Mutations of the hepatocyte nuclear factor-4α (HNF-4α) gene are associated with a subtype of maturity-onset diabetes of the young (MODY1) that is characterized by impaired insulin secretion in response to a glucose load. HNF-4α, which is a transcription factor expressed in pancreatic β-cells, plays an important role in regulating the expression of genes involved in glucose metabolism. Thus, cofactors that interact with HNF-4α and modify its transcriptional activity might also play an important role in regulating the metabolic pathways in pancreatic β-cells, and the genes of such cofactors are plausible candidate genes for MODY. In the present study, we showed, using a yeast two-hybrid screening assay, that thyroid hormone receptor interacting protein 3 (Trip3) interacted with HNF-4α, and their interaction was confirmed by the glutathione S-transferase pull-down assay. Human Trip3 cDNA contained an open reading frame for a protein of 155 amino acids, and the gene was expressed in both pancreatic islets and MIN6 cells. Cotransfection experiments indicated that Trip3 could enhance (two- to threefold) the transcription activity of HNF-4α in COS-7 cells and MIN6 cells. These results suggest that Trip3 is a coactivator of HNF-4α. Mutation screening revealed that variation of the Trip3 gene is not a common cause of MODY/early-onset type 2 diabetes in Japanese individuals. Trip3 may play an important role in glucose metabolism by regulating the transcription activity of HNF-4α.

Maturity-onset diabetes of the young (MODY) is a monogenic form of diabetes characterized by autosomal dominant inheritance, early onset, and pancreatic β-cell dysfunction. Mutations of the genes encoding hepatocyte nuclear factor (HNF)-4α, -1α, and -1β are known to cause MODY1, MODY3, and MODY5, respectively (13). HNF-1α, -1β, and -4α are functionally related transcription factors belonging to the HNF transcription cascade, suggesting that the proper regulation of this cascade is important for normal pancreatic β-cell function.

HNF-4α is a transcription factor and a member of the steroid hormone receptor superfamily. It possesses several functional domains, including an NH2-terminal ligand-independent transactivation domain (AF-1); a DNA-binding domain that contains two zinc finger modules followed by a T-box and an A-box; and a functionally complex COOH-terminal region that forms a ligand-binding domain, a dimerization interface, and a ligand-dependent transactivation domain (AF-2) (4,5). HNF-4α plays an important role in regulating the expression of genes involved in a variety of metabolic pathways in pancreatic β-cells and the liver. Patients with the MODY1 mutation are lean and show impaired insulin secretion in response to a glucose load (6). Molecules that can modify the activity of HNF-4α might also be involved in glucose metabolism. Recent genetic studies have shown that mutations of the gene encoding small heterodimer partner (SHP), a repressor that interacts with HNF-4α, are associated with early-onset mild obesity with hyperinsulinemia in Japanese subjects (7). Because SHP inhibits HNF-4α (7,8), loss of its function should lead to an increase of HNF-4α activity, resulting in increased insulin secretion. Accordingly, the functional loss of a coactivator of HNF-4α might cause MODY or early-onset type 2 diabetes by reducing HNF-4α activity.

In the present study, we found that thyroid hormone receptor interacting protein 3 (Trip3) showed an interaction with HNF-4α by yeast two-hybrid screening. Trip3 has been reported to interact with the thyroid hormone receptor and also with the retinoid X receptor, but its function has not been clarified (9). We cloned the full-length cDNA of human Trip3 and showed that it activates HNF-4α. We also screened Japanese subjects with MODY/early-onset type 2 diabetes for mutations of the Trip3 gene.

Plasmids.

The following plasmids were used in the yeast two-hybrid screening assay: pBTM116-HNF-4α lacking the NH2-terminal 139 amino acid residues fused to the DNA-binding domain of LexA as bait; pAS2–1-HNF-4α lacking the NH2-terminal 139 amino acid residues fused to the DNA-binding domain of Gal4, also as bait; pACT2-HNF-4α lacking the NH2-terminal 139 amino acid residues fused to the GAL4 activation domain (amino acids 768–881) as the positive control; and pACT2-no insert or pACT2-RAD51 as the negative control. The pCAGGS expression vector bearing a β-actin promoter and cytomegalovirus enhancer or the pcDNA3.1 expression vector (Invitrogen, Carlsbad, CA) were used. PCR was performed to introduce the nucleotide sequence encoding the HA epitope (YPYDVPDYA) in-frame at the NH2 terminus. The HNF-4α reporter plasmid (pHNF4-tk-Luc) used has been described previously (10). HNF-4α cDNA was cloned in-frame to the BamHI site of pGEX-3X (Amersham Pharmacia Biotech, Tokyo, Japan).

Yeast two-hybrid screening assay.

The yeast strain L40 (MATa trp1 leu2 his3 LYS2::lexA-HIS3 URA3::lexA-lacZ) was used. L40 harboring pBTM116-HNF4α was transformed with 100 μg of an oligo(dT) and/or random-primed human adult liver cDNA fusion library in a Gal4-activating domain vector (pACT2; Clontech, Tokyo, Japan) using lithium acetate. Transformants were selected by culture for 3 days on SD/-Trp/-Leu/-His plates containing 10 mmol/l 3-aminotriazole, a competitive inhibitor of the HIS3 gene product (Sigma, Tokyo, Japan). Colonies with a diameter >2 mm were streaked out onto a fresh master plate. After 3 days, the β-galactosidase filter assay was performed as described previously (11). Quantative assays for determining β-galactosidase activity using chlorophenol red-β-d-galactopyranoside (CPRG) were performed as described in the manufacturer’s protocol (Matchmaker Library Protocol; Clontech, Palo Alto, CA).

Cloning of the 5′ sequence of Trip3 cDNA.

The partial sequence of Trip3 cDNA (accession number L40410) has been reported, and our Trip3 clone originally isolated also lacked 5′ nucleotides. To determine the sequence of full-length Trip3 cDNA, 1 μl of human kidney cDNA library was amplified by PCR with a specific primer for Trip3 (5′-cgagtttcagggttgcactgttct-3′) and a forward primer for λgt10 (forward; 5′-agcaagttcagcctggttaag-3′). PCR products were separated by electrophoresis on 2% agarose gels, transferred to nylon membranes, and hybridized with a radiolabeled Trip3-specific internal oligonucleotide (5′-ttccggaagcagactaccgag-3′). After the identified band was excised from the gel, DNA was extracted and subcloned into the TA vector for DNA sequencing. Mouse dbEST (a database of expressed sequence tags) was screened with the human sequence corresponding to mouse Trip3 cDNA.

RT-PCR and Northern blot analysis.

Total RNA was isolated from mouse tissues (kidney, intestine, brain, and muscle) and from MIN6 cells using TRIzol reagent (Life Technologies, Rockville, MD) according to the manufacturer’s protocol. Pancreatic islets were isolated from 10- to 20-week-old C57BL/6 mice by the collagenase digestion method (12), and 10 μg total RNA was isolated from the islets. For RT-PCR analysis, contaminating genomic DNA was removed by treatment with DNase I. cDNA synthesis was performed with 1 μg total RNA using Moloney murine leukemia virus reverse transcriptase (Life Technologies) with dNTPs and oligo(dT) primers. The following forward and reverse primers were used for the specific PCR amplification of mouse Trip3: 5′-ttgcccgacttgccgcgtgcccta-3′ and 5′-cctaaacagcagtctgcaaactcc-3′ (annealing temperature, 60°C; product size, 360 bp). One microliter of a human pancreatic islet cDNA library (1) was also amplified with specific primers for human Trip3 (P2F, 5′-agaacagtgcaaccctgaaactcg-3′; P3R, 5′-actgaccaagtttaactccat-3′; product size, 673 bp). Ten micrograms of RNA was separated on 1% agarose gel and blotted onto Hybond N+ membranes (Amersham). The membranes were prehybridized and then hybridized to 32P-labeled probes in QuikHyb hybridization solution (Stratagene, La Jolla, CA). cDNA probe for mouse Trip3 was prepared by RT-PCR as described above. Mouse β-actin probe was prepared by RT-PCR with specific primers (13) and confirmed by sequencing. The Northern images were scanned and quantified using ScanningImager and ImageQuant software (Molecular Dynamics, Sunnyvale, CA).

Glutathione S-transferase pull-down assay.

Glutathione S-transferase (GST) fusion HNF-4α protein was expressed in Escherichia coli BL21 (DE3) and purified using glutathione-Sepharose 4B beads (Amersham). Trip3 protein was synthesized using a TNT T7 coupled reticulocyte lysate system (Promega, Tokyo) with [35S]cysteine. 35S-labeled proteins were incubated with ∼1 μg GST fusion proteins in NETN (100 mmol/l NaCl, 1 mmol/l EDTA, 20 mmol/l Tris-HCl, pH 8.0, and 0.5% NP40) for 1.5 h at 4°C. After washing, specifically bound proteins were subjected to 15% SDS-PAGE. Then, the radiolabeled proteins were detected using autoradiography and a BAS-2000 image analysis system (FujiFilm, Tokyo).

Cell culture and transient transfection assay.

COS-7 and MIN6 cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% and 15% fetal bovine serum, respectively. When 80% confluence was reached, the cells were detached and plated in 6-well plates at a density of 6 × 104 and 3 × 105 cells per well, respectively. Transfection was performed for 3 h in serum-free OPTI-MEMI (Life Technologies) with the indicated amounts of the expression vectors and 0.5 μg of the reporter genes together with 10 ng pRL-SV40, the internal control plasmid (Promega), using Lipofectamine Plus Reagent (Life Technologies) according to the manufacturer’s protocol. After incubation for another 24 h (COS-7) or 48 h (MIN6), luciferase activity was measured with the Dual-Luciferase Reporter Assay System (Promega) (14).

Mutation analysis of the Trip3 gene.

We studied 41 unrelated Japanese subjects with early-onset type 2 diabetes (diagnosed at <30 years of age) with a family history of type 2 diabetes in second-degree relatives (15). Nine of the 41 patients were considered to have MODY, which was defined as type 2 diabetes occurring in at least three generations, consistent with autosomal dominant transmission and onset before 25 years of age in at least one affected subject from the family. Eleven subjects were diagnosed as having type 2 diabetes before 15 years of age. These 11 subjects might have also had MODY, since it is common in Japanese of this age group (16). BLAST homology searches of human genomic sequences were performed to determine the exon-intron boundaries of the Trip3 gene. Based on the database sequences, specific PCR primers were designed to amplify the coding regions and flanking introns, and then mutation screening was performed. The mutations/polymorphisms that were identified in the diabetic patients were also assessed in 50 control subjects by DNA sequencing. Written informed consent was obtained from all of the participants.

Cloning of Trip3 as an HNF-4α–interacting protein by two-hybrid screening.

To isolate proteins interacting with HNF-4α, we used a LexA DNA-binding domain fused to the AF-2 region of human HNF-4α (amino acids 140–474) as bait in the yeast two-hybrid screening assay (Fig. 1).

The DNA-binding domain was eliminated to avoid nonspecific binding with DNA. More than 106 primary transformants from an adult human liver cDNA library were screened, yielding seven potentially positive clones judged by β-galactosidase filter assay. Sequence analysis of these seven clones revealed that two independent clones encoded Trip3. Analysis of the other five clones is still in progress. Trip3 has previously been reported to interact with the thyroid hormone receptor and also with the retinoid X receptor in a ligand-dependent manner, but its function has not been clarified (9). To confirm that the Trip3 clone is a true positive, we retransformed the clone with the bait or control plasmids and compared the resultant β-galactosidase activity. Because HNF-4α generates a homodimer, it was used as a positive control. Trip3 transformants cotransformed with HNF-4α showed about half the β-galactosidase activity of the positive control, whereas no β-galactosidase activity was seen in those with no insert or Rad51 negative control vectors (Fig. 2). A different bait (pAS2–1, with the Gal4 DNA-binding domain fused to HNF-4α) and a different yeast strain (CG1945) were also used to test the interaction, and similar results were obtained (data not shown).

The clones of Trip3 isolated in the two-hybrid screening assay contained a partial fragment of the COOH-terminal 119–amino acid residues. Because the previously published sequence of Trip3 also lacked the NH2-terminal residues, we cloned the entire coding sequence of Trip3 by PCR-based cloning from a human kidney cDNA library. The cDNA contained an open reading frame for a protein of 155 amino acids (accession number AF400652). This human sequence was used to screen mouse dbEST, and three full-length mouse clones (AI194289, AK014350, and AK004259) were found. Mouse Trip3 encoded a protein consisting of 151 amino acids that showed 79.4% identity with human Trip3 protein at the amino acid level. Trip3 has no similarity to known proteins in mammalians. However, it has a cysteine-rich region at the NH2 terminus, and this region was recognized as a potential zinc finger, metal-binding, and DNA-binding domain, according to a motif scan in PROSITE of the ExPASy Molecular Biology Server (on-line at http://www.expasy.ch). Besides, human and mouse Trip3 both contained a short conserved LXXLL binding motif with HNF-4α (17,18). A BLAST search also revealed that Trip3 showed weak homology (38%) with the Drosophila melanogaster gene product CG8204 (19).

Expression of Trip3 RNA in pancreatic islets and MIN6 cells.

Human Trip3 was ubiquitously expressed in all tissues examined, including muscle, kidney, and pancreas (9). Trip3 gene is expressed at higher levels in muscle and kidney than in pancreas. Trip3 expression in pancreatic islets (β-cells) has not been investigated previously. RT-PCR and Northern blot analysis demonstrated Trip3 expression in human and mouse pancreatic islets as well as in a mouse β-cell line (MIN6 cells) (Fig. 3). The expression level of mouse Trip3 in pancreatic islets was about 64 and 47% of that in kidney and MIN6 cells, respectively, adjusted by the internal control, β-actin. These data suggested that the Trip3 gene is expressed in pancreatic islets (β-cells), a site where HNF-4α is also expressed.

In vitro interaction of Trip3 with HNF-4α.

Direct interaction of Trip3 with HNF-4α was examined using a GST pull-down assay (Fig. 4). Trip3 did not bind to GST protein, but it did bind to GST-HNF-4α in the absence of its ligand. This result confirmed that Trip3 can interact with HNF-4α.

Effect of Trip3 on the transcriptional activity of HNF-4α.

To examine whether Trip3 is capable of modifying the transcriptional activity of HNF-4α, cotransfection experiments were performed. Expression of Trip3 protein was confirmed by Western blot analysis using anti-HA monoclonal antibody (data not shown). In COS-7 cells, Trip3 enhanced the transcription activity of HNF-4α in a concentration-dependent manner by two- to threefold compared with HNF-4α alone (Fig. 5A). Similar results were also obtained using MIN6 cells (Fig. 5B). These findings suggest that Trip3 is a coactivator of HNF-4α.

Trip3 gene mutation screening in Japanese subjects with early-onset type 2 diabetes and MODY.

A homology search through human genomic sequences indicated that human Trip3 cDNA matched the human sequence segment (AC023133) localized to chromosome 17. The Trip3 gene consisted of five exons spanning ∼10 kb. The coding region and flanking introns were screened for mutations in 41 unrelated Japanese subjects with early-onset type 2 diabetes. Sequences of the primers used for amplification and sequencing are shown in Table 1.

This analysis revealed two polymorphisms in intron 1: IVS1+148–49insCGGGAGGG (insertion of CGGGAGGG between nucleotides 48 and 49 of intron 1; the G of the acceptor site invariant GT was denoted as nt +1) and IVS1 + 56G→C (G to C substitution at nucleotide 56 of intron 1). The two polymorphisms were always found simultaneously, suggesting linkage disequilibrium. The frequencies of these polymorphisms were similar between the diabetic group (6 of 82, 7.3%) and the control group (3 of 100, 3.0%).

Mutations of the HNF-4α gene are a cause of MODY1 (2). HNF-4α is a transcription factor belonging to the steroid receptor superfamily, and it plays an important role in regulating the expression of genes by pancreatic β-cells. It has been reported that HNF-4α regulates the genes for GLUT2, l-pyruvate kinase, aldolase B, and 2-oxoglutarate dehydrogenase E1 (20). Cofactors that interact with HNF-4α and modify its effect on transcriptional activation could also be involved in the regulation of such genes. Previous studies have identified steroid receptor coactivator (SRC)-1, SRC-2/glucocorticoid receptor interacting protein-1 (GRIP-1), p300, and CREB binding protein as proteins that interact with HNF-4α (21,22). In the present study, using a yeast two-hybrid system, we isolated Trip3 as another protein that interacted with HNF-4α, and direct interaction between HNF-4α and Trip3 was also confirmed using the GST pull-down assay. Earlier studies have indicated that Trip3 interacts with the thyroid hormone receptor and also with the retinoid X receptor, but not with the glucocorticoid receptor (9). However, the function of Trip3 has been unclear. Our transfection data strongly suggest that Trip3 is a novel coactivator of HNF-4α. Many cofactors bind to a common region (the COOH-terminal helix 12 of the AF-2 region) of nuclear receptors to cause transcriptional activation (23,24). These cofactors contain a short conserved LXXLL motif (L denotes leucine and X denotes any amino acid), which appears to be both necessary and sufficient for such interactions (17,18). Interestingly, both human and mouse Trip3 contained this motif, suggesting that Trip3 may bind to HNF-4α via this motif. A protein database search revealed that Trip3 has a zinc finger, DNA-binding domain–like sequence at the NH2 terminus, suggesting that Trip3 might bind to DNA directly. Further studies are necessary to clarify the molecular mechanism underlying the activation of HNF-4α by Trip3.

In this study, we also screened for Trip3 gene mutations in Japanese subjects with MODY/early-onset type 2 diabetes. Although there was no evidence that Trip3 gene mutations are a common cause of MODY/early-onset type 2 diabetes in the Japanese population, Trip3 gene mutations may be contributory in other populations. Otherwise, since Trip3 interacts with the thyroid hormone receptor, its mutations might be involved in thyroid disease. Furthermore, the mechanism of transcriptional regulation of the Trip3 gene is unknown. For example, the expression of PGC-1 (peroxisome proliferator–activated receptor-γ [PPAR-γ] coactivator-1), a coactivator of PPAR-γ, is altered by β3-adrenergic agonists (25) and insulin (26). Trip3 expression and the regulation of glucose metabolism in pancreatic β-cells by HNF-4α might also be influenced by various stimuli.

In summary, we cloned a novel coactivator of HNF-4α. Interaction between HNF-4α and Trip3 might play an important role in the regulation of glucose homeostasis. The information presented here should facilitate studies regarding the roles of Trip3 and HNF-4α in normal β-cell function and in the pathophysiology of MODY/type 2 diabetes.

FIG. 1.

Functional domains of HNF-4α and the HNF-4α region ligated into bait expression plasmid vectors used in this study. Region A/B is highly variable among nuclear receptors and contains a ligand-independent transactivation domain (AF-1). Region E contains a ligand-binding domain, a dimerization interface, and a ligand-dependent transactivation region (AF-2).

FIG. 1.

Functional domains of HNF-4α and the HNF-4α region ligated into bait expression plasmid vectors used in this study. Region A/B is highly variable among nuclear receptors and contains a ligand-independent transactivation domain (AF-1). Region E contains a ligand-binding domain, a dimerization interface, and a ligand-dependent transactivation region (AF-2).

FIG. 2.

The quantative assay for determining β-galactosidase activity using CPRG was performed as described in the manufacturer’s protocol. The strength of interaction between HNF-4α and Trip3 was estimated as about half of that between HNF-4α and itself, according to this assay.

FIG. 2.

The quantative assay for determining β-galactosidase activity using CPRG was performed as described in the manufacturer’s protocol. The strength of interaction between HNF-4α and Trip3 was estimated as about half of that between HNF-4α and itself, according to this assay.

FIG. 3.

A: Trip3 gene expression in pancreatic β-cells. Human Trip3 cDNA was amplified from a human pancreatic islet cDNA library (lane 1) using human Trip3-specific primers. RNA was extracted from MIN6 cells (lane 2) and mouse pancreatic islets (lanes 3 and 4). Total RNA (1 μg) was reverse-transcribed (lanes 2 and 3), and the expression of mouse Trip3 mRNA was examined by PCR. No products were amplified in the absence of reverse transcriptase (lane 4). B: Northern blotting analysis of Trip3 gene in mouse kidney, intestine, brain, muscle, pancreatic islets, and MIN6 cells.

FIG. 3.

A: Trip3 gene expression in pancreatic β-cells. Human Trip3 cDNA was amplified from a human pancreatic islet cDNA library (lane 1) using human Trip3-specific primers. RNA was extracted from MIN6 cells (lane 2) and mouse pancreatic islets (lanes 3 and 4). Total RNA (1 μg) was reverse-transcribed (lanes 2 and 3), and the expression of mouse Trip3 mRNA was examined by PCR. No products were amplified in the absence of reverse transcriptase (lane 4). B: Northern blotting analysis of Trip3 gene in mouse kidney, intestine, brain, muscle, pancreatic islets, and MIN6 cells.

FIG. 4.

In vitro interaction between HNF-4α and Trip3. Control GST protein or HNF-4α fused to GST on glutathione-Sepharose beads was incubated in the presence of in vitro translated 35S-labeled Trip3. Results of the pull-down assay are shown.

FIG. 4.

In vitro interaction between HNF-4α and Trip3. Control GST protein or HNF-4α fused to GST on glutathione-Sepharose beads was incubated in the presence of in vitro translated 35S-labeled Trip3. Results of the pull-down assay are shown.

FIG. 5.

Trip3 enhances the transcriptional activity of HNF-4α in COS-7 cells (A) and MIN6 cells (B). The HNF-4α-pcDNA3.1 construct was transfected alone or with increasing amounts of the Trip3-pCAGGS plasmid as indicated. The total amount of DNA added was adjusted using empty pCAGGS DNA. The HNF-4α reporter construct was generated by ligating eight copies of the HNF-4a binding site sequence encompassing nucleotides -156 to -138 of mouse transthyretin promoter to the HSV-TK promoter/luciferase fusion gene (10). Luciferase activity was normalized by the activity of pRL-SV40. Experiments were repeated four times (COS-7) or three times (MIN6). SE is shown by the error bars. *P < 0.05, **P < 0.01.

FIG. 5.

Trip3 enhances the transcriptional activity of HNF-4α in COS-7 cells (A) and MIN6 cells (B). The HNF-4α-pcDNA3.1 construct was transfected alone or with increasing amounts of the Trip3-pCAGGS plasmid as indicated. The total amount of DNA added was adjusted using empty pCAGGS DNA. The HNF-4α reporter construct was generated by ligating eight copies of the HNF-4a binding site sequence encompassing nucleotides -156 to -138 of mouse transthyretin promoter to the HSV-TK promoter/luciferase fusion gene (10). Luciferase activity was normalized by the activity of pRL-SV40. Experiments were repeated four times (COS-7) or three times (MIN6). SE is shown by the error bars. *P < 0.05, **P < 0.01.

TABLE 1

Sequences of primers for amplification and sequencing of Trip3

RegionForward primer (5′-3′)Reverse primer (5′-3′)Product size (bp)
Exon 1/2 CGGCGCAGTAAACAGTCTCCTTCCA GAAAGGAAGCGCACGCCAAGGGTC 401 
Exon 3 GCAGCCTTGTCGCTGAAATGGAGG CCTTTTCCTTCGACTTATTCTATG 207 
Exon 4 TTCAAGTAGTGGTTAAAATCTGGT GCCCTACATGCCATACTTATT 264 
Exon 5 CTTTTCAGCCATCTCCATGTGTTT CCAGGAGTCAAGCACACGC 293 
RegionForward primer (5′-3′)Reverse primer (5′-3′)Product size (bp)
Exon 1/2 CGGCGCAGTAAACAGTCTCCTTCCA GAAAGGAAGCGCACGCCAAGGGTC 401 
Exon 3 GCAGCCTTGTCGCTGAAATGGAGG CCTTTTCCTTCGACTTATTCTATG 207 
Exon 4 TTCAAGTAGTGGTTAAAATCTGGT GCCCTACATGCCATACTTATT 264 
Exon 5 CTTTTCAGCCATCTCCATGTGTTT CCAGGAGTCAAGCACACGC 293 

This work was supported by grants from the Japanese Ministry of Science, Education and Culture (13204054 and 13671190); the Japan Diabetes Foundation; and the Research for the Future Program of the Japan Society for the Promotion of Science (97L00801).

We thank J. Miyazaki and A. Shinohara for their kind gifts of pCAGGS and pBTM116/Rad51, respectively; Graeme Bell (University of Chicago) for providing the human pancreatic islet cDNA library; and Y. Tsujimoto, Y. Eguchi, and T. Kodama for their helpful comments.

1.
Yamagata K, Oda N, Kaisaki PJ, Menzel S, Furuta H, Vaxillaire M, Southam L, Cox RD, Lathrop GM, Boriraj VV, Chen X, Cox NJ, Oda Y, Yano H, Le Beau MM, Yamada S, Nishigori H, Takeda J, Fajans SS, Hattersley AT, Iwasaki N, Hansen T, Pedersen O, Polonsky KS, Turner RC, Velho G, Chevre J-C, Froguel P, Bell GI: Mutations in the hepatocyte nuclear factor-1α gene in maturity-onset diabetes of the young (MODY3).
Nature
384
:
455
–458,
1996
2.
Yamagata K, Furuta H, Oda N, Kaisaki PJ, Menzel S, Cox NJ, Fajans SS, Signorini S, Stoffel M, Bell GI: Mutations in the hepatocyte nuclear factor-4α gene in maturity-onset diabetes of the young (MODY1).
Nature
384
:
458
–460,
1996
3.
Horikawa Y, Iwasaki N, Hara M, Furuta H, Hinokio Y, Cockburn BN, Lindner T, Yamagata K, Ogata M, Tomonaga O, Kuroki H, Kasahara T, Iwamoto Y, Bell GI: Mutation in hepatocyte nuclear factor-1β gene (TCF2) associated with maturity-onset diabetes of the young.
Nat Genet
17
:
384
–385,
1997
4.
Hadzopoulou-Cladaras M, Kistanova E, Evagelopoulou C, Zeng S, Cladaras C, Ladias JA: Functional domains of the nuclear receptor hepatocyte nuclear factor 4.
J Biol Chem
272
:
539
–550,
1997
5.
Jiang G, Sladek FM: The DNA binding domain of hepatocyte nuclear factor 4 mediates cooperative, specific binding to DNA and heterodimerization with the retinoid X receptor α.
J Biol Chem
272
:
1218
–1225,
1997
6.
Byrne MM, Sturis J, Fajans SS, Ortiz FJ, Stoltz A, Stoffel M, Smith MJ, Bell GI, Halter JB, Polonsky KS: Altered insulin secretory responses to glucose in subjects with a mutation in the MODY1 gene on chromosome 20.
Diabetes
44
:
699
–704,
1995
7.
Nishigori H, Tomura H, Tonooka N, Kanamori M, Yamada S, Sho K, Inoue I, Kikuchi N, Onigata K, Kojima I, Kohama T, Yamagata K, Yang Q, Matsuzawa Y, Miki T, Seino S, Kim Mi-Y, Choi H-S, Lee Y-W, Moore DD, Takeda J: Mutations in the small heterodimer partner gene are associated with mild obesity in Japanese.
Proc Natl Acad Sci U S A
98
:
575
–580,
2001
8.
Lee YK, Dell H, Dowhan DH, Hadzopoulou-Cladaras M, Moore DD: The orphan nuclear receptor SHP inhibits hepatocyte nuclear factor 4 and retinoid X receptor transactivation: two mechanisms for repression.
Mol Cell Biol
20
:
187
–195,
2000
9.
Lee J-W, Choi H-S, Gyurist J, Brent R, Moore DD: Two classes of proteins dependent on either the presence or absence of thyroid hormone for interaction with the thyroid hormone receptor.
Mol Endocrinol
9
:
243
–254,
1995
10.
Yang Q, Yamagata K, Yamamoto K, Cao Y, Miyagawa J, Fukamizu A, Hanafusa T, Matsuzawa Y: R127-HNF-4α is a loss of function mutation but not a rare polymorphism and causes type II diabetes in a Japanese family with MODY1.
Diabetologia
43
:
520
–524,
2000
11.
Iwahashi H, Eguchi Y, Yasuhara N, Hanafusa T, Matsuzawa Y, Tsujimoto Y: Synergistic anti-apoptotic activity between Bcl-2 and SMN implicated in spinal muscular atrophy.
Nature
390
:
413
–417,
1997
12.
Wollheim CB, Meda P, Halban PA: Isolation of pancreatic islets and primary culture of the intact microorgans or of dispersed islet cells.
Methods Enzymol
192
:
188
–223,
1990
13.
Miquerol L, Lopez S, Cartier N, Tulliez M, Raymondjean M, Kahn A: Expression of the L-type pyruvate kinase gene and the hepatocyte nuclear factor 4 transcription factor in exocrine and endocrine pancreas.
J Biol Chem
269
:
8944
–8951,
1994
14.
Yamagata K, Yang Q, Yamamoto K, Iwahashi H, Miyagawa J, Okita K, Yoshiuchi I, Miyazaki J, Noguchi T, Nakajima H, Namba M, Hanafusa T, Matsuzawa Y: Mutation P291fsinsC in the transcription factor hepatocyte nuclear factor-1α is dominant negative.
Diabetes
47
:
1231
–1235,
1998
15.
Zhu Q, Yamagata K, Tsukahara Y, Yang Q, Liu W, Hanafusa T, Miyagawa J, Matsuzawa Y: Mutation screening of the hepatocyte nuclear factor (HNF)-6 gene in Japanese subjects with diabetes mellitus.
Diabetes Res Clin Pract
52
:
171
–174,
2001
16.
Yamada S, Tomura H, Nishigori H, Sho K, Mabe H, Iwatani N, Takumi T, Kito Y, Moriya N, Muroya K, Ogata T, Onigata K, Morikawa A, Inoue I, Takeda J: Identification of mutations in the hepatocyte nuclear factor-1alpha gene in Japanese subjects with early-onset NIDDM and functional analysis of the mutant proteins.
Diabetes
48
:
645
–648,
1999
17.
Torchia J, Rose DW, Inostroza J, Kamei Y, Westin S, Glass CK, Rosenfeld MG: The transcriptional co-activator p/CIP binds CBP and mediates nuclear-receptor function.
Nature
387
:
677
–684,
1997
18.
Heery DM, Kalkhoven E, Hoare S, Parker MG: A signature motif in transcriptional co-activators mediates binding to nuclear receptors.
Nature
387
:
733
–736,
1997
19.
Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG, Scherer SE, Li PW, Hoskins RA, Galle RF, et al.: The genome sequence of Drosophila melanogaster.
Science
287
:
2185
–2195,
2000
20.
Wang H, Maechler P, Antinozzi PA, Hagenfeldt KA, Wollheim CB: Hepatocyte nuclear factor 4alpha regulates the expression of pancreatic beta-cell genes implicated in glucose metabolism and nutrient-induced insulin secretion.
J Biol Chem
275
:
35953
–35959,
2000
21.
Wang JC, Stafford JM, Granner DK: SRC-1 and GRIP1 coactivate transcription with hepatocyte nuclear factor 4.
J Biol Chem
273
:
30847
–30850,
1998
22.
Yoshida E, Aratani S, Itou H, Miyagishi M, Takiguchi M, Osumu T, Murakami K, Fukamizu A: Functional association between CBP and HNF4 in trans-activation.
Biochem Biophys Res Commun
241
:
664
–669,
1997
23.
Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung L: Nuclear receptor coactivators and corepressors.
Mol Endocrinol
1167
–1177,
1996
24.
Xu L, Glass CK, Rosenfeld MG: Coactivator and corepressor complexes in nuclear receptor function.
Curr Opin Genet Dev
9
:
140
–147,
1999
25.
Gomez-Ambrosi J, Fruhbeck G, Alfredo Martinez J: Rapid in vivo PGC-1 mRNA upregulation in brown adipose tissue of Wistar rats by a β3-adrenergic agonist and lack of effect of leptin.
Mol Cell Endocrinol
176
:
85
–90,
2001
26.
Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR, Granner DK, Newgard CB, Spiegelman BM: Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1.
Nature
413
:
131
–138,
2001

Address correspondence and reprint requests to Dr. Kazuya Yamagata, Department of Internal Medicine and Molecular Science, Graduate School of Medicine, B5, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan. E-mail: kazu@imed2.med.osaka-u.ac.jp.

Received for publication 8 August 2001 and accepted in revised form 10 December 2001.

CPRG, chlorophenol red-β-d-galactopyranoside; GST, glutathione S-transferase; HNF, hepatocyte nuclear factor; MODY, maturity-onset diabetes of the young; SHP, small heterodimer partner; SRC, steroid receptor coactivator; Trip3, thyroid hormone receptor interacting protein 3.