. B and C: cells were incubated for 48 h in medium containing 0.1% FCS, incubated for 1 h with 50 μmol/l LY294002 (B) and 35 μmol/l H7 (C) and then stimulated with 100 nmol/l insulin for the indicated times. Cell lysates (10 μg/lane) were fractionated on a 12% SDS-PAGE followed by immunoblotting with anti-phosphorylated ERK1 and ERK2 antibody. The experiment is representative of three independent experiments. D: cells kept in serum-free medium for 24 h were treated with vehicle or with 25 μmol/l PD98059 (inhibitor of MEK) for 1 h, and then they were treated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. PAI-1 antigen levels were determined in cell supernatants. Data are the means ± SE of four individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. E: cells were transiently transfected with 4G-PAI-1-pCAT construct, incubated with 25 μmol/l PD98059 for 1 h, and then incubated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are expressed as fold increase over control and are the means ± SE of five experiments. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. Ins, insulin; LY, LY294002.

FIG. 8.

Effect of insulin on MAP kinase activation in HepG2 cells. A: cells were kept in medium containing 0.1% FCS for 48 h and then stimulated with 100 nmol/l insulin for the indicated times. MAP kinase activity was determined in cell lysates. Data are the means ± SE of three individual experiments. *P < 0.01 vs. unstimulated cells. B and C: cells were incubated for 48 h in medium containing 0.1% FCS, incubated for 1 h with 50 μmol/l LY294002 (B) and 35 μmol/l H7 (C) and then stimulated with 100 nmol/l insulin for the indicated times. Cell lysates (10 μg/lane) were fractionated on a 12% SDS-PAGE followed by immunoblotting with anti-phosphorylated ERK1 and ERK2 antibody. The experiment is representative of three independent experiments. D: cells kept in serum-free medium for 24 h were treated with vehicle or with 25 μmol/l PD98059 (inhibitor of MEK) for 1 h, and then they were treated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. PAI-1 antigen levels were determined in cell supernatants. Data are the means ± SE of four individual experiments performed in duplicate. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. E: cells were transiently transfected with 4G-PAI-1-pCAT construct, incubated with 25 μmol/l PD98059 for 1 h, and then incubated with 100 nmol/l insulin for 16 h in the continued presence of the inhibitor. CAT antigen was then measured in cell lysates and normalized for β-galactosidase activity. Data are expressed as fold increase over control and are the means ± SE of five experiments. *P < 0.01 vs. unstimulated cells; §P < 0.01 vs. insulin-stimulated cells. Ins, insulin; LY, LY294002.

FIG. 9.

PAI-1 promoter. A: schematic diagram of PAI-1 promoter deletion constructs used in transient transfection assays. B: induction of CAT antigen in HepG2 cells transfected with PAI-1 promoter constructs and incubated with 100 nmol/l insulin. Results represent the means ± SE of seven independent experiments performed in triplicate.

FIG. 9.

PAI-1 promoter. A: schematic diagram of PAI-1 promoter deletion constructs used in transient transfection assays. B: induction of CAT antigen in HepG2 cells transfected with PAI-1 promoter constructs and incubated with 100 nmol/l insulin. Results represent the means ± SE of seven independent experiments performed in triplicate.

FIG. 10.

EMSA. A: human PAI-1 promoter sequences from −805 to −708, from −207 to −108, and from −107 to −28. Open boxes delineate the different probes and shaded boxes indicate putative nuclear factor binding sites. B: EMSA of HepG2 nuclear extracts incubated with insulin for 8 h and bound to the probes −805/−768, −777/−741, −749/−708, −157/−128, −93/−62, −67/−48, and −54/−33. The arrows denote an insulin-induced factor. a, b, c, f, and g: Lane 1, no extract; lane 2, no insulin; lane 3, 100 nmol/l insulin; lane 4, 50-fold excess of unlabeled competitor; lane 5, excess of unlabeled noncompetitor. d: Lane 1, no extract; lane 2, no insulin; lane 3, 100 nmol/l insulin; lane 4, 50-fold excess of unlabeled noncompetitor; lane 5 excess of unlabeled competitor. F indicates free DNA. e: Lanes1-3, as above; lane 4, anti-Jun/Fos antibody; lane 5, anti-Sp1 antibody; lane 6, anti-Jun/Fos antibody plus anti-Sp1 antibody; lane 7, excess of unlabeled AP-1 oligonucleotide; lane 8, excess mutant AP-1 oligonucleotide; lane 9, excess Sp1 unlabeled oligonucleotide; lane 10, excess unlabeled mutant Sp1 oligonucleotide. C: time course effect of insulin on Sp1 binding: lane 1, no extract; lane 2, no insulin for 2 h; lane 3, 100 nmol/l insulin for 2 h; lane 4, no insulin for 4 h; lane 5, 100 nmol/l insulin for 4 h; lane 6, no insulin for 6 h; lane 7, 100 nmol/l insulin for 6 h; lane 8, no insulin for 8 h; lane 9, 100 nmol/l insulin for 8 h; lane 10, 50-fold excess of unlabeled noncompetitor; lane 11, excess of unlabeled competitor.  

FIG. 10.

EMSA. A: human PAI-1 promoter sequences from −805 to −708, from −207 to −108, and from −107 to −28. Open boxes delineate the different probes and shaded boxes indicate putative nuclear factor binding sites. B: EMSA of HepG2 nuclear extracts incubated with insulin for 8 h and bound to the probes −805/−768, −777/−741, −749/−708, −157/−128, −93/−62, −67/−48, and −54/−33. The arrows denote an insulin-induced factor. a, b, c, f, and g: Lane 1, no extract; lane 2, no insulin; lane 3, 100 nmol/l insulin; lane 4, 50-fold excess of unlabeled competitor; lane 5, excess of unlabeled noncompetitor. d: Lane 1, no extract; lane 2, no insulin; lane 3, 100 nmol/l insulin; lane 4, 50-fold excess of unlabeled noncompetitor; lane 5 excess of unlabeled competitor. F indicates free DNA. e: Lanes1-3, as above; lane 4, anti-Jun/Fos antibody; lane 5, anti-Sp1 antibody; lane 6, anti-Jun/Fos antibody plus anti-Sp1 antibody; lane 7, excess of unlabeled AP-1 oligonucleotide; lane 8, excess mutant AP-1 oligonucleotide; lane 9, excess Sp1 unlabeled oligonucleotide; lane 10, excess unlabeled mutant Sp1 oligonucleotide. C: time course effect of insulin on Sp1 binding: lane 1, no extract; lane 2, no insulin for 2 h; lane 3, 100 nmol/l insulin for 2 h; lane 4, no insulin for 4 h; lane 5, 100 nmol/l insulin for 4 h; lane 6, no insulin for 6 h; lane 7, 100 nmol/l insulin for 6 h; lane 8, no insulin for 8 h; lane 9, 100 nmol/l insulin for 8 h; lane 10, 50-fold excess of unlabeled noncompetitor; lane 11, excess of unlabeled competitor.  

This study was supported by HIFMECH contract (BMH4-CT96-0,272) of the European Community, by the Swedish Medical Research Council (Grant 12660), and by the Ministero dell’Universitá e della Ricerca Scientifica e Tecnologica (MURST) (60%).

The authors thank Dr. Eric Clauser for kindly providing CHO cells and Prof. Adriana Maggi for providing Ras plasmids.

1.
White MF, Kahn CR: The insulin signaling system.
J Biol Chem
269
:
1
–4,
1994
2.
Kannel W, McGee D: Diabetes and cardiovascular disease: the Framingham study.
JAMA
241
:
2035
–2038,
1979
3.
Reaven GM: Banting Lecture 1988: Role of insulin resistance in human disease.
Diabetes
37
:
1595
–1607,
1988
4.
Genest J, Cohn JS: Clustering of cardiovascular risk factors: targeting high risk individuals.
Am J Cardiol
76
:
8A
–20A,
1995
5.
Juhan-Vague I, Alessi MC, Vague P: Increased plasma plasminogen activator inhibitor-1 levels: a possible link between insulin resistance and atherothrombosis.
Diabetologia
34
:
457
–462,
1991
6.
Wiman B: Plasminogen activator inhibitor 1 (PAI-1) in plasma: its role in thrombotic disease.
Thromb Haemost
74
:
71
–76,
1995
7.
Juhan-Vague I, Alessi MC: PAI-1, obesity, insulin resistance and risk of cardiovascular events.
Thromb Haemost
78
:
656
–660,
1997
8.
Alessi MC, Juhan-Vague I, Kooistra T, Declerck PJ, Collen D: Insulin stimulates the synthesis of plasminogen activator inhibitor 1 by the human hepatocellular cell line HepG2.
Thromb Haemost
60
:
491
–494,
1988
9.
Schneider DJ, Sobel BE: Augmentation of synthesis of plasminogen activator inhibitor type 1 by insulin and insulin-like growth factor type I: implications for vascular disease in hyperinsulinemic states.
Proc Natl Acad Sci U S A.
88
:
9959
–9963,
1991
10.
Schneider DJ, Nordt TK, Sobel BE: Stimulation by proinsulin of expression of plasminogen activator inhibitor type-I in endothelial cells.
Diabetes
41
:
890
–895,
1992
11.
Grenett HE, Benza RL, Li XN, Aikens ML, Grammer JR, Brown SL, Booyse FM: Expression of plasminogen activator inhibitor type I in genotyped human endothelial cell cultures: genotype-specific regulation by insulin.
Thromb Haemost
82
:
1504
–1509,
1999
12.
Nystrom FH, Quon MJ: Insulin signalling: metabolic pathways and mechanisms for specificity.
Cell Signal
11
:
563
–574,
1999
13.
Banfi C, Mussoni L, Risè P, Cattaneo MG, Vicentini L, Battaini F, Galli C, Tremoli E: Very low density lipoprotein-mediated signal transduction and plasminogen activator inhibitor type 1 in cultured HepG2 cells.
Circ Res
85
:
208
–217,
1999
14.
Leconte I, Clauser E: Two sequences flanking the major autophosphorylation site of the insulin receptor are essential for tyrosine kinase activation.
Biochem J
306
:
465
–472,
1995
15.
Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning:
A Laboratory Manual.
2nd ed. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory,
1989
16.
Eriksson P, Nilsson L, Karpe F, Hamsten A: Very-low-density lipoprotein response element in the promoter region of the human plasminogen activator inhibitor-1 gene implicated in the impaired fibrinolysis of hypertriglyceridemia.
Arterioscler Thromb Vasc Biol
18
:
20
–26,
1998
17.
Lew DJ, Decker T, Strehlow I, Darnell JE: Overlapping elements in the guanylate-binding protein gene promoter mediate trascriptional induction by alpha and gamma interferons.
Mol Cell Biol
11
:
182
–191,
1991
18.
Seger R, Seger D, Reszka AA, Munar ES, Eldar-Finkelman H, Dobrowolska G, Jensen AM, Campbell JS, Fischer EH, Krebs EG: Overexpression of mitogen-activated protein kinase kinase (MAPKK) and its mutants in NIH 3T3 cells: evidence that MAPKK involvement in cellular proliferation is regulated by phosphorylation of serine residues in its kinase subdomains VII and VIII.
J Biol Chem
269
:
25699
–25709,
1994
19.
Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature
227
:
680
–685,
1970
20.
Alksnis M, Barkhem T, Stromstedt PE, Ahola H, Kutoh E, Gustafsson JA, Poellinger L, Nilsson S: High level expression of functional full length and truncated glucocorticoid receptor in Chinese hamster ovary cells: demonstration of ligand-induced down-regulation of expressed receptor mRNA and protein.
J Biol Chem
266
:
10078
–10085,
1991
21.
Kalb VF Jr, Bernlohr RW: A new spectrophotometric assay for protein in cell extracts.
Anal Biochem
82
:
362
–371,
1977
22.
Eriksson P, Wrange O: Protein-protein contacts in the glucocorticoid receptor homodimer influence its DNA binding properties.
J Biol Chem
265
:
3535
–3542,
1990
23.
Sironi L, Mussoni L, Prati L, Baldassarre D, Camera M, Banfi C, Tremoli E: Plasminogen activator inhibitor type-1 synthesis and mRNA expression in HepG2 cells are regulated by VLDL.
Arterioscler Thromb Vasc Biol
16
:
89
–96,
1996
24.
Hadari YR, Tzahar E, Nadiv O, Rothenberg P, Roberts CT Jr, LeRoith D, Yarden Y, Zick Y: Insulin and insulinomimetic agents induce activation of phosphatidylinositol 3′-kinase upon its association with pp185 (IRS-1) in intact rat livers.
J Biol Chem
267
:
17483
–17486,
1992
25.
Vlahos CJ, Matter WF, Hui KY, Brown RF: A specific inhibitor of phosphatidylinositol 3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002).
J Biol Chem
269
:
5241
–5248,
1994
26.
Hara M, Akasaka K, Akinaga S, Okabe M, Nakano H, Gomez R, Wood D, Uh M, Tamanoi F: Identification of Ras farnesyltransferase inhibitors by microbial screening.
Proc Natl Acad Sci U S A
90
:
2281
–2285,
1993
27.
Casey PJ, Moomaw JF, Zhang FL, Higgins YB, Thissen JA: Prenylation and G protein signaling.
Recent Prog Horm Res
49
:
215
–238,
1994
28.
Huzoor-Akbar, Wang W, Kornhauser R, Volker C, Stock JB: Protein prenylcysteine analog inhibits agonist-receptor-mediated signal transduction in human platelets.
Proc Natl Acad Sci U S A
90
:
868
–872,
1993
29.
Cook SJ, Rubinfeld B, Albert I, McCormick F: RapV12 antagonizes Ras-dependent activation of ERK1 and ERK2 by LPA and EGF in Rat-1 fibroblasts.
EMBO J
12
:
3475
–3485,
1993
30.
Moule SK, Denton RM: Multiple signaling pathways involved in the metabolic effects of insulin (Review).
Am J Cardiol
80
:
41A
–49A,
1997
31.
Slivka SR, Loskutoff DJ: Regulation of type I plasminogen activator inhibitor synthesis by protein kinase C and cAMP in bovine aortic endothelial cells.
Biochim Biophys Acta
1094
:
317
–322,
1991
32.
Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR: A synthetic inhibitor of the mitogen-activated protein kinase cascade.
Proc Natl Acad Sci U S A
92
:
7686
–7689,
1995
33.
Juhan-Vague I, Vague P, Alessi MC, Badier C, Valadier J, Aillaud MF, Atlan C: Relationships between plasma insulin triglyceride, body mass index, and plasminogen activator inhibitor 1.
Diabete Metab
13
:
331
–336,
1987
34.
Vague P, Juhan-Vague I, Aillaud MF, Badier C, Viard R, Alessi MC, Collen D: Correlation between blood fibrinolytic activity, plasminogen activator inhibitor level, plasma insulin level, and relative body weight in normal and obese subjects.
Metabolism
35
:
250
–253,
1986
35.
Grant PJ, Kruithof EK, Felley CP, Felber JP, Bachmann F: Short-term infusions of insulin, triacylglycerol and glucose do not cause acute increases in plasminogen activator inhibitor-1 concentrations in man.
Clin Sci
79
:
513
–516,
1990
36.
Vuorinen-Markkola H, Puhakainen I, Yki-Jarvinen H: No evidence for short-term regulation of plasminogen activator inhibitor activity by insulin in man.
Thromb Haemost
67
:
117
–120,
1992
37.
Panahloo A, Yudkin JS: Diminished fibrinolysis in diabetes mellitus and its implication for diabetic vascular disease.
J Cardiovasc Risk
4
:
91
–99,
1997
38.
Kooistra T, Bosma PJ, Tons HA, van den Berg AP, Meyer P, Princen HM: Plasminogen activator inhibitor 1: biosynthesis and mRNA level are increased by insulin in cultured human hepatocytes.
Thromb Haemost
62
:
723
–728,
1989
39.
O’Brien RM, Granner DK: Regulation of gene expression by insulin.
Physiol Rev
76
:
1109
–1161,
1996
40.
Fattal PG, Schneider DJ, Sobel BE, Billadello JJ: Post-transcriptional regulation of expression of plasminogen activator inhibitor type 1 mRNA by insulin and insulin-like growth factor 1.
J Biol Chem
267
:
12412
–12415,
1992
41.
Price DJ, Grove JR, Calvo V, Avruch J, Bierer BE: Rapamycin-induced inhibition of the 70-kilodalton S6 protein kinase.
Science
257
:
973
–977,
1992
42.
Chung J, Kuo CJ, Crabtree GR, Blenis J: Rapamycin-FKBP specifically blocks growth-dependent activation of and signaling by the 70 kd S6 protein kinases.
Cell
69
:
1227
–1236,
1992
43.
Yang SH, Dickson AJ: Inhibitors of signalling identify differential control processes responsible for selective effects of insulin on the expression of phosphoenolpyruvate carboxykinase and gene 33 in rat H4 hepatoma cells.
Biochem J
310
:
375
–378,
1995
44.
Shepherd PR, Nave BT, Siddle K: Insulin stimulation of glycogen synthesis and glycogen synthase activity is blocked by wortmannin and rapamycin in 3T3–L1 adipocytes: evidence for the involvement of phosphoinositide 3-kinase and p70 ribosomal protein-S6 kinase.
Biochem J
305
:
25
–28,
1995
45.
Cross DA, Alessi DR, Vandenheede JR, McDowell HE, Hundal HS, Cohen P: The inhibition of glycogen synthase kinase-3 by insulin or insulin-like growth factor 1 in the rat skeletal muscle cell line L6 is blocked by wortmannin, but not by rapamycin: evidence that wortmannin blocks activation of the mitogen-activated protein kinase pathway in L6 cells between Ras and Raf.
Biochem J
303
:
21
–26,
1994
46.
Yamamoto-Honda R, Tobe K, Kaburagi Y, Ueki K, Asai S, Yachi M, Shirouzu M, Yodoi J, Akanuma Y, Yokoyama S, Yazaki Y, Kadowaki T: Upstream mechanisms of glycogen synthase activation by insulin and insulin-like growth factor-I: glycogen synthase activation is antagonized by wortmannin or LY294002 but not by rapamycin or by inhibiting p21ras.
J Biol Chem
270
:
2729
–2734,
1995
47.
Sutherland C, O’Brien RM, Granner DK: Phosphatidylinositol 3-kinase, but not p70/p85 ribosomal S6 protein kinase, is required for the regulation of phosphoenolpyruvate carboxykinase (PEPCK) gene expression by insulin: dissociation of signaling pathways for insulin and phorbol ester regulation of PEPCK gene expression.
J Biol Chem
270
:
15501
–15506,
1995
48.
Lefebvre V, Mechin MC, Louckx MP, Rider MH, Hue L: Signaling pathway involved in the activation of heart 6-phosphofructo-2-kinase by insulin.
J Biol Chem
271
:
22289
–22292,
1996
49.
Folli F, Saad MJ, Backer JM, Kahn CR: Insulin stimulation of phosphatidylinositol 3-kinase activity and association with insulin receptor substrate 1 in liver and muscle of the intact rat.
J Biol Chem
267
:
22171
–22177,
1992
50.
Nakanishi H, Brewer KA, Exton JH: Activation of the zeta isozyme of protein kinase C by phosphatidylinositol 3,4,5-trisphosphate.
J Biol Chem
268
:
13
–16,
1993
51.
Toker A, Meyer M, Reddy KK, Falck JR, Aneja R, Aneja S, Parra A, Burns DJ, Ballas LM, Cantley LC: Activation of protein kinase C family members by the novel polyphosphoinositides PtdIns-3,4-P2 and PtdIns-3,4,5-P3.
J Biol Chem
269
:
32358
–32367,
1994
52.
Whitehurst CE, Owaki H, Bruder JT, Rapp UR, Geppert TD: The MEK kinase activity of the catalytic domain of RAF-1 is regulated independently of Ras binding in T cells.
J Biol Chem
270
:
5594
–5599,
1995
53.
Lin YL, Chou CK: Phosphatidylinositol 3-kinase is required for the regulation of hepatitis B surface antigen production and mitogen-activated protein kinase activation by insulin but not by TPA.
Biochem Biophys Res Commun
246
:
172
–175,
1998
54.
Band CJ, Posner BI: Phosphatidylinositol 3′-kinase and p70s6k are required for insulin but not bisperoxovanadium 1,10-phenanthroline (bpV(phen) inhibition of insulin-like growth factor binding protein gene expression: evidence for MEK-independent activation of mitogen-activated protein kinase by bpV(phen).
J Biol Chem
272
:
138
–145,
1997
55.
Calles-Escandon J, Mirza SA, Sobel BE, Schneider DJ: Induction of hyperinsulinemia combined with hyperglycemia and hypertriglyceridemia increases plasminogen activator inhibitor 1 in blood in normal human subjects.
Diabetes
47
:
290
–293,
1998
56.
Cobb MH, Boulton TG, Robbins DJ: Extracellular signal-regulated kinases: ERKs in progress.
Cell Regulation
2
:
965
–978,
1991
57.
Arts J, Grimbergen J, Bosma PJ, Rahmsdorf HJ, Kooistra T: Role of c-Jun and proximal phorbol 12-myristate-13-acetate-(PMA)-responsive elements in the regulation of basal and PMA-stimulated plasminogen-activator inhibitor-1 gene expression in HepG2.
Eur J Biochem
241
:
393
–402,
1996
58.
Pal S, Claffey KP, Cohen HT, Mukhopadhyay D: Activation of Sp1-mediated vascular permeability factor/vascular endothelial growth factor transcription requires specific interaction with protein kinase C zeta.
J Biol Chem
273
:
26277
–26280,
1998
59.
Ries S, Buchler C, Langmann T, Fehringer P, Aslanidis C, Schmitz G: Transcriptional regulation of lysosomal acid lipase in differentiating monocytes is mediated by transcription factors Sp1 and AP-2.
J Lipid Res
39
:
2125
–2134,
1998
60.
Zheng XL, Matsubara S, Diao C, Hollenberg MD, Wong NCW: Activation of apolipoprotein AI gene expression by protein kinase A and kinase C through transcription factor, Sp1.
J Biol Chem
275
:
31747
–31754,
2000
61.
Chen YQ, Su M, Walia RR, Hao Q, Covington JW, Vaughan DE: Sp1 sites mediate activation of the plasminogen activator inhibitor-1 promoter by glucose in vascular smooth muscle cells.
J Biol Chem
273
:
8225
–8231,
1998
62.
Goldberg HJ, Scholey J, Fantus IG: Glucosamine activates the plasminogen activator inhibitor 1 gene promoter through Sp1 DNA binding sites in glomerular mesangial cells.
Diabetes
49
:
863
–871,
2000

Address correspondence and reprint requests to Prof. Elena Tremoli, Laboratory of Pharmacology of Thrombosis and Atherosclerosis, Department of Pharmacological Sciences, University of Milan, Via Balzaretti 9, 20133 Milan, Italy. E-mail: elena.tremoli@unimi.it.

Received for publication 24 May 2000 and accepted in revised form 3 April 2001.

ACF, N-acetyl-S-trans,trans-farnesyl-l-cysteine; ELISA, enzyme-linked immunosorbent assay; EMSA, electromobility shift assay; ERK, extracellular signal–regulated kinase; FCS, fetal calf serum; H7, 1-(5-isoquinolinylsulfonyl)-2-methylpiperazine; IRS, insulin receptor substrate; LY294002, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one; MAP, mitogen-activated protein; MEK, MAP/ERK; MEM, minimal essential medium; PAI, plasminogen activator inhibitor; PD98059, 2′-amino-3′-methoxyflavone; PI, phosphatidylinositol; PK, protein kinase; PMA, phorbol 12-myristate 13-acetate; PMSF, phenylmethylsulfonyl fluoride.