Effect of the (C825T) Gβ₃ Polymorphism on Adrenoceptor-Mediated Lipolysis in Human Fat Cells

We investigated 114 obese subjects (21 men and 93 women) of Scandinavian origin who were consecutively recruited to study adrenergic regulation of lipolysis in subcutaneous fat cells. The subjects were obese healthy volunteers or obese otherwise healthy subjects who were referred to our obesity unit for treatment for being overweight. None of the subjects was completely sedentary or involved in sporting activities. None had undertaken a weight-reduction diet during the 6 months before the study. Obesity was defined using World Health Organization criteria (BMI >30 kg/m²). The BMI of the subjects ranged from 30.4 to 53.4 kg/m². None of the subjects was on regular medication. Their ages ranged from 20 to 72 years, and 12 women were menopausal. (It has recently been shown that menopause does not influence lipolysis regulation in human subcutaneous fat cells [11]). The study was approved by the ethics committee of Huddinge Hospital. The procedure was initially explained to each subject, and his or her consent was then obtained

The subjects came to the laboratory at 8:00 a.m. after an overnight fast. Height and weight were determined and a fasting venous blood sample was obtained for the determination of plasma glycerol, glucose, insulin, triglycerides, cholesterol, HDL cholesterol, and serum-free fatty acids, as previously described (12). Thereafter, a subcutaneous fat biopsy (∼1–2 g) was obtained under local anesthesia from the umbilical region (13)

The methods to perform and analyze fat cell experiments have been described in detail elsewhere (14,15). In brief, isolated fat cells were prepared and their average size, volume, and weight were determined. Diluted fat cell suspensions (2%, vol/vol) were incubated in duplicate for 2 h at 37°C in a Krebs-Henseleit phosphate buffer (pH 7.4) containing bovine albumin (20 g/l), glucose (1 mg/ml), and ascorbic acid (0.1 mg/ml). At the end of the incubation, an aliquot of the medium was removed for glycerol analysis (lipolysis index) and analysis of the amount of glycerol release related to the number of incubated fat cells

The following agents were added (at concentrations of 10⁻¹⁰ to 10⁻⁴ mol/l, depending on the type of agent) to the incubation medium at the start of the experiment; norepinephrine (a natural catecholamine), isoprenaline (a nonselective β-adrenergic agonist), dobutamine (a selective β₁-adrenoceptor agonist), terbutaline (a selective β₂-adrenoceptor agonist), clonidine (a selective α₂-adrenoceptor agonist), and dibutyryl cyclic AMP (dcAMP; a phosphodiesterase-resistant cyclic AMP analog). The basal condition was defined as that with no agonist present. In the clonidine experiments, adenosine deaminase (1 unit/ml) was added to the incubation medium to avoid the influence of adenosine on the antilipolytic effect of clonidine

Because human subcutaneous fat cells have functional spare α₂- and β-adrenergic receptors (16), it is possible to use classical pharmacological methods to evaluate receptor function (17). The individual concentration response curves were linearized by log-logit transformation and analyzed for pD₂ (negative logarithm of half-maximum effective concentration [EC₅₀]). Furthermore, responsiveness (glycerol release at maximum effective drug concentration) was determined from the original curves. Changes in pD₂ reflect receptor events (binding and coupling to effector), whereas changes in responsiveness reflect receptor events as well as more distal and postreceptor-related events (17). The intrinsic activity of dobutamine and terbutaline was also determined according to the following formula: lipolysis at maximum effective dobutamine/terbutaline concentration minus basal lipolysis divided by lipolysis at maximum effective isoprenaline concentration minus basal lipolysis. Although the β₁- and β₂-adrenoceptor agonists used might be less selective in other systems, we have previously demonstrated the selectivity of dobutamine and terbutaline on β-adrenoceptor-mediated lipolysis in isolated human fat cells (15). A plateau of response was reached at the highest concentrations in all cases and with all drugs. Thus, it was possible to get an accurate measure of pD₂, intrinsic activity, and the responsiveness of the different drugs in each of the subjects investigated

DNA was prepared from frozen (−20°C) venous blood. The C825T polymorphism in the Gβ₃ gene was determined exactly as previously described (2). A combination of PCR and digestion of the PCR product with the restriction enzyme BseD1 (to obtain restriction fragments of various lengths) was used. The accuracy of the method was confirmed by direct sequencing (Cybergene, Stockholm, Sweden)

Because the amount of adipose tissue available was limited and priority was given to lipolysis experiments, cells for subsequent protein analysis could be saved only from a limited number of subjects. Aliquots (300 μl) of packed cells were lysed in protein lysis buffer (1% Triton X-100, Tris-HCl [pH 7.6], 150 mmol/l NaCl) supplemented with protease inhibitors (1 mmol/l phenylmethylsulfonyl fluoride and Complete [Boehringer Mannheim, Mannheim, Germany]), and homogenized using a microtome. The homogenate was centrifuged at 14,000 rpm for 30 min, and the infranatant was removed and saved. All steps were performed at 4°C to minimize the risk of protein degradation. The protein content in each sample was determined using a kit of reagents from Pierce Biotech (Rockford, IL). For detection of total intracellular Gβ content, 100 μg total protein were directly loaded onto 12% polyacrylamide gels and separated by standard SDS-PAGE. To specifically detect Gβ₃, 100 μg total protein were immunoprecipitated overnight at 4°C in the presence of anti-Gβ₃ antibody (1:200; Santa Cruz Biotechnology, Santa Cruz, CA). Samples were then incubated with protein-A-Sepharose beads (Pharmacia, Uppsala, Sweden), washed, boiled, and loaded in parallel with the samples for total Gβ content. To control for differences in gel migration, exposure time, antibody incubation, and so on, all samples were run on the same gels and transferred to the same polyvinylidine fluoride membranes (Amersham, Little Chalfont, U.K.). Blots were blocked for 1 h at room temperature in Tris-buffered saline with 0.1% Tween-20 and 5% non-fat dried milk. This was followed by an overnight incubation at 4°C in the presence of antibodies against all isoforms of Gβ (Santa Cruz Biotechnology). To confirm antibody specificity, positive controls provided by the manufacturer were included in all experiments. Secondary antibodies conjugated to horseradish peroxidase were obtained from Sigma (St Louis, MO) (α-rabbit 1:4,000). Antigen-antibody complexes were detected by chemiluminescence using a kit of reagents for enhanced chemiluminescence (Amersham) and blots were exposed to high-performance chemiluminescence film (Amersham). Films were scanned and the optical density (OD) of each specific band was analyzed using the program Image (National Institutes of Health, Bethesda, MD) and expressed as OD · mm⁻² · 100 μg⁻¹ total protein. Additional proteins were measured on the same samples as were used for Gβ using antibodies (all from Santa Cruz Biotechnology) directed toward the following: α₂A-adrenoceptor, β₂-adrenoceptor, Gα_i, and Gα_s

RT-PCR for Gβ3 and Gβ3-s mRNA transcripts was attempted as follows. For an individual reaction, 15 pmol oligo d(T) primer or a specific 3′ Gβ3 primer (either GAAGCAGATCAGCTCCTGGT or CCTCCTCAGTTCCAGATTTTGAGGA) was added to the RT mix, containing 1× reaction buffer (Promega), 6.5 mmol/l dNTPs, 1 mmol/l MnCl₂, and 5 units rtTh RT (Promega) enzyme. The enzymatic reaction consisted of incubation at 25°C for 10 min, followed by incubations of 3 min at 60°C, 15 min at 72°C, and 5 min at 99°C. This cDNA synthesis procedure is standard in our laboratory. Then 4 μl of the reverse transcribed sample were used for the subsequent PCR reactions. An individual reaction comprised 45 pmol 5′ primer, 45 pmol 3′ primer, 2.5 units Thermophylus aquaticus (Taq) polymerase, 1 polymerase reaction buffer (Gibco), and 0.2 mmol/l dNTPs. MgCl₂ was added at a range of concentrations (1–4 mmol/l). The PCR reaction proceeded according to two different protocols, either with a stepwise increase in annealing temperature from 37 to 72°C or by a stepwise reduction in temperature per cycle from 64 to 50°C. Positive controls (using oligonucleotides specific for either leptin or uncoupling protein 2) were used in parallel to control for cDNA quality and PCR efficiency. To detect the product, 5–10 μl of the PCR reaction were loaded onto a 2% agarose/Tris-acetate-EDTA (TAE) gel containing 0.5 μg/ml EtBr and run at 100 V for 1–2 h in 1× TAE buffer

BSA (fraction V) was obtained from Sigma (St Louis, MO), (-)-isoprenaline hydrochloride from Hässle (Mölndal, Sweden), terbutaline sulfate from Draco (Lund, Sweden), dobutamine hydrochloride from Lilly (Indianapolis, IN), clonidine from Boehringer-Ingelheim (Ingelheim, Germany), Taq polymerase from Perkin-Elmer/Cetus (Emeryville, CA), and the restriction enzyme BseD1 from New England Biolabs (Beverly, MA)

Analyses of phenotypic values included descriptive statistics (mean + SD by genotype or box plot) and were performed by ANOVA and post hoc test or ANCOVA adjusted for sex and, when stated, age and BMI. In some cases, χ² and Student’s unpaired t tests were performed. A 5% significance level was used for hypothesis testing. The statistical software program used was Stat View (SAS Institute, Cary, NC)

We found 8 subjects who carried the T variant in the homozygous form; 45 subjects were heterozygous. The remaining 61 subjects were homozygous for the C allele. The observed genotype frequency was similar to that previously reported in other Caucasian populations (4) and is in Hardy-Weinberg equilibrium. The sex distribution (Table 1) did not differ significantly among genotypes, although there was a trend toward an increased number of males in the small TT group (P = 0.10). Therefore, all subsequent statistical analyses were corrected for sex using ANCOVA

The clinical data for comparison among genotypes is shown in Table 1. No significant differences among TT, CT, and CC carriers were seen for age, BMI, fasting plasma levels of glucose, insulin, catecholamines, lipids, or fat cell volume. On the other hand, fasting circulating levels of glycerol and free fatty acids were significantly reduced by half in the TT group, but there were no apparent differences between CC and CT carriers

Mean concentration-response curves for the selective agonists are shown for illustrative purposes in Fig. 1. For terbutaline (β₂ selective), dobutamine (β₁ selective), and clonidine (α₂ selective), the mean curves of TT carriers were shifted to the right of those for CC carriers. The pD₂ values according to genotype for the whole cohort are shown in Fig. 2. A significant relationship between the polymorphism and pD₂ for all selective agonists was observed. For terbutaline (P = 0.02) and clonidine (P = 0.004), the T homozygotes had ∼1 log unit lower mean pD₂ values than the C homozygotes. Heterozygotes had intermediate values. This represents a 10-fold difference in EC₅₀ between T and C homozygotes. For dobutamine (P = 0.007), the T homozygotes had ∼0.5 log unit lower mean pD₂ values than C homozygous or heterozygous subjects, which represented about a sevenfold difference in EC₅₀. Because pD₂ appeared to be reduced in both CT and TT carriers, T heterozygotes and homozygotes were also combined into one group. The pD₂ values for CT/TT carriers and CC carriers are shown in Table 2. For all three ligands, the pD₂ values were ∼0.5 log unit higher among CC than CT/TT carriers. This difference was statistically significant (P from 0.007 to 0.019) and was observed in the whole (a correction for sex was made) as well as in the female subgroup. The analysis of data presented in Table 2 was not influenced in an important way if either BMI or age was included as a covariable in the statistical analysis

Data on the maximum action of the lipolysis agents (responsiveness) are shown in Table 3. There was no significant difference among TT, CT, and CC carriers with regard to basal, lipolysis, adenosine deaminase-induced lipolysis, or maximally stimulated lipolysis by dcAMP. However, clonidine lipolysis was maximally inhibited to a significantly lower rate in CC than in TT or CT carriers. Furthermore, maximum isoprenaline-, terbutaline-, dobutamine-, or norepinephrine-induced lipolysis rates were significantly reduced in TT carriers by almost half (P from <0.01 to 0.02). On the other hand, CC and CT carriers had similar responsiveness for the different β-adrenergic agonists as well as for norepinephrine

We also investigated if terbutaline and dobutamine were full or partial agonists in the different genotype groups by measuring their lipolytic effect in relation to the nonselective full agonist isoprenaline. This intrinsic activity for terbutaline was 0.86 + 0.11, 0.88 + 0.21, and 0.84 + 0.14 in CC, CT, and TT carriers, respectively (P = 0.43). Corresponding values for dobutamine were 0.83 + 0.15, 0.83 + 0.23, and 0.75 + 0.15 (P = 0.49). The intrinsic activity values for the two agents did not differ among TT, CT, and CC carriers. In other words, terbutaline and dobutamine were to the same extent almost full agonists in all genotypes

To assess the amount of Gβ₃ protein in isolated adipocytes, we measured the protein content of Gβ₃ in frozen cell samples from four TT homozygotes, four CT heterozygotes, and seven CC homozygotes. Because of the relative scarcity of TT subjects, the four samples included were the only ones remaining. In contrast, the CT and CC samples were picked at random for analysis. First, 100 μg isolated protein was either loaded directly onto polyacrylamide gels or immunoprecipitated overnight with a commercially available antibody against Gβ₃. Both samples were separated by standard SDS-PAGE on the same gels and transferred to membranes for Western blotting. Gβ proteins were then detected with an antibody that recognizes all forms of Gβ. Total Gβ protein content was not different in samples from the different genotypes (Fig. 3,A, left). In contrast, Gβ₃ protein content was markedly reduced in carriers of the T allele (Fig. 3,A, right). Densitometric scanning and quantification demonstrated a statistically significant 80% reduction of Gβ₃ content in T compared to C homozygotes (157 + 78 vs. 824 + 272 OD · mm⁻² · 100 μg⁻¹ total protein, respectively; P = 0.02) (Fig. 3 B). CT heterozygotes displayed an intermediate 57% reduction of Gβ₃ expression (351 + 129 OD · mm⁻² · 100 μg⁻¹ total protein). Combining the data from all T allele carriers revealed a significant difference in Gβ₃ protein content as compared to CC subjects (824 + 272 vs. 254 + 79 OD · mm⁻² · 100 μg⁻¹ total protein for CC and CT/TT carriers, respectively;P = 0.015). We could not observe any expression of the previously described Gβ₃-s protein in any of the samples. This could have been because of a low or absent expression of this splice variant in human adipocytes

To determine whether the reduced protein expression of Gβ₃ in TT carriers was specific, we ran additional Western blots on the same adipose samples described above (Fig. 4). Although the levels differed among subjects, the protein amount of α₂A-adrenoceptor, β₂-adrenoceptor, Gα_i, or Gα_s was not influenced in a significant way by the C825T polymorphism (OD values not shown)

Attempts were made to detect Gβ₃ and Gβ₃-s mRNA transcripts in C and T allele carriers using RT-PCR. Although several different protocols were attempted, including that previously published by Siffert et al. (4) and novel modifications by the same group of investigators (W. Siffert and D. Rosskopf, personal communication), we could not detect a Gβ₃ mRNA transcript in adipose tissue or in a number of other tissues, including platelets. Difficulties in detecting Gβ₃ mRNA in native human tissues has been experienced by other investigators (D. Rosskopf, personal communication). Because previously published studies of Gβ₃ mRNA have been performed only in cells overexpressing the Gβ₃ gene (2), our results could indicate that Gβ₃ mRNA is either highly unstable or is expressed at very small amounts, thereby preventing a reliable detection in native human tissue

This study demonstrated significant effects of the C825T polymorphism in the Gβ₃ gene on the function of several different native adrenergic receptor subtypes in apparently healthy obese subjects, as assessed by lipolysis in freshly isolated subcutaneous adipocytes. Using immortalized lymphoblasts and transfected insect cells, it was previously found that the C825T polymorphism influences signaling through Gα_i (2). However, the Gβ protein is a common pathway for both Gα_i- as well as Gα_s-coupled receptors. Therefore, if functional, a structural variation in the Gβ₃ gene should influence both inhibitory and stimulatory G protein-coupled receptors. For lipolysis in fat cells, we found that the T variant of Gβ₃ in its homozygous form was associated with a marked decrease in pD₂ values for terbutaline (β₂-adrenoceptor selective), dobutamine (β₁-adrenoceptor selective), and clonidine (α₂-adrenoceptor selective). The responsiveness for these agents and for the nonselective β-adrenergic agonist isoprenaline was also decreased. However, the polymorphism did not influence basal lipolysis, adenosine deaminase-induced lipolysis, or dcAMP-mediated lipolysis (the latter reflects actions at the most distal step in lipolysis action the protein kinase A hormone-sensitive complex). Our lipolysis data therefore suggest that the T-to-C substitution alters the Gβ₃ protein in a way that decreases signaling of β₁-_, β₂-, and α₂-adrenoceptors for adipocyte lipolysis at some earlier steps above protein kinase A. The polymorphism may have a more marked effect on Gα_s- than Gα_i-coupling, as responsiveness for norepinephrine was decreased in adipocytes of TT carriers. Norepinephrine’s effects on lipolysis reflect the net sum of β- and α₂- adrenoceptor signaling

The findings with lipolysis were surprising, as earlier studies on immortalized lymphoblasts have shown increased signal transduction, at least for Gα_i-coupled receptors (2). An increased efficiency of the Gα_i signaling complex in lipolysis experiments is predicted to increase clonidine pD₂ and/or responsiveness in human adipocytes (16). To obtain a mechanistic insight, we studied Gβ₃ protein content in fat cells from a subset of subjects. The total Gβ content was not influenced by the polymorphism. However, the amount of Gβ₃ was markedly decreased in adipocytes of 825T allele carriers. Furthermore, there was no apparent presence of the proposed alternative splice variant Gβ₃-s. This finding is in contrast to earlier findings with platelets that showed a normal content of full-length Gβ₃ (2). We believe that this is unlikely to be attributable to methodological reasons, as we used the same antibodies as in previous studies (2). However, we cannot exclude the presence of very low levels of Gβ₃-s protein in fat cells of 825T carriers that were below the detection limit of the present assays. The data are also at odds with earlier functional studies on the native protein. Thus, in vivo-stimulated coronary vasoconstriction through α₂-adrenoceptors (Gα_i-coupled) has been found to be enhanced in C825T carriers as compared to C825C carriers (18). Furthermore, stimulation of interleukin-8 receptors (Gα_i-coupled) induced more prominent chemotaxis in neutrophils from individuals with the TC/TT genotypes than in those with the CC genotype (19). For the moment, we have no definite explanation for the divergence in these findings, although cell type-specific effects of the polymorphism are possible. For example, the 825T variation may cause alternative splicing in some cells (immortalized lymphoblasts, platelets), but decreased translational efficiency in other cells, such as fat cells. The complexity of G protein signaling, which involves numerous receptors and G protein subunit isoforms, allows for thousands of receptor-G protein combinations and variations in signal transduction (20,21). It is also possible that the splice variant influences other pathways involving G proteins in fat cells that were not investigated here (i.e., Gα_q and Gα_o). Furthermore, the alteration in adrenoceptor signal transduction in fat cells of T825T subjects was probably attributable to a selective alteration of Gβ₃. The reason for this is that the protein levels of other key regulators, such as β₂-adrenoceptor, α₂-adrenoceptor, Gα_i, and Gα_s were not changed in TT carriers

Our results suggest that the noncoding C825T polymorphism affects the production of full-length Gβ₃ protein, possibly by affecting transcriptional and/or translational regulation. Unfortunately, it was not possible to study such events because of the lack of sufficient amounts of adipose tissue. We tried to measure Gβ₃ mRNA but were not able to amplify the gene product by PCR. It is difficult to obtain quantitative measures of Gβ₃ mRNA in native human cells and tissues (D. Rosskopf, personal communication). So far, only data with mRNA for Gβ₃ have been reported for an artificial cell system (2)

Whether the Gβ₃ polymorphism is of pathophysiological importance for insulin resistant conditions such as obesity is controversial. An association to obesity has been demonstrated in some studies (4) but not in others (22). If, however, the Gβ₃ polymorphism is a thrifty gene variation (8), it makes sense that the 825T allele is associated with impaired catecholamine-induced lipolysis in fat cells. A number of in vivo and in vitro studies have shown that catecholamine-induced lipolysis in subcutaneous adipose tissue is decreased in several insulin-resistant conditions, such as obesity, metabolic syndrome, familial combined hyperlipidemia, and polycystic ovary syndrome (10). The present results are also in line with studies on subjects with Gα_s deficiency. Such subjects are obese and have resistance to the in vivo lipolytic action of catecholamines as compared to matched controls (23). Thus, a reduction in adipocyte protein content of different subunits in G_s signaling (Gα_s and Gβ₃) seems to impair lipolysis activation by catecholamines in human fat cells. The present observation of low circulating levels of fatty acids and glycerol in fasted T825T subjects further supports the role of Gβ₃ in regulating lipolysis in man. We have previously shown that fasting circulating levels of glycerol and free fatty acids measured in the morning closely mirror the rate of lipolysis in subcutaneous adipose tissue (24)

It should be noted that in this study, only obese subjects were investigated, so we do not know the importance of the polymorphism in a lean population. Some attempts were made to analyze the clinical effects of C825T, bearing in mind that subjects with disorders comorbid with obesity, such as diabetes, hypertension, and dyslipidemia, were not included. The polymorphism had no apparent effect on BMI, insulin sensitivity, or plasma lipids. We included men and women in the study. It is unlikely that the findings were influenced to an important extent by sex, as we made statistical corrections for sex. Furthermore, in a subgroup analysis, the genotype effect on pD₂ for all selective adrenergic agonists was statistically significant in women. It remains to be established, on the other hand, if the polymorphism is also functional in fat cells of obese men. Because of the paucity of obese men, it was not possible to make a reliable evaluation of the polymorphism in the male subgroup

In conclusion, the results of this study suggest that the C825T polymorphism in the Gβ₃ gene influences catecholamine-induced lipolysis in vitro and lipolysis in vivo. The polymorphism may regulate the content of Gβ₃ protein in human fat cells and thereby cause variations in lipolysis mediated by native Gα_i- as well as Gα_s-coupled receptors. The 825T allele appears to decrease the amount of Gβ₃ in fat cells and thereby inhibit signaling to lipolysis through β₁-, β₂-, and α₂-adrenergic receptors, and the net effect is decreased catecholamine action. This effect may be a particular feature of the Gβ₃ gene in adipocytes, as 825T has been reported to actually increase Gα_i signal transduction in other native cells, possibly as a result of increased production of an alternative spliced short form of Gβ₃

This study was supported by grants from the Swedish Medical Research Council, Swedish Diabetes Association, Swedish Heart and Lung Foundation, and the Foundations of Novo Nordisk, Thuring and Söderberg, and the Swedish Medical Society

The excellent technical assistance of Eva Sjölin, Kerstin Wåhlen, Britt-Marie Leijonhufvud, and Catharina Hertel is greatly appreciated. We thank Professor Stephan Rössner for help in recruiting the obese subjects