In the genetic analysis of common, multifactorial diseases, such as type 1 diabetes, true positive irrefutable linkage and association results have been rare to date. Recently, it has been reported that a single nucleotide polymorphism (SNP), 1858C>T, in the gene PTPN22, encoding Arg620Trp in the lymphoid protein tyrosine phosphatase (LYP), which has been shown to be a negative regulator of T-cell activation, is associated with an increased risk of type 1 diabetes. Here, we have replicated these findings in 1,388 type 1 diabetic families and in a collection of 1,599 case and 1,718 control subjects, confirming the association of the PTPN22 locus with type 1 diabetes (family-based relative risk (RR) 1.67 [95% CI 1.46–1.91], and case-control odds ratio (OR) 1.78 [95% CI 1.54–2.06]; overall P = 6.02 × 10−27). We also report evidence for an association of Trp620 with another autoimmune disorder, Graves’ disease, in 1,734 case and control subjects (P = 6.24 × 10−4; OR 1.43 [95% CI 1.17–1.76]). Taken together, these results indicate a more general association of the PTPN22 locus with autoimmune disease.

Type 1 diabetes is a multigenic autoimmune disease with three loci identified so far, the HLA class II genes (1), the insulin gene on chromosome 11p15 (2,3), and the CTLA4 locus on 2q33 (4,5), all of which are involved in T-cell activation, homeostasis, and repertoire formation. Very recently, evidence for a fourth locus has been reported (6), PTPN22 on chromosome 1p13, which encodes a lymphoid protein tyrosine kinase (LYP) that is important in negative control of T-cell activation and in T-cell development (7,8). A nonsynonymous single nucleotide polymorphism (SNP) at nucleotide 1858 in codon 620 (Arg620Trp) in PTPN22 was associated with type 1 diabetes in North American and Sardinian collections (6). The disease-associated variant Trp620 may alter the binding of LYP to the cytoplasmic tyrosine kinase (6,9), which regulates the T-cell receptor–signaling kinases, T-cell–specific protein tyrosine kinase (LCK) and FYN (8,9).

Evidence for this association was based on two independent case-control collections from North America (294 case and 395 control subjects, P = 5.99 × 10−4, odds ratio [OR] for allele T = 1.83 [95% CI 1.28–2.60]) and Sardinia (174 case and 214 control subjects, P = 0.047, OR for allele T = 2.31 [0.93–5.82]). Because irrefutable results are rare in complex diseases (10,11,12), we sought to confirm the PTPN22/LYP Arg620Trp/1858C>T SNP association in several independent populations. We genotyped the SNP in 791 U.K., 336 U.S., and 261 Romanian multiplex and simplex type 1 diabetic families (13), providing 1,946 parent-child trio genotypes, and in 1,573 type 1 diabetic case subjects and 1,718 control subjects from the U.K. We confirmed the association in the family (P = 5.62 × 10−14, relative risk [RR] for allele T = 1.67 [95% CI 1.46–1.91]) and case-control (likelihood-ratio test P = 4.22 × 10−15, OR for allele T = 1.78 [95% CI 1.54–2.06]) collections, with the combined result being highly significant (P = 6.02 × 10−27) (Table 1). There was evidence of population heterogeneity in the 1858C>T genotype frequencies (P = 1.28 × 10−5), but not in the disease association (P = 0.98) (Table 2). Having confirmed the association and found a striking consistency across different Caucasian populations, we performed case-only locus-locus interaction analyses (14,15) between 1858C>T and the known type 1 diabetes susceptibility loci at IDDM1/HLA, the IDDM12/CTLA4 CT60 SNP (rs3087243) (5), and the IDDM2/INS variable number of tandem repeats (VNTR) (−23HphI, rs689) (2). No evidence for an interaction with CTLA4 CT60, INS VNTR, and HLA-DRB1 was consistently found between the analyses of the affected offspring from the family collection and the case subjects from the case-control collection and PTPN22/LYP Arg620Trp/1858C>T (Table 3). However, evidence of a statistical interaction, or lack of one, is difficult to interpret (14,15). The distribution of 1858C>T genotypes were also evaluated on the basis of age at onset of type 1 diabetes, parent of origin, and sex, and no consistent evidence of heterogeneity was found (Table 3).

Given that Graves’ disease, type 1 diabetes, autoimmune hypothyroidism, and other autoimmune diseases, such as rheumatoid arthritis, commonly cluster in the same families (16), it is likely they share some of the same susceptibility genes and alleles, as demonstrated at CTLA4 for type 1 diabetes and Graves’ disease (5). Owing to the central role of LYP in T-cell signaling, the Trp620 variant could be a shared determinant among different autoimmune and immune-mediated diseases. Hence, we investigated whether this locus was also associated with autoimmune thyroid disease, using a case-control collection (901 Graves’ disease case subjects and 833 control subjects, all of whom were independent of the type 1 diabetic control subjects study). We found evidence for an association (likelihood-ratio test P = 6.26 × 10−4, OR for allele T = 1.43 [95% CI 1.17–1.76]) (Table 4), indicating that this locus may have a general effect on predisposition to autoimmunity. Very recently, the Trp620 variant has also been associated with rheumatoid arthritis and systemic lupus erythematosus (17,18). It will be interesting to test in future experiments if Arg620Trp is the only disease-associated variant in the gene and in this chromosome region.

The 1,573 case subjects were recruited as part of the U.K. Genetic Resource Investigating Diabetes (GRID) study, which is a joint project between the University of Cambridge Departments of Pediatrics and Medical Genetics and is funded by the Juvenile Diabetes Research Foundation and the Wellcome Trust. The eventual aim of this project is to collect 8,000 case subjects with type 1 diabetes matched geographically across Great Britain (http://www-gene.cimr.cam.ac.uk/ucdr/grid.shtml) to 8,000 control subjects from the 1958 British Birth Cohort (http://www.cls.ioe.ac.uk/Cohort/Ncds/mainncds.htm) to allow statistically powered genetic association studies. The 1,718 1958 British Birth Cohort control subjects are part of a longitudinal study in which the subjects are British citizens born in a particular week in March 1958. The case subjects, all Caucasian and <16 years of age, have a mean age at onset of type 1 diabetes at 7.5 years, with an SD of 4 years. The regional distribution of case and control subjects are matched. All families were Caucasian of European descent and were composed of two parents and at least one affected child. The families consisted of 528 multiplex families from the Diabetes U.K. Warren 1 collection (20), including 56 simplex families from Yorkshire, providing 1,912 genotypes (2,040 individuals attempted to be genotyped), 336 multiplex families from the Human Biological Data Interchange (U.S.) (21), providing 1,315 genotypes (1,382 attempted), 263 multiplex/simplex families from Belfast (22), providing 847 genotypes (885 attempted), and 261 Romanian simplex families, providing 819 genotypes (845 attempted), with inclusion criteria as reported in Vella et al. (13). Caucasian, U.K.-born, Graves’ disease case subjects (n = 901) were recruited from thyroid clinics as described previously (5,23). Ethnically matched control subjects (n = 833) with no history of autoimmune disease were recruited at various sites in Birmingham and Oxford (independent of the U.K. GRID study). All DNA samples were collected after approval from the relevant research ethics committees, and written informed consent was obtained from the participants.

Genotyping.

Genotyping, in the type 1 diabetes collections, was undertaken using TaqMan (Applied Biosystems, Warrington, U.K.), and probes and primers were also designed by Applied Biosystems.

All genotyping was double scored to minimize error and a duplicate plate was typed to check genotyping quality. No mismatches were observed. The primers were as follows: forward, CAACTGCTCCAAGGATAGATGATGA, reverse, CCAGCTTCCTAACCACAATAAATG, FAM probe, TCAGGTGTCCGTACAGG, and VIC probe, TCAGGTGTCCATACAGG.

Genotyping in the Graves’ disease and control collection was undertaken using PCR followed by restriction enzyme digest with PCR primers and XcmI, as described by Bottini et al. (8).

The interaction analyses used CTLA4 CT60 (rs3087243) (5), the INS −23HphI (rs689) as a surrogate for the INS VNTR (2), and HLA-DRB1 (24).

Statistical analysis.

All statistical analyses were performed in the STATA statistical package (http://www.stata.com). Some additional STATA routines were used and may be downloaded from http://www-gene.cimr.cam.ac.uk/clayton/software/stata.

A score test was used to combine tests from family and case-control studies. If U is the score statistic, contrasting allele frequencies in case and control subjects or, in family studies, frequencies of transmitted and untransmitted alleles and V is the estimated variance of the score statistic, U2/V is asymptotically distributed as χ2, with 1 degree of freedom. To combine results, we first calculate U and V for each study and calculate an overall U and V by summing the contributions from each study, U = U1 + U2 and V = V1 + V2. We then calculate U2/V.

Arg620Trp allele frequencies in parents and control subjects were in Hardy-Weinberg equilibrium. The case-only (affected offspring only) locus-locus interaction analysis, defined as deviation from a multiplicative model for the joint effects of the two genotypes (25), was performed using regression model as a score test for association between genotypes in case subjects.

Potential population substructure within the U.K. case-control collections could slightly inflate the P values reported. We have, therefore, analyzed the case-control collection adjusting for 12 geographical regions within Britain. This increases the P value to 8.23 × 10−12 and OR to 172 (95% CI 1.47–2.01).

TABLE 1

The 1858C>T/Trp620 allele and genotype frequencies and association test results in the type 1 diabetic family and case-control collections

Type 1 diabetic family collectionTransmittedUntransmitted*RR (95% CI)P
Allele T/Trp620 (TDT) 565 339 1.67 (1.46–1.91) 5.62 × 10−14 
Genotypes     
C/C 1,364 (70.1) 4,448 (76.2) 1.00 (reference) — 
C/T 516 (26.5) 1,288 (22.1) 1.61 (1.38–1.87) 9.96 × 10−10 
T/T 66 (3.4) 102 (1.7) 3.13 (2.18–4.48) 5.30 × 10−10 
Type 1 diabetic family collectionTransmittedUntransmitted*RR (95% CI)P
Allele T/Trp620 (TDT) 565 339 1.67 (1.46–1.91) 5.62 × 10−14 
Genotypes     
C/C 1,364 (70.1) 4,448 (76.2) 1.00 (reference) — 
C/T 516 (26.5) 1,288 (22.1) 1.61 (1.38–1.87) 9.96 × 10−10 
T/T 66 (3.4) 102 (1.7) 3.13 (2.18–4.48) 5.30 × 10−10 
Type 1 diabetes case-control collectionCase subjectsControl subjectsOR (95% CI)P
Alleles     
C 2,610 (83.0) 3,077 (89.6) 1.00 (reference) — 
T 536 (17.0) 359 (10.4) 1.78 (1.54–2.06) 1.17 × 10−14 
Genotypes     
C/C 1,077 (68.5) 1,377 (80.2) 1.00 (reference) — 
C/T 456 (29.0) 323 (18.8) 1.81 (1.53–2.13) 1.34 × 10−12 
T/T 40 (2.5) 18 (1.0) 2.84 (1.62–4.98) 2.73 × 10−4 
Type 1 diabetes case-control collectionCase subjectsControl subjectsOR (95% CI)P
Alleles     
C 2,610 (83.0) 3,077 (89.6) 1.00 (reference) — 
T 536 (17.0) 359 (10.4) 1.78 (1.54–2.06) 1.17 × 10−14 
Genotypes     
C/C 1,077 (68.5) 1,377 (80.2) 1.00 (reference) — 
C/T 456 (29.0) 323 (18.8) 1.81 (1.53–2.13) 1.34 × 10−12 
T/T 40 (2.5) 18 (1.0) 2.84 (1.62–4.98) 2.73 × 10−4 

Data are n (%), unless noted otherwise. For the case-control collection, using logistic regression, we assumed a multiplicative model (likelihood-ratio test, χ12 = 61.57, P = 4.22 × 10−15) because it was not significantly different (likelihood-ratio test, χ12 = 0.18, P = 0.67) from the full genotype model (likelihood-ratio test, χ22 = 61.75, P = 3.90 × 10−14) (19).

*

Untransmitted (pseudocontrol) data for genotypes in the type 1 diabetic family collection are estimated, using conditional logistic regression, as in Cordell and Clayton (19). TDT, transmission/disequilibrium test.

View Large
TABLE 2

Population PTPN22/LYP1858C>T parental allele frequencies and transmission-disequilibrium test results for allele T/Trp620

PopulationNo. of parent-child triosParental allele frequency (%)TransmittedUntransmittedRR (95% CI)P
U.K.* 1,087 14.3 338 204 1.66 (1.40–1.98) 8.6 × 10−9 
Great Britain 850 16.4 272 175 1.55 (1.28–1.87) 4.5 × 10−6 
Northern Ireland 237 12.3 66 29 2.28 (1.47–3.53) 1.5 × 10−4 
U.S. 626 12.9 173 100 1.73 (1.35–2.21) 1.0 × 10−5 
Romania 233 10.2 54 35 1.54 (1.01–2.36) 0.04 
PopulationNo. of parent-child triosParental allele frequency (%)TransmittedUntransmittedRR (95% CI)P
U.K.* 1,087 14.3 338 204 1.66 (1.40–1.98) 8.6 × 10−9 
Great Britain 850 16.4 272 175 1.55 (1.28–1.87) 4.5 × 10−6 
Northern Ireland 237 12.3 66 29 2.28 (1.47–3.53) 1.5 × 10−4 
U.S. 626 12.9 173 100 1.73 (1.35–2.21) 1.0 × 10−5 
Romania 233 10.2 54 35 1.54 (1.01–2.36) 0.04 
*

Combined result for Great Britain and Northern Ireland.

View Large
TABLE 3

P values obtained by using a regression model as a score test for association

Affected offspringCase subjects
HLA-DRB1 0.203 (1,755) 0.130 (1,604) 
INS VNTR 0.054 (1,849) 0.201 (1,599) 
CTLA4 (CT60) 0.028 (1,816) 0.742 (1,583) 
Age at onset 0.240 (2,023) 0.343 (1,657) 
Sex 0.951 (2,061) 0.029 (1,593) 
Parent of Origin 0.681 (2,064) N/A 
Affected offspringCase subjects
HLA-DRB1 0.203 (1,755) 0.130 (1,604) 
INS VNTR 0.054 (1,849) 0.201 (1,599) 
CTLA4 (CT60) 0.028 (1,816) 0.742 (1,583) 
Age at onset 0.240 (2,023) 0.343 (1,657) 
Sex 0.951 (2,061) 0.029 (1,593) 
Parent of Origin 0.681 (2,064) N/A 

Data are P (n individuals). Associations were investigated between 1858C>T/Trp620 and HLA-DRB1 (DR3/DR3, DR3/DR4, DR4/DR4, DR3/non-DR4, DR4/non-DR3, and non-DR3/non-DR4), INS VNTR in two subgroups (I/I and I/III + III/III), the CTLA4 CT60 SNP, age at onset of type 1 diabetes, and sex in case subjects (research design and methods). The regression model for the affected offspring included a population variable. N/A, not available.

View Large
TABLE 4

PTPN22/LYP 1858C>T/Trp620 allele and genotype frequencies and association test results in the Graves’ disease case-control collection

Case subjectsControl subjectsLogistic regression
OR (95% CI)P
Alleles     
    C 1,544 (85.7) 1,492 (89.6) 1.00 (reference) — 
    T 258 (14.3) 174 (10.4) 1.43 (1.17–1.76) 6.26 × 10−4 
Genotypes     
    C/C 661 (73.4) 669 (80.3) 1.00 (reference) — 
    C/T 222 (24.6) 154 (18.5) 1.46 (1.16–1.84) 1.42 × 10−3 
    T/T 18 (2.0) 10 (1.2) 1.82 (0.83–3.98) 0.132 
Case subjectsControl subjectsLogistic regression
OR (95% CI)P
Alleles     
    C 1,544 (85.7) 1,492 (89.6) 1.00 (reference) — 
    T 258 (14.3) 174 (10.4) 1.43 (1.17–1.76) 6.26 × 10−4 
Genotypes     
    C/C 661 (73.4) 669 (80.3) 1.00 (reference) — 
    C/T 222 (24.6) 154 (18.5) 1.46 (1.16–1.84) 1.42 × 10−3 
    T/T 18 (2.0) 10 (1.2) 1.82 (0.83–3.98) 0.132 

Data are n (%), unless noted otherwise. We assumed a multiplicative model (likelihood-ratio test, χ12 = 11.95, P = 5.46 × 10−4) because it was not significantly different (likelihood-ratio test, χ12 = 0.12, P = 0.73) from the full genotype model (likelihood-ratio test, χ22 = 12.06, P = 2.41 × 10−3) (19).

View Large

D.S. and J.D.C. contributed equally to this work.

We thank the Juvenile Diabetes Research Foundation, the Wellcome Trust, Diabetes U.K., and the Medical Research Council for financial support.

We gratefully acknowledge the participation of all of the patients, control subjects, and family members and thank Tasneem Hassanali, Jayne Hutchings, Gillian Coleman, Sarah Field, Trupti Mistry, Kirsi Bourget, Sally Clayton, Matthew Hardy, Jennifer Keylock, Pamela Lauder, Meeta Maisuria, William Meadows, Meera Sebastian, and Sarah Wood for preparing the DNA samples.

1.
Cucca F, Lampis R, Congia M, Angius E, Nutland S, Bain SC, Barnett AH, Todd JA: A correlation between the relative predisposition of MHC class II alleles to type 1 diabetes and the structure of their proteins.
Hum Mol Genet
 
10
:
2025
–2037,
2001
2.
Barratt BJ, Payne F, Lowe CE, Hermann R, Healy BC, Harold D, Concannon P, Gharani N, McCarthy MI, Olavesen MG, McCormack R, Guja C, Ionescu-Tirgoviste C, Undlien DE, Ronningen KS, Gillespie KM, Tuomilehto-Wolf E, Tuomilehto J, Bennett ST, Clayton DG, Cordell HJ, Todd JA: Remapping the insulin gene/IDDM2 locus in type 1 diabetes.
Diabetes
 
53
:
1884
–1889,
2004
3.
Bell GI, Horita S, Karam JH: A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus.
Diabetes
 
33
:
176
–183,
1984
4.
Nistico L, Buzzetti R, Pritchard LE, Van der Auwera B, Giovannini C, Bosi E, Larrad MT, Rios MS, Chow CC, Cockram CS, Jacobs K, Mijovic C, Bain SC, Barnett AH, Vandewalle CL, Schuit F, Gorus FK, Tosi R, Pozzilli P, Todd JA: The CTLA-4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes.
Hum Mol Genet
 
5
:
1075
–1080,
1996
5.
Ueda H, Howson JM, Esposito L, Heward J, Snook H, Chamberlain G, Rainbow DB, Hunter KM, Smith AN, Di Genova G, Herr MH, Dahlman I, Payne F, Smyth D, Lowe C, Twells RC, Howlett S, Healy B, Nutland S, Rance HE, Everett V, Smink LJ, Lam AC, Cordell HJ, Walker NM, Bordin C, Hulme J, Motzo C, Cucca F, Hess JF, Metzker ML, Rogers J, Gregory S, Allahabadia A, Nithiyananthan R, Tuomilehto-Wolf E, Tuomilehto J, Bingley P, Gillespie KM, Undlien DE, Ronningen KS, Guja C, Ionescu-Tirgoviste C, Savage DA, Maxwell AP, Carson DJ, Patterson CC, Franklyn JA, Clayton DG, Peterson LB, Wicker LS, Todd JA, Gough SC: Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease.
Nature
 
423
:
506
–511,
2003
6.
Bottini N, Musumeci L, Alonso A, Rahmouni S, Nika K, Rostamkhani M, MacMurray J, Meloni GF, Lucarelli P, Pellecchia M, Eisenbarth GS, Comings D, Mustelin T: A functional variant of lymphoid tyrosine phosphatase is associated with type I diabetes.
Nat Genet
 
36
:
337
–338,
2004
7.
Hasegawa K, Martin F, Huang G, Tumas D, Diehl L, Chan AC: PEST domain-enriched tyrosine phosphatase (PEP) regulation of effector/memory T cells.
Science
 
303
:
685
–689,
2004
8.
Hill RJ, Zozulya S, Lu YL, Ward K, Gishizky M, Jallal B: The lymphoid protein tyrosine phosphatase Lyp interacts with the adaptor molecule Grb2 and functions as a negative regulator of T-cell activation.
Exp Hematol
 
30
:
237
–244,
2002
9.
Cloutier JF, Veillette A: Cooperative inhibition of T-cell antigen receptor signaling by a complex between a kinase and a phosphatase.
J Exp Med
 
189
:
111
–121,
1999
10.
Lohmueller KE, Pearce CL, Pike M, Lander ES, Hirschhorn JN: Meta-analysis of genetic association studies supports a contribution of common variants to susceptibility to common disease.
Nat Genet
 
33
:
177
–182,
2003
11.
Dahlman I, Eaves IA, Kosoy R, Morrison VA, Heward J, Gough SC, Allahabadia A, Franklyn JA, Tuomilehto J, Tuomilehto-Wolf E, Cucca F, Guja C, Ionescu-Tirgoviste C, Stevens H, Carr P, Nutland S, McKinney P, Shield JP, Wang W, Cordell HJ, Walker N, Todd JA, Concannon P: Parameters for reliable results in genetic association studies in common disease.
Nat Genet
 
30
:
149
–150,
2002
12.
Ioannidis JP, Trikalinos TA, Ntzani EE, Contopoulos-Ioannidis DG: Genetic associations in large versus small studies: an empirical assessment.
Lancet
 
361
:
567
–571,
2003
13.
Vella A, Howson JM, Barratt BJ, Twells RC, Rance HE, Nutland S, Tuomilehto-Wolf E, Tuomilehto J, Undlien DE, Ronningen KS, Guja C, Ionescu-Tirgovi°te C, Savage DA, Todd JA: Lack of association of the Ala45Thr polymorphism and other common variants of the NeuroD gene with type 1 diabetes.
Diabetes
 
53
:
1158
–1161,
2004
14.
Cordell HJ, Todd JA, Hill NJ, Lord CJ, Lyons PA, Peterson LB, Wicker LS, Clayton DG: Statistical modeling of interlocus interactions in a complex disease: rejection of the multiplicative model of epistasis in type 1 diabetes.
Genetics
 
158
:
357
–367,
2001
15.
Cordell HJ: Epistasis: what it means, what it doesn’t mean, and statistical methods to detect it in humans.
Hum Mol Genet
 
11
:
2463
–2468,
2002
16.
Tait KF, Marshall T, Berman J, Carr-Smith J, Rowe B, Todd JA, Bain SC, Barnett AH, Gough SC: Clustering of autoimmune disease in parents of siblings from the type 1 diabetes Warren repository.
Diabet Med
 
21
:
358
–362,
2004
17.
Begovich AB, Carlton VE, Honigberg LA, Schrodi SJ, Chokkalingam AP, Alexander HC, Ardlie KG, Huang Q, Smith AM, Spoerke JM, Conn MT, Chang M, Chang SY, Saiki RK, Catanese JJ, Leong DU, Garcia VE, McAllister LB, Jeffery DA, Lee AT, Batliwalla F, Remmers E, Criswell LA, Seldin MF, Kastner DL, Amos CI, Sninsky JJ, Gregersen PK: A missense single-nucleotide polymorphism in a gene encoding a protein tyrosine phosphatase (PTPN22) is associated with rheumatoid arthritis.
Am J Hum Genet
 
75
:
330
–337,
2004
18.
Kyogoku C, Langefeld CD, Ortmann WA, Lee A, Selby S, Carlton VE, Chang M, Ramos P, Baechler EC, Batliwalla FM, Novitzke J, Williams AH, Gillett C, Rodine P, Graham RR, Ardlie KG, Gaffney PM, Moser KL, Petri M, Begovich AB, Gregersen PK, Behrens TW: Genetic association of the R620W polymorphism of protein tyrosine phosphatase PTPN22 with human SLE.
Am J Hum Genet
 
75
:
504
–507,
2004
19.
Cordell HJ, Clayton DG: A unified stepwise regression procedure for evaluating the relative effects of polymorphisms within a gene using case/control or family data: application to HLA in type 1 diabetes.
Am J Hum Genet
 
70
:
124
–141,
2002
20.
Bain SC, Todd JA, Barnett AH: The British Diabetic Association: Warren repository.
Autoimmunity
 
7
:
83
–85,
1990
21.
Lernmark A, Ducat L, Eisenbarth G, Ott J, Permutt MA, Rubenstein P, Spielman R: Family cell lines available for research.
Am J Hum Genet
 
47
:
1028
–1030,
1990
22.
Patterson CC, Carson DJ, Hadden DR: Epidemiology of childhood IDDM in Northern Ireland 1989–1994: low incidence in areas with highest population density and most household crowding: Northern Ireland Diabetes Study Group.
Diabetologia
 
39
:
1063
–1069,
1996
23.
Allahabadia A, Heward JM, Nithiyananthan R, Gibson SM, Reuser TT, Dodson PM, Franklyn JA, Gough SC: MHC class II region, CTLA4 gene, and ophthalmopathy in patients with Graves’ disease.
Lancet
 
358
:
984
–985,
2001
24.
Maier LM, Twells RC, Howson JM, Lam AC, Clayton DG, Smyth DJ, Savage D, Carson D, Patterson CC, Smink LJ, Walker NM, Burren OS, Nutland S, Rance H, Tuomilehto-Wolf E, Tuomilehto J, Guja C, Ionescu-Tirgovişte C, Undlien DE, Ronningen KS, Cucca F, Todd JA: Testing the possible negative association of type 1 diabetes and atopic disease by analysis of the interleukin 4 receptor gene.
Genes Immun
 
4
:
469
–475,
2003
25.
Clayton D, McKeigue PM: Epidemiological methods for studying genes and environmental factors in complex diseases.
Lancet
 
358
:
1356
–1360,
2001
DIABETES
2004