Voltage-gated potassium channels (Kv channels) are involved in repolarization of excitable cells. In pancreatic β-cells, prolongation of the action potential by block of delayed rectifier potassium channels would be expected to increase intracellular free calcium and to promote insulin release in a glucose-dependent manner. However, the specific Kv channel subtypes responsible for repolarization in β-cells, most importantly in humans, are not completely resolved. In this study, we have investigated the expression of 26 subtypes from Kv subfamilies in human islet mRNA. The results of the RT-PCR analysis were extended by in situ hybridization and/or immunohistochemical analysis on sections from human or Rhesus pancreas. Cell-specific markers were used to show that Kv2.1, Kv3.2, Kv6.2, and Kv9.3 are expressed in β-cells, that Kv3.1 and Kv6.1 are expressed in α-cells, and that Kv2.2 is expressed in δ-cells. This study suggests that more than one Kv channel subtype might contribute to the β-cell delayed rectifier current and that this current could be formed by heterotetramers of active and silent subunits.

The role of potassium channels in excitation-secretion coupling is well established (1). In pancreatic β-cells, insulin secretion is modulated by the activity of different ionic currents. Among these are the three main potassium currents found in β-cells: the ATP-sensitive (KATP), calcium-activated (KCa), and voltage-gated (Kv) currents. Each has a functional role at different stages in the process of glucose-induced insulin secretion (2).

KATP, consisting of inward rectifier Kir6.2 and sulfonylurea receptor SUR1, sets the β-cell resting membrane potentials (Em) under low plasma glucose conditions (3,4). Elevated plasma glucose concentration results in an increase in metabolic activity, which leads to closure of KATP channels and to membrane depolarization (5,6). Voltage-gated calcium channels (Ca channels) then become activated, and the resultant rise in intracellular Ca2+ triggers insulin secretion. Sulfonylureas, widely used insulin secretagogues, bind to the SUR1 receptor and block the KATP channel, causing insulin secretion in the absence of glucose metabolism (7,8).

KCa in β-cells consists of at least two different components. There is a large conductance KCa channel in β-cells, with no obvious physiological function (9). In nondissociated β-cells, a second type of KCa current has been described (10). This current is linked to depolarization-induced rhythmic electrical activity of β-cells, important for insulin secretion (11).

The remaining potassium current is generated by Kv channels that produce either a fast transient current, IA, or a slow inactivating, delayed rectifying current, IDR (1214). Both currents exist in β-cells, with IDR being the major contributor to the repolarization of these cells. Thus, blockage of IDR should enhance Ca influx and therefore lead to an increase in insulin secretion as has been previously reported (1517). Because IDR does not open until the membrane is depolarized above a threshold level of ca −20 mV, its activation would be glucose dependent. Therefore, pharmacological interference with this mechanism may provide a novel way to treat type 2 diabetes without causing the hypoglycemic adverse effect of sulfonylureas (18,19). IDR has also been shown to be part of the signaling pathway of glucagon-like peptide-1-induced glucose-dependent insulin secretion (20). The function of IDR currents in δ-cells may be similar to that of β-cells because action potential initiation is dependent on depolarization through metabolism-dependent blockage of KATP. In α-cells, the opening of Na channels apparently initiates the action potential, but the IDR may still be involved in repolarization (21).

Kv channels belong to the six-transmembrane (TM) family of K channels, where Kv1 to Kv11 subfamilies exist, although Kv7 is only found in Aplysia (22,23). Members of the Kv1 to Kv4 subfamilies form tetrameric functional channels, homomultimers or heteromultimers, usually with members from the same subfamily. Members of the Kv5 to Kv11 families code for “silent subunits” that do not express as functional homomultimers. In heterologous expression systems, silent subunits can coassemble with Kv2 and Kv3 subunits and modulate the biophysical characteristics of the latter subunits (2427). There are several difficulties that obscure the correlation of any particular Kv subunit with a specific physiological function: the high degree of sequence homology results in many Kv channels having similar pharmacological and biophysical properties, and most excitable cells express more than one Kv channel gene.

Previous studies have identified Kv2.1 and Kv3.2 in rodent β-cells and insulinoma cells (16,2830), and block of Kv2.1 has been implicated in eliciting glucose-dependent insulin secretion (16,31,32). While Kv2.1 has been detected in human islets (33), no studies have yet been attempted in human or primate β-cells to define the molecular components of IDR. Although a molecular basis for the A-type current has been reported in α- and δ-cells (21), there is no information on the IDR in these cells.

In this study, we used RT-PCR to analyze the expression of 26 Kv channel genes in human islets. Cell-type specific expression of 11 Kv subtypes was further determined by in situ hybridization or immunohistochemistry. All data, taken together, suggest that closely related Kv channel subtypes are distributed among different cell types in primate islets. In addition, we provide evidence that pancreatic β-cells express both silent and functionally active Kv channel subtypes. Some heteromeric combination of these subtypes might be the underlying molecular correlate of IDR.

Design and optimization of RT-PCR primers for Kv1 to Kv11 family subtypes.

To establish the profile of Kv channel subtypes in islets, we performed RT-PCR amplification on RNA extracted from human islets using a subtype-specific primer pair for each of the 26 members of the Kv1–Kv11 families.

To obtain efficient and specific primer pairs, we used the Vector NTI program (Informax, Frederick, MD) to select sequences. Each primer sequence then was submitted to a basic local alignment search tool search against GenBank to ensure specificity of the selected sequence. Specific primer pairs were then used to amplify Kv channel subtypes from human fetal brain cDNA. Finally, the most effective primer pairs for each subtype were used to study the expression of Kv channels in human islets (Table 1).

Antibodies.

A rabbit polyclonal antibody for Kv1.6 was raised against the peptide RRSSYLPTPHRAYAEKRM, corresponding to residue 509–526 of the rat Kv1.6 (34). Human Kv1.6 shares 17 of 18 amino acid residues with the rat channel in this region. Rabbit polyclonal antibodies against Kv2.1 and Kv3.2 proteins were purchased from Alomone Labs (Jerusalem, Israel). The Kv2.1 antibody was raised against the peptide HMLPGGGAHGSTRDQSI, corresponding to residue 837–853 of rat Kv2.1. Human Kv2.1 shares 15 of 17 amino acids with this region of the rat channel. The Kv3.2 antibody was raised against the peptide DLGGKRLGIEDAAGLGGPDGK(C), corresponding to residues 184–204 of rat Kv3.2. The human and rat Kv3.2 have 19 identical amino acids in this peptide sequence. Antibodies for Kv2.1 and Kv3.2 detected only a single band in Western blots of the cognate channels expressed in HEK 293 cells.

RT-PCR.

Human pancreatic islets were obtained from the University of Alberta (Edmonton, AB, Canada). The islets were purified based on staining with the β-cell-specific dye diphenylthiocarbazone (Sigma), as previously described (35). The total RNA was isolated using TRI Reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer’s instruction. Because most of the human Kv channel genes are intronless, we treated the total RNA with DNaseI (Ambion, Austin, TX) to eliminate traces of genomic DNA. A control PCR reaction was performed with β-actin primers (forward: 5′-GCCCTTTCTCACTGGTTCTC-3′; reverse: 5′-CTTTACACCAGCCTCATGGC-3′) located on an intron region to verify the absence of genomic DNA.

The DNaseI-digested RNA was transcribed into cDNA using SensiScript Reverse Transcriptase from Qiagen (Valencia, CA), per the manufacturer’s instruction. Human fetal brain poly A+ RNA was purchased from BD Biosciences Clontech (Palo Alto, CA). The RNA was transcribed into cDNA with the Omniscript Reverse Transcriptase Kit from Qiagen following the manufacturer’s instructions. The cDNA was used as templates for the amplification of individual channel subtypes. Approximately 100 ng of total RNA was used in each reaction. A blank reaction was used as a control. The reaction conditions were as follows: start with 95°C for 15 min to activate the HotStarTaq DNA Polymerase (Qiagen), then denature at 94°C for 30 s, annealing at 56°C for 30 s, followed by an extension at 72°C for 1 min. The total number of cycles was 35. The amplification was followed by a 10-min extension at 72°C. The primers for each Kv channel subtype are listed in Table 1. The sequences for the insulin primers are the following: sense primer 5′-CCAGCCGCAGCCTTTGTGA-3′, antisense primer 5′-GCTGGTAGAGGGAGCAGAT-3′. The sequences for the trypsin II primers are the following: sense primer 5′-GCCCCCTTTGATGATGATG-3′, antisense primer 5′-ACACGCGGGAATTGATGAC-3′. The sequences for the Kir6.2 primers are the following: sense primer 5′-AAGAAGTGAAGTGGGACC-3′, antisense primer 5′-GTTGCCTTTCTTGGACAC-3′.

In situ hybridization, immunohistochemistry, and double-label combined in situ hybridization/immunohistochemistry.

For in situ hybridization (ISH), oligonucleotide probes specific for human Kv2.1, Kv2.2, Kv3.1, Kv6.1, Kv6.2, and Kv9.3 (Table 2) were end labeled with biotin-16-dUTP (Roche Molecular Biochemicals, Indianapolis, IN). The digoxigenin oligonucleotide tailing kit (Roche Molecular Biochemicals) was used according to the manufacturer’s protocol, except for replacement of digoxigenin-dUTP with biotin-16-dUTP. For Kv3.3 and Kv9.2, riboprobes instead of oligo probes were used for ISH. A 298-bp fragment from the 3′-untranslated region of the human Kv3.3 cDNA insert was prepared by RT-PCR amplification from human fetal brain cDNA, using a Kv3.3-specific primer pair (Table 1). Similarly, a 543-bp fragment from the 3′-untranslated region of the human Kv9.2 cDNA was amplified, using a Kv9.2-specific primer pair (Table 1). The reaction conditions were the same as described above for subtype RT-PCR. The PCR fragments were subcloned into the plasmid vector pCRII-TOPO (Invitrogen, Carlsbad, CA) and sequenced to verify their identity. To prepare riboprobes for ISH, the Kv3.3 and Kv9.2 containing vectors were linearized with the restriction enzymes SpeI and NotI, respectively, to create template DNA. Biotinylated sense and antisense riboprobes were then generated by in vitro transcription using Biotin RNA Labeling Mix (Roche Molecular Biochemicals).

Cryostat sections (8 μm) of human pancreas (the National Disease Research Interchange) and rhesus pancreas tissue, obtained under the approval of the Merck Research Laboratories Institutional Animal Care and Use Committee, were thaw mounted on SuperFrost plus slides (Fisher Scientific) and fixed with 4% paraformaldehyde. To improve the signal strength, a cocktail mixture of two labeled oligonucleotide probes (listed in Table 2) specific for a particular Kv channel subunit was used at a final concentration of 2 pmol/ml each. The ISH conditions were the same as those previously described (36). Bound probes were detected using the TSA direct red FISH tyramide amplification kit (PerkinElmer Life Sciences, Boston, MA) according to the manufacturer’s instructions. ISH using mRNA probes, immunohistochemistry (IHC) using antibodies, and combined double-label ISH/IHC were performed as previously described (37). ISH and IHC expression experiments were carried out on human and Rhesus pancreatic sections. The expression of Kv2.1, 2.2, 3.1, 3.2, 3.3, 6.1, 6.2, 9.2, and 9.3 subunits were examined in sections from both species, and in all cases, expression patterns in Rhesus and human were consistent. Double-staining cell identification experiments were carried out on the specimens that gave the best signal. Kv1.6 and Kv4.1 were only monitored in Rhesus.

Cell identification markers were antibodies specific for glucagon (Dako, Carpinteria, CA), insulin (Zymed Laboratories, South San Francisco, CA), and somatostatin (Dako). Matched preimmune sera or nonimmune control sera were used as negative controls for IHC. All antibodies were used at the manufacturer’s specified dilutions and incubated on the sections for 2 h at room temperature following the ISH procedures. Bound antibodies were detected using fluorescein isothiocyanate-conjugated donkey (MultipleLabel) IgG (Jackson Immunoresearch, West Grove, PA). Nuclei were counterstained with 4,6-diamidino-2-phenylindole (DAPI; Molecular Probes, Eugene, OR). Digital acquisition and image reassembly were carried out using a MicroMax CCD camera (Princeton Instruments, Princeton, NJ) and Metamorph imaging software (Universal Imaging, West Chester, PA).

There are 17 channel subtypes detected in human islets by RT-PCR.

The level of effectiveness of the Kv channel subtype-specific primers was tested by PCR using human fetal brain cDNA as templates. In all cases, a PCR product was visible on a 1% agarose gel (Fig. 1A). The expression profile for Kv channels was determined in at least two different human islet cDNA preparations. PCR fragments for Kv1.3, 1.6, 1.7, 2.1, 2.2, 3.1, 3.2, 3.3, 4.1, 4.4, 6.1, 6.2, 9.1 9.2, 9.3, 10.1, and 11.1 are identified as being present in the pancreatic islet preparation (Fig. 1B and Table 3). Probes for Kir6.2, representative of islet RNA, and trypsin, representative of acinar tissue RNA, indicate that there is some nonislet RNA present in the human islet preparation used for Fig. 1.

Kv3.4, Kv4.4, and Kv9.1 were only found in one of three human islet preparations. Kv4.4 and Kv9.1 appear as faint bands compared with brain and may be due to nonislet tissue in the one preparation. However, Kv3.4 was also found in only one of three human islet cDNA preparations, but as a more prominent band. This channel is usually responsible for an A-type potassium current and has been reported to be in β- and δ-cells from rat (21). This expression profile could be a natural variation within the human population or a marker for a possible disease state.

The expression of Kv1.7 was found in all three human preparations, but the band was weaker than the signal in brain and the signal of the other Kv channels in islets. These results were confirmed in a separate experiment where Kv1.7 and Kv1.6 were tested in a tissue panel including islets, brain, and skeletal muscle among others, where Kv1.7 was most prominent in skeletal muscle, confirming a previous report (38). While RT-PCR is not quantitative, these experiments suggest that the expression of Kv1.7 is lower in islets than for other Kv channels observed in this tissue.

Kv2.1 and Kv3.2 colocalize with insulin in β-cells.

Pancreatic islets are composed primarily of three cell types (i.e., α-, β-, and δ-cells); however, vascular endothelial cells (39) and interneurons (40) are found in islets as well. To identify the presence of channel subtypes in islet cells and to obviate the possibility of contamination from surrounding tissues, each of the most prominent islet Kv channel subtypes identified by PCR were tested by either or both ISH and IHC and compared with cell markers in sections of either Rhesus or human pancreatic tissue. Because Kv2.1 and Kv3.2 have been reported to exist in β-cells and in insulin-secreting cell lines (16,28), the cellular presence of these two channel subtypes was determined first. Pancreatic sections were probed for Kv2.1 mRNA with labeled antisense oligonucleotides by ISH (Table 2) and with an insulin-specific antibody by IHC in a double-staining experiment. Kv2.1 mRNA-positive cells located within an islet (Fig. 2A) exclusively colocalize with the insulin-containing cells, which confirms the expression of Kv2.1 in β-cells (Fig. 2B and C). Consistent with this finding, there is no colocalization of Kv2.1 and the glucagon signals (Fig. 2D). The presence of Kv2.1 protein in islets, but not in surrounding pancreatic tissue, was confirmed by immunostaining (Fig. 2E). Taken together, our results are consistent with the expression of Kv2.1 in pancreatic β-cells.

Expression of Kv3.2 was studied with the same double-labeling protocol used for Kv2.1. Kv3.2 antisense oligonucleotides (Fig. 3G) and insulin antibody (Fig. 3H) labeled the same population of islet cells (Fig. 3I), suggesting that Kv3.2 is expressed in β-cells.

Because both Kv2.1 and Kv3.2 are expressed in β-cells, we tested for their colocalization in pancreatic sections. Accordingly, we probed with a Kv3.2 antibody (Fig. 3J) and with Kv2.1 antisense oligonucleotides (Fig. 3K). As expected, both positive cell populations overlap completely, further confirming that Kv2.1 and Kv3.2 are coexpressed in β-cells, based on colocalization with insulin and each other (Fig. 3L).

Kv2.2 and Kv3.1 are found in δ- and α-cells, respectively, but not in β-cells.

Pancreatic tissue was probed for Kv2.2 mRNA and insulin, using the same protocol as for Kv2.1 (Fig. 2F and G). In marked contrast to Kv2.1, colocalization of Kv2.2 with insulin was not observed (Fig. 2H). Subsequently, a section was probed with Kv2.2 antisense oligonucleotides and a somatostatin antibody. Both probes labeled the same cell population (Fig. 2I–K), indicating that Kv2.2 is expressed in the δ-cells of the islet.

The double staining of Kv3.1 mRNA (Fig. 3A) and insulin (Fig. 3B) did not overlap, suggesting that Kv3.1 is not expressed in β-cells (Fig. 3C). Subsequently, a section was probed with Kv3.1 antisense oligonucleotides (Fig. 3D) and a glucagon antibody (Fig. 3E). Both probes labeled the same cell population (Fig. 3F), indicating that Kv3.1, in contrast to Kv3.2, is expressed in pancreatic α-cells.

Distribution of “electrically silent” subunits in pancreatic sections.

Several silent subunits were found to be present in human islet cDNA by RT-PCR (see above). Human pancreatic sections were probed for Kv6.1 and Kv6.2 channels with labeled antisense oligonucleotides (Table 2) and with cell marker-specific antibodies in a double-staining experiment. The results shown in Fig. 4A–H demonstrate that Kv6.1 is colocalized with glucagon, but not with insulin. In Figs. 4I–L, Kv6.2 appears to colocalize with all of the insulin-containing cells. However, in a number of islets, Kv6.2 labels only a major fraction of the insulin-containing cells (data not shown). This distribution could indicate the existence of a subset of β-cells within some islets.

To determine whether Kv9.2 is expressed in pancreatic β-cells, we first performed an ISH experiment using Kv9.2-specific oligonucleotide probes, but could not detect a significant signal over background levels (data not shown). We then used a Kv9.2 riboprobe for ISH and the insulin antibody for IHC experiments. The results in Fig. 5A–C show that the Kv9.2 mRNA is expressed in islets, but does not colocalize with insulin.

The double-staining protocol with insulin antibody was used to determine the cell distribution of Kv9.3 mRNA. Kv9.3-positive cells completely overlap with insulin-containing cells (Fig. 5D–F), but not with those cells containing glucagon (Fig. 5I). These data suggest that Kv9.3 mRNA is exclusively expressed in β-cells. Although Kv10.1 and Kv11.1 are found in human islets by RT-PCR (see above), we did not attempt to further characterize the cell distribution of these two silent subunits.

Kv subunits not found in the islet.

Other subunits, such as Kv1.6, Kv3.3, and Kv4.1, were identified by RT-PCR in human islets. In ISH/IHC protocols, the three subtypes appear to be located outside of the islet, and no colocalization with insulin was observed for any of them (Fig. 6A–I). Morphologically, the tubular configuration of the Kv1.6-expressing cells suggests that these cells could be acinar, Schwann, or nerve cells (4143).

The expression of Kv channels in islet cell types other than α-, β-, or δ-cells might contribute to the observed PCR signals (Fig. 1). However, this contribution does not appear to be significant because, by ISH, Kv channels that coexpress with either insulin, somatostatin, or glucagon are only found in cells that contain that marker. If other cell types were responsible for the PCR signal, at least some cells would be expected to show the Kv signal separate from the marker.

The identification of the molecular components for the IDR in human β-cells is critical for the development of an inhibitor of this channel that would function as a glucose-dependent insulin secretagogue for the treatment of type 2 diabetes. This study is an attempt to identify the Kv subunits that are present in human β-cells, with the ultimate goal of correlating their biophysical and pharmacological properties with the currents found in β-cells. The initial ISH experiments on both human and Rhesus islets demonstrate that expression of the Kv channels under investigation exhibit the same pattern in both species. Our results combining RT-PCR with ISH and IHC strongly suggest that Kv2.1 and Kv3.2 are the major subunits in β-cells. In addition, silent subunits Kv6.2 and 9.3 are also present in β-cells (Table 3).

In heterologous expression systems, Kv2.1 and Kv3.2 express delayed rectifier-type currents that resemble those present in β-cells (4446). Therefore, either one or the other or both may contribute to IDR in β-cells. Because the tetraethylammonium ion and hanatoxin sensitivities of individually heterologously expressed channels are quite different, it may be possible to use these tools to distinguish the relative contributions of these channel subtypes to the β-cell IDR (44).

It is interesting that two silent subunits, Kv6.2 and Kv9.3, are also expressed in human β-cells. In heterologous expression systems, these subunits are known to coassemble with subunits from either Kv2 or Kv3 families and to modify their function (24,4749). It remains to be determined if this also occurs in β-cells. In addition two other silent subunits, Kv10.1 and 11.1, previously reported to be in pancreas and also known to associate with subunits from Kv2 and Kv3 family (50), are found in islets. Their presence in β-cells and their significance will require further investigation.

It is curious that members from two particular families distribute to different cell types within the islet. For instance, Kv2.1 and Kv3.2 distribute to the β-cell, whereas Kv2.2 and Kv3.1 are present in δ- and α-cells, respectively. This differential distribution has significant implications for the development of inhibitors that specifically target channels present in β-cells.

There have been reports of Kv1 family channels in islets, β-cells, and insulin-secreting cell lines (16,51,52). In human islets, others (51) have reported that by RT-PCR Kv1.1, Kv1.2, and Kv1.4 are not found, while Kv1.5 and Kv1.6 were present. In our studies of human islets, only Kv1.3 and Kv1.6 were identified by RT-PCR, with a very weak indication for Kv1.7. Kv1.6 is external to the islet, in contrast to the recent report of its presence in rat β-cells (53). While Kv1.4 seems to be absent from human islets by RT-PCR, it appears to be present in rat β-cells by Western blot and PCR (51), but not in mouse by immunostaining (53). These data could indicate differences in channel composition between species and highlights the importance of the identification of the relevant subunits in human β-cells.

The identification of different channel types exclusive to each of the three major cell types found in the islet suggests that it may be possible to select for cell-type-dependent intervention through block of their respective IDRs. All of the Kv subunits tested in islets have been found in other tissues, but, in general, the exact combination of subunits in these tissues is unknown. For the β-cell, determination of IDR composition may aid significantly in the identification of a glucose-dependent insulin secretagogue applicable in type 2 diabetes, without the hypoglycemic liabilities found with KATP inhibitors.

FIG. 1.

RT-PCR amplification of Kv channel subtypes from RNA of human fetal brain and pancreatic islets. A: Human fetal brain poly A+ RNA was subjected to RT-PCR amplification using primers shown in Table 1 as described in research design and methods. B: RNA extraction from pancreatic islets was performed and total RNA was reverse transcribed into cDNA. PCR amplifications of Kv channel subtypes in islets were performed under the same conditions as described in A. Results from the electrophoresis of the PCR products that were separated on 1% agarose gels and stained with ethidium bromide are presented. On the left side of each image are the DNA markers (800 ng/lane; Bio-Rad Laboratories, Hercules, CA) of different sizes (bp). The top of each image labels the subtype of Kv channel represented by each lane. All PCR products showed the expected molecular sizes; some were cloned in bacterial vectors and sequenced to verify identity (data not shown). PCR reactions with water instead of cDNA were performed as a control (data not shown.)

FIG. 1.

RT-PCR amplification of Kv channel subtypes from RNA of human fetal brain and pancreatic islets. A: Human fetal brain poly A+ RNA was subjected to RT-PCR amplification using primers shown in Table 1 as described in research design and methods. B: RNA extraction from pancreatic islets was performed and total RNA was reverse transcribed into cDNA. PCR amplifications of Kv channel subtypes in islets were performed under the same conditions as described in A. Results from the electrophoresis of the PCR products that were separated on 1% agarose gels and stained with ethidium bromide are presented. On the left side of each image are the DNA markers (800 ng/lane; Bio-Rad Laboratories, Hercules, CA) of different sizes (bp). The top of each image labels the subtype of Kv channel represented by each lane. All PCR products showed the expected molecular sizes; some were cloned in bacterial vectors and sequenced to verify identity (data not shown). PCR reactions with water instead of cDNA were performed as a control (data not shown.)

FIG. 2.

Kv2.1 channel is expressed in pancreatic β-cells and Kv2.2 channel is expressed in δ-cells. In all sections, cell nuclei were stained with DAPI and are shown in blue. A: ISH for Kv2.1 mRNA-positive cells (red) can be seen within an islet from Rhesus pancreas. B: IHC with insulin detects β-cells (green) within the same islet as seen in panel A. C: Colocalization (yellow) of Kv2.1 mRNA and insulin within the same section. D: Results from a double-staining ISH/IHC experiment including Kv2.1 mRNA (red) and glucagon protein (green) in a human islet. The lack of yellow indicates no coexpression of Kv2.1 mRNA with glucagon. E: IHC of Kv2.1 protein visualized with Texas red (red) labels cells within a Rhesus islet. F: Kv2.2 mRNA-containing cells (red) are present within a Rhesus islet. G: Insulin label of β-cells (green) in the same region of the islet. H: Lack of colocalization (yellow) of Kv2.2 mRNA and insulin protein. I: Kv2.2 mRNA-positive cells (red) are present within a region of a Rhesus islet. J: Somatostatin-containing pancreatic δ-cells (green) within the same section of the islet as in panel I. K: Kv2.2 mRNA colocalizes (yellow) with somatostatin.

FIG. 2.

Kv2.1 channel is expressed in pancreatic β-cells and Kv2.2 channel is expressed in δ-cells. In all sections, cell nuclei were stained with DAPI and are shown in blue. A: ISH for Kv2.1 mRNA-positive cells (red) can be seen within an islet from Rhesus pancreas. B: IHC with insulin detects β-cells (green) within the same islet as seen in panel A. C: Colocalization (yellow) of Kv2.1 mRNA and insulin within the same section. D: Results from a double-staining ISH/IHC experiment including Kv2.1 mRNA (red) and glucagon protein (green) in a human islet. The lack of yellow indicates no coexpression of Kv2.1 mRNA with glucagon. E: IHC of Kv2.1 protein visualized with Texas red (red) labels cells within a Rhesus islet. F: Kv2.2 mRNA-containing cells (red) are present within a Rhesus islet. G: Insulin label of β-cells (green) in the same region of the islet. H: Lack of colocalization (yellow) of Kv2.2 mRNA and insulin protein. I: Kv2.2 mRNA-positive cells (red) are present within a region of a Rhesus islet. J: Somatostatin-containing pancreatic δ-cells (green) within the same section of the islet as in panel I. K: Kv2.2 mRNA colocalizes (yellow) with somatostatin.

FIG. 3.

Expression of Kv3.1 and Kv3.2 channels in pancreatic α- and β-cells, respectively. In all sections, cell nuclei were stained with DAPI and are illustrated in blue. A: Kv3.1 mRNA-containing cells (red) in a section of a human islet. B: Insulin protein-containing cells (green) in the same section used in panel A. C: Lack of colocalization (no yellow color) of Kv3.1 mRNA and insulin protein. D: Kv3.1 mRNA-positive cells (red) within a Rhesus islet. E: Glucagon-positive α-cells (green) are present within the same islet. F: Kv3.1 mRNA colocalizes with glucagon (yellow). G: Kv3.2 mRNA-containing cells (red) highlight an islet in a section from a Rhesus pancreas. H: Insulin immunoreactive cells (green) shown in the same islet. I: Colocalization of Kv3.2 mRNA and insulin protein (yellow). J: IHC of Kv3.2 protein visualized with fluorescein isothiocyanate (green) labels cells within a Rhesus islet. K: Kv2.1 mRNA-positive cells (red) shown within the same islet. L: Kv3.2 protein colocalizes with Kv2.1 mRNA in the same cells (yellow).

FIG. 3.

Expression of Kv3.1 and Kv3.2 channels in pancreatic α- and β-cells, respectively. In all sections, cell nuclei were stained with DAPI and are illustrated in blue. A: Kv3.1 mRNA-containing cells (red) in a section of a human islet. B: Insulin protein-containing cells (green) in the same section used in panel A. C: Lack of colocalization (no yellow color) of Kv3.1 mRNA and insulin protein. D: Kv3.1 mRNA-positive cells (red) within a Rhesus islet. E: Glucagon-positive α-cells (green) are present within the same islet. F: Kv3.1 mRNA colocalizes with glucagon (yellow). G: Kv3.2 mRNA-containing cells (red) highlight an islet in a section from a Rhesus pancreas. H: Insulin immunoreactive cells (green) shown in the same islet. I: Colocalization of Kv3.2 mRNA and insulin protein (yellow). J: IHC of Kv3.2 protein visualized with fluorescein isothiocyanate (green) labels cells within a Rhesus islet. K: Kv2.1 mRNA-positive cells (red) shown within the same islet. L: Kv3.2 protein colocalizes with Kv2.1 mRNA in the same cells (yellow).

FIG. 4.

Kv6.1 channel is expressed in islet α-cells, and Kv6.2 channel is expressed in islet β-cells. In all sections, cell nuclei were stained with DAPI and are illustrated in blue. A: Kv6.1 mRNA-containing cells (red) are found within a human islet. B: Insulin-positive cells (green) in the same section as in panel A highlight different islet cells. C and D: Microscopic analysis reveals lack of colocalization (no yellow color) between Kv6.1 mRNA and insulin. E: Kv6.1 mRNA-containing cells (red) in a section of a human islet. F: Glucagon protein-containing cells (green) in the same section used in E. G and H: Colocalization (yellow) of Kv6.1 mRNA and glucagon protein was detected. I: Kv6.2 mRNA-containing cells (red) in a section of a Rhesus islet. J: Insulin protein-containing cells (green) in the same section used in I. K and L: Colocalization (yellow) of Kv6.2 mRNA and insulin protein.

FIG. 4.

Kv6.1 channel is expressed in islet α-cells, and Kv6.2 channel is expressed in islet β-cells. In all sections, cell nuclei were stained with DAPI and are illustrated in blue. A: Kv6.1 mRNA-containing cells (red) are found within a human islet. B: Insulin-positive cells (green) in the same section as in panel A highlight different islet cells. C and D: Microscopic analysis reveals lack of colocalization (no yellow color) between Kv6.1 mRNA and insulin. E: Kv6.1 mRNA-containing cells (red) in a section of a human islet. F: Glucagon protein-containing cells (green) in the same section used in E. G and H: Colocalization (yellow) of Kv6.1 mRNA and glucagon protein was detected. I: Kv6.2 mRNA-containing cells (red) in a section of a Rhesus islet. J: Insulin protein-containing cells (green) in the same section used in I. K and L: Colocalization (yellow) of Kv6.2 mRNA and insulin protein.

FIG. 5.

Expression of Kv9.3, but not Kv9.2, channels in pancreatic β-cells. In all sections, cell nuclei were stained with DAPI and are illustrated in blue. A: Kv9.2 mRNA-containing cells (red) in a section of a human islet. B: Insulin immunoreactive cells (green) in the same section used in panel A. C: Lack of colocalization (no yellow color) of Kv9.2 mRNA and insulin protein. D: Kv9.3 mRNA-containing cells (red) within a Rhesus islet. E: Insulin-positive cells (green) in the same section used in D. F: Significant colocalization (yellow) of Kv9.3 mRNA and insulin protein was detected. G: Kv9.3 mRNA-containing cells (red) within an islet. H: Glucagon protein-containing cells (green) in the same section used in G. I: Lack of colocalization (no yellow color) of Kv9.3 mRNA and glucagon protein was detected.

FIG. 5.

Expression of Kv9.3, but not Kv9.2, channels in pancreatic β-cells. In all sections, cell nuclei were stained with DAPI and are illustrated in blue. A: Kv9.2 mRNA-containing cells (red) in a section of a human islet. B: Insulin immunoreactive cells (green) in the same section used in panel A. C: Lack of colocalization (no yellow color) of Kv9.2 mRNA and insulin protein. D: Kv9.3 mRNA-containing cells (red) within a Rhesus islet. E: Insulin-positive cells (green) in the same section used in D. F: Significant colocalization (yellow) of Kv9.3 mRNA and insulin protein was detected. G: Kv9.3 mRNA-containing cells (red) within an islet. H: Glucagon protein-containing cells (green) in the same section used in G. I: Lack of colocalization (no yellow color) of Kv9.3 mRNA and glucagon protein was detected.

FIG. 6.

Kv1.6, Kv3.3, and Kv4.1 channels are not expressed in Rhesus pancreatic β-cells. In all sections, cell nuclei were stained with DAPI and are illustrated in blue. All images in this figure were taken from sections of Rhesus pancreas A: Kv1.6 immunoreactive cells, detected with Texas red (red), are located outside of the islet. B: Insulin immunoreactivity labels the same islet as seen in panel A and delineates the β-cells. C: Combination of IHC for Kv1.6 (red) and insulin (green) demonstrate signals on different cells. There is no coexpression as judged by the lack of yellow color. D: Kv3.3 mRNA-containing cells (red) in a section of pancreas. E: Insulin protein-containing cells (green) in the same islet. F: No colocalization (no yellow color) of Kv3.3 mRNA and insulin protein was detected. G: Kv4.1 mRNA-containing cells (red) in a section of pancreas. H: Insulin protein-containing cells (green) in the same section of the islet. I: No colocalization (no yellow color) of Kv4.1 mRNA and insulin protein was detected within the islet.

FIG. 6.

Kv1.6, Kv3.3, and Kv4.1 channels are not expressed in Rhesus pancreatic β-cells. In all sections, cell nuclei were stained with DAPI and are illustrated in blue. All images in this figure were taken from sections of Rhesus pancreas A: Kv1.6 immunoreactive cells, detected with Texas red (red), are located outside of the islet. B: Insulin immunoreactivity labels the same islet as seen in panel A and delineates the β-cells. C: Combination of IHC for Kv1.6 (red) and insulin (green) demonstrate signals on different cells. There is no coexpression as judged by the lack of yellow color. D: Kv3.3 mRNA-containing cells (red) in a section of pancreas. E: Insulin protein-containing cells (green) in the same islet. F: No colocalization (no yellow color) of Kv3.3 mRNA and insulin protein was detected. G: Kv4.1 mRNA-containing cells (red) in a section of pancreas. H: Insulin protein-containing cells (green) in the same section of the islet. I: No colocalization (no yellow color) of Kv4.1 mRNA and insulin protein was detected within the islet.

TABLE 1

PCR primers used for RT-PCR amplification of Kv channels

SubtypeAccession no.Sense primer (5′ to 3′)Antisense primer (5′ to 3′)
Kv1.1 L02750 CATCTGGTTCTCCTTCGAGC GTTAGGGGAACTGACGTGGA 
Kv1.2 L02752 TCCGGGATGAGAATGAAGAC TTGGACAGCTTGTCACTTGC 
Kv1.3 M55515 GTTCTCCTTCGAACTGCTGG CTGAAGAGGAGAGGTGCTGG 
Kv1.4 M55514 CCCCAGCTTTGATGCCATCTTG TGAGGATGGCAAAGGACATGGC 
Kv1.5 M55513 TGCGTCATCTGGTTCACCTTCG TGTTCAGCAAGCCTCCCATTCC 
Kv1.6 X17622 TCAACAGGATGGAAACCAGCCC CTGCCATCTGCAACACGATTCC 
Kv1.7 AJ310479 TGCCCTTCAATGACCCGTTCTTC AAGACACGCACCAATCGGATGAC 
Kv2.1 L02840 TACAGCCTCGACGACAACG ACCACGCGGCGGACATTCTG 
Kv2.2 U69962 AACGAAGAACTGAGGCGAGAG ACTCCGCCTAAGGGTGAAAC 
Kv3.1 S56770 AACCCCATCGTGAACAAGACGG TCATGGTGACCACGGCCCA 
Kv3.2 AI363404 CTGCTGCTGGATGACCTACC TGTGCCATTGATGACTGGTT 
Kv3.3 AF055989 TTCTGCCTGGAAACCCATGAGG TGTTGACAATGACGGGCACAGG 
Kv3.4 M64676 TTCAAGCTCACACGCCACTTCG TGCCAAATCCCAAGGTCTGAGG 
Kv4.1 AJ005898 ATCTCGAGGAGATGAGGTTC TTCTTTCGGTCCCGATAC 
Kv4.3 AF048712 TGGCTTCTTCATCGCTGTCTCG CCGAAGATCTTCCCTGCAATCG 
Kv4.4 NM_012283 AGCCAAGAAGAACAAGCTG AGGAAGTTTAGGACATGCC 
Kv5.1 AF033382 TCCACATGAAGAAGGGCATCTGC TCACGTAGAAGGGGAGGATG 
Kv6.1 AF033383 TGCACCAACTTCGACGACATCC GGAACTCCAGGGAGAACCAGCC 
Kv6.2 AJ0111021 AAGCTCTTCGCCTGCGTGTC CAGCAGCAGCGACACGTAGAAC 
Kv6.3 NM_172347 ATGCCCATGCCTTCCAGAGA AGAGCTGCACGATCTCCTCG 
Kv8.1 AF167082 TTCCACAGCTGCCCGTATCTTTG TTTTGCCTGTGGTGGTGTCTGG 
Kv9.1 AF043473 TTTGAGGACTTGCTGAGCAGCG TTGCTCCAGGCACACCAACAAG 
Kv9.2 XM_043106 GTACTGGGGCATCAACGAGT CCACGGAGAGGTAGAGCAAG 
Kv9.3 AF043472 CTCTGTGGGCATTTCCATTT AGAAACAGGCACAAACACCC 
Kv10.1 AF348982 GCTTGCCCGTCACTTCATTGGTC TTCTTCCAGGCACTGTGATAGGA 
Kv11.1 AF348983 AGCCATGCTCAAACAGAGTG CTCCTCGTAGTCGTCGCACA 
SubtypeAccession no.Sense primer (5′ to 3′)Antisense primer (5′ to 3′)
Kv1.1 L02750 CATCTGGTTCTCCTTCGAGC GTTAGGGGAACTGACGTGGA 
Kv1.2 L02752 TCCGGGATGAGAATGAAGAC TTGGACAGCTTGTCACTTGC 
Kv1.3 M55515 GTTCTCCTTCGAACTGCTGG CTGAAGAGGAGAGGTGCTGG 
Kv1.4 M55514 CCCCAGCTTTGATGCCATCTTG TGAGGATGGCAAAGGACATGGC 
Kv1.5 M55513 TGCGTCATCTGGTTCACCTTCG TGTTCAGCAAGCCTCCCATTCC 
Kv1.6 X17622 TCAACAGGATGGAAACCAGCCC CTGCCATCTGCAACACGATTCC 
Kv1.7 AJ310479 TGCCCTTCAATGACCCGTTCTTC AAGACACGCACCAATCGGATGAC 
Kv2.1 L02840 TACAGCCTCGACGACAACG ACCACGCGGCGGACATTCTG 
Kv2.2 U69962 AACGAAGAACTGAGGCGAGAG ACTCCGCCTAAGGGTGAAAC 
Kv3.1 S56770 AACCCCATCGTGAACAAGACGG TCATGGTGACCACGGCCCA 
Kv3.2 AI363404 CTGCTGCTGGATGACCTACC TGTGCCATTGATGACTGGTT 
Kv3.3 AF055989 TTCTGCCTGGAAACCCATGAGG TGTTGACAATGACGGGCACAGG 
Kv3.4 M64676 TTCAAGCTCACACGCCACTTCG TGCCAAATCCCAAGGTCTGAGG 
Kv4.1 AJ005898 ATCTCGAGGAGATGAGGTTC TTCTTTCGGTCCCGATAC 
Kv4.3 AF048712 TGGCTTCTTCATCGCTGTCTCG CCGAAGATCTTCCCTGCAATCG 
Kv4.4 NM_012283 AGCCAAGAAGAACAAGCTG AGGAAGTTTAGGACATGCC 
Kv5.1 AF033382 TCCACATGAAGAAGGGCATCTGC TCACGTAGAAGGGGAGGATG 
Kv6.1 AF033383 TGCACCAACTTCGACGACATCC GGAACTCCAGGGAGAACCAGCC 
Kv6.2 AJ0111021 AAGCTCTTCGCCTGCGTGTC CAGCAGCAGCGACACGTAGAAC 
Kv6.3 NM_172347 ATGCCCATGCCTTCCAGAGA AGAGCTGCACGATCTCCTCG 
Kv8.1 AF167082 TTCCACAGCTGCCCGTATCTTTG TTTTGCCTGTGGTGGTGTCTGG 
Kv9.1 AF043473 TTTGAGGACTTGCTGAGCAGCG TTGCTCCAGGCACACCAACAAG 
Kv9.2 XM_043106 GTACTGGGGCATCAACGAGT CCACGGAGAGGTAGAGCAAG 
Kv9.3 AF043472 CTCTGTGGGCATTTCCATTT AGAAACAGGCACAAACACCC 
Kv10.1 AF348982 GCTTGCCCGTCACTTCATTGGTC TTCTTCCAGGCACTGTGATAGGA 
Kv11.1 AF348983 AGCCATGCTCAAACAGAGTG CTCCTCGTAGTCGTCGCACA 
TABLE 2

DNA probes used for ISH

SubtypeSequence (5′ to 3′)
hKv2.1 CTCAAAGTTGAACGCTATTGCTGTGTGTTTCTCAGGAGACC 
 TGACCAATCATTCCCTGTAGCTGTCTAACAGTGGAATCCATCC 
hKv2.2 GGACTGTCGGTGGCATTGTCAGACTGCAAAGGACTATGTAGC 
 CCATCCCTGGCAGCAGGTCCTTTCTCTCTGGATAGAGTTAG 
hKv3.1 TCGGCGTCCGCGTCGTCGGCGCTGTTGTCCAGAGGAG 
 CTCCCGGTAGTAGCGCACTTGCGTGCCATTGCGAACG 
hKv3.2 GCCAGGCGTGTTCCAGGCAGGGTCTTGAGGGTG 
 TTCGAAGACCCCTACTCGTCCAGAGCCGCCAGGTTTA 
hKv4.1 CCTGGGTCACCGTCTTGTTGCTAATATGGATGAAGCC 
 GTCGGTGAGGAGGAAGCAGGCTCGGTCCCGGCTATA 
hKv6.1 GTGAAGGCATCTCGAGGAGATGAGGTTC 
 GAAGGAATTCTTCTACGATGCTGACTCA 
hKv6.2 TGAGGATGTCGTCGAAGTTGGTGCAGGCCTTGAGCTG 
 GATGAGGAACTGCGCCCTCCGGAACATCACCCTCT 
hKv9.2 ACTGGGCCACAAGCACTAGAATAGCGTACACGATGGAC 
 GGCTGCCCATCGAACTTGGAGGCGTCGTTGTAGAAGGC 
hKv9.3 GAGGAAACCGCAGGAGGGTGCTTTGGTCAACAGACTGC 
 GGAGCTGACCAAATCGCAGTGTGTCAAACTTCTCCAGC 
SubtypeSequence (5′ to 3′)
hKv2.1 CTCAAAGTTGAACGCTATTGCTGTGTGTTTCTCAGGAGACC 
 TGACCAATCATTCCCTGTAGCTGTCTAACAGTGGAATCCATCC 
hKv2.2 GGACTGTCGGTGGCATTGTCAGACTGCAAAGGACTATGTAGC 
 CCATCCCTGGCAGCAGGTCCTTTCTCTCTGGATAGAGTTAG 
hKv3.1 TCGGCGTCCGCGTCGTCGGCGCTGTTGTCCAGAGGAG 
 CTCCCGGTAGTAGCGCACTTGCGTGCCATTGCGAACG 
hKv3.2 GCCAGGCGTGTTCCAGGCAGGGTCTTGAGGGTG 
 TTCGAAGACCCCTACTCGTCCAGAGCCGCCAGGTTTA 
hKv4.1 CCTGGGTCACCGTCTTGTTGCTAATATGGATGAAGCC 
 GTCGGTGAGGAGGAAGCAGGCTCGGTCCCGGCTATA 
hKv6.1 GTGAAGGCATCTCGAGGAGATGAGGTTC 
 GAAGGAATTCTTCTACGATGCTGACTCA 
hKv6.2 TGAGGATGTCGTCGAAGTTGGTGCAGGCCTTGAGCTG 
 GATGAGGAACTGCGCCCTCCGGAACATCACCCTCT 
hKv9.2 ACTGGGCCACAAGCACTAGAATAGCGTACACGATGGAC 
 GGCTGCCCATCGAACTTGGAGGCGTCGTTGTAGAAGGC 
hKv9.3 GAGGAAACCGCAGGAGGGTGCTTTGGTCAACAGACTGC 
 GGAGCTGACCAAATCGCAGTGTGTCAAACTTCTCCAGC 
TABLE 3

Summary of expression of Kv channels in primate islets

SubtypePCRISH/IHCSubtypePCRISH/IHC
Kv1.1 − ND* Kv4.1 nonislet 
Kv1.2 − ND Kv4.3 − ND 
Kv1.3 ND Kv4.4 (+) ND 
Kv1.4 − ND Kv5.1 − ND 
Kv1.5 − ND Kv6.1 α-cell 
Kv1.6 nonislet Kv6.2 β-cell 
Kv1.7 ND Kv6.3 − ND 
Kv2.1 β-cell Kv8.1 − ND 
Kv2.2 δ-cell Kv9.1 (+) ND 
Kv3.1 α-cell Kv9.2 non-β-cell 
Kv3.2 β-cell Kv9.3 β-cell 
Kv3.3 nonislet Kv10.1 ND 
Kv3.4 (+)* ND Kv11.1 ND 
SubtypePCRISH/IHCSubtypePCRISH/IHC
Kv1.1 − ND* Kv4.1 nonislet 
Kv1.2 − ND Kv4.3 − ND 
Kv1.3 ND Kv4.4 (+) ND 
Kv1.4 − ND Kv5.1 − ND 
Kv1.5 − ND Kv6.1 α-cell 
Kv1.6 nonislet Kv6.2 β-cell 
Kv1.7 ND Kv6.3 − ND 
Kv2.1 β-cell Kv8.1 − ND 
Kv2.2 δ-cell Kv9.1 (+) ND 
Kv3.1 α-cell Kv9.2 non-β-cell 
Kv3.2 β-cell Kv9.3 β-cell 
Kv3.3 nonislet Kv10.1 ND 
Kv3.4 (+)* ND Kv11.1 ND 
*

Seen in one of three islet preparations.

L.Y. and D.J.F. contributed equally to this article.

We would like to thank Drs. Maria Garcia, Jim Herrington, and Owen B. McManus for critical discussion and constructive comments. We would also like to thank Dr. H.G. Knaus for generously supplying antibodies for Kv1.6 and Dr. Jonathan Lakey for supplying human islets.

1.
Hille B: Ion channels of excitable membranes. In
Potassium Channels and Chloride Channels.
Sunderland, U.K., Sinauer Associates,
2001
, p.
137
–167
2.
Dukes ID, Philipson LH: K+ channels: generating excitement in pancreatic β-cells.
Diabetes
45
:
845
–853,
1996
3.
Aguilar-Bryan L, Bryan J: Molecular biology of adenosine triphosphate-sensitive potassium channels.
Endocr Rev
20
:
101
–135,
1999
4.
Miki T, Nagashima K, Seino S: The structure and function of the ATP-sensitive K+ channel in insulin-secreting pancreatic beta-cells.
J Mol Endocrinol
22
:
113
–123,
1999
5.
Ashcroft FM, Gribble FM: Correlating structure and function in ATP-sensitive K+ channels.
Trends Neurosci
21
:
288
–294,
1998
6.
Yokoshiki H, Sunagawa M, Seki T, Sperelakis N: ATP-sensitive K+ channels in pancreatic, cardiac, and vascular smooth muscle cells.
Am J Physiol
274
:
C25
–C37,
1998
7.
Ashcroft SJ: The beta-cell KATP channel.
J Membr Biol
176
:
187
–206,
2000
8.
Petit P, Loubatieres-Mariani MM: Potassium channels of the insulin-secreting B cell.
Fundam Clin Pharmacol
6
:
123
–134,
1992
9.
Kukuljan M, Goncalves AA, Atwater I: Charybdotoxin-sensitive KCa channel is not involved in glucose-induced electrical activity in pancreatic beta-cells.
J Membr Biol
119
:
187
–195,
1991
10.
Gopel SO, Kanno T, Barg S, Eliasson L, Galvanovskis J, Renstrom E, Rorsman P: Activation of Ca2+-dependent K+ channels contributes to rhythmic firing of action potentials in mouse pancreatic beta cells.
J Gen Physiol
114
:
759
–770,
1999
11.
Rorsman P, Eliasson L, Renstrom E, Gromada J, Barg S, Gopel S: The cell physiology of biphasic insulin secretion.
News Physiol Sci
15
:
72
–77,
2000
12.
Smith PA, Bokvist K, Arkhammar P, Berggren PO, Rorsman P: Delayed rectifying and calcium-activated K+ channels and their significance for action potential repolarization in mouse pancreatic beta-cells.
J Gen Physiol
95
:
1041
–1059,
1990
13.
Smith PA, Bokvist K, Rorsman P: Demonstration of A-currents in pancreatic islet cells.
Pflugers Arch
413
:
441
–443,
1989
14.
Zunkler BJ, Trube G, Ohno-Shosaku T: Forskolin-induced block of delayed rectifying K+ channels in pancreatic beta-cells is not mediated by cAMP.
Pflugers Arch
411
:
613
–619,
1988
15.
Philipson LH, Rosenberg MP, Kuznetsov A, Lancaster ME, Worley JF 3rd, Roe MW, Dukes ID: Delayed rectifier K+ channel overexpression in transgenic islets and beta-cells associated with impaired glucose responsiveness.
J Biol Chem
269
:
27787
–27790,
1994
16.
Roe MW, Worley JF 3rd, Mittal AA, Kuznetsov A, DasGupta S, Mertz RJ, Witherspoon SM 3rd, Blair N, Lancaster ME, McIntyre MS, Shehee WR, Dukes ID, Philipson LH: Expression and function of pancreatic beta-cell delayed rectifier K+ channels: role in stimulus-secretion coupling.
J Biol Chem
271
:
32241
–32246,
1996
17.
Eberhardson M, Tengholm A, Grapengiesser E: The role of plasma membrane K+ and Ca2+ permeabilities for glucose induction of slow Ca2+oscillations in pancreatic beta-cells.
Biochim Biophys Acta
1283
:
67
–72,
1996
18.
Burge MR, Sood V, Sobhy TA, Rassam AG, Schade DS: Sulphonylurea-induced hypoglycaemia in type 2 diabetes mellitus: a review.
Diabetes Obes Metab
1
:
199
–206,
1999
19.
Del Prato S, Aragona M, Coppelli A, Burge MR, Sood V, Sobhy TA, Rassam AG, Schade DS: Sulfonylureas and hypoglycaemia: sulphonylurea-induced hypoglycaemia in type 2 diabetes mellitus: a review.
Diabetes Nutr Metab
15
:
444
–450,
2002
[discussion in 15:450–451, 2002]
20.
MacDonald PE, Salapatek AM, Wheeler MB: Glucagon-like peptide-1 receptor activation antagonizes voltage-dependent repolarizing K+ currents in β-cells: a possible glucose-dependent insulinotropic mechanism.
Diabetes
51 (Suppl. 3)
:
S443
–S447,
2002
21.
Kanno T, Gopel SO, Rorsman P, Wakui M: Cellular function in multicellular system for hormone-secretion: electrophysiological aspect of studies on alpha-, beta- and delta-cells of the pancreatic islet.
Neurosci Res
42
:
79
–90,
2002
22.
Coetzee WA, Amarillo Y, Chiu J, Chow A, Lau D, McCormack T, Moreno H, Nadal MS, Ozaita A, Pountney D, Saganich M, Vega-Saenz de Miera E, Rudy B: Molecular diversity of K+ channels.
Ann N Y Acad Sci
868
:
233
–285,
1999
23.
Zhao B, Rassendren F, Kaang BK, Furukawa Y, Kubo T, Kandel ER: A new class of noninactivating K+ channels from aplysia capable of contributing to the resting potential and firing patterns of neurons.
Neuron
13
:
1205
–1213,
1994
24.
Stocker M, Hellwig M, Kerschensteiner D: Subunit assembly and domain analysis of electrically silent K+ channel alpha-subunits of the rat Kv9 subfamily.
J Neurochem
72
:
1725
–1734,
1999
25.
Zhu XR, Netzer R, Bohlke K, Liu Q, Pongs O: Structural and functional characterization of Kv6.2 a new gamma-subunit of voltage-gated potassium channel.
Receptors Channels
6
:
337
–350,
1999
26.
Kerschensteiner D, Stocker M: Heteromeric assembly of Kv2.1 with Kv9.3: effect on the state dependence of inactivation.
Biophys J
77
:
248
–257,
1999
27.
Sano Y, Mochizuki S, Miyake A, Kitada C, Inamura K, Yokoi H, Nozawa K, Matsushime H, Furuichi K: Molecular cloning and characterization of Kv6.3, a novel modulatory subunit for voltage-gated K+ channel Kv2.1.
FEBS Lett
512
:
230
–234,
2002
28.
Su J, Yu H, Lenka N, Hescheler J, Ullrich S: The expression and regulation of depolarization-activated K+ channels in the insulin-secreting cell line INS-1.
Pflugers Arch
442
:
49
–56,
2001
29.
Betsholtz C, Baumann A, Kenna S, Ashcroft FM, Ashcroft SJ, Berggren PO, Grupe A, Pongs O, Rorsman P, Sandblom J: Expression of voltage-gated K+ channels in insulin-producing cells: analysis by polymerase chain reaction.
FEBS Lett
263
:
121
–126,
1990
30.
Philipson LH, Hice RE, Schaefer K, LaMendola J, Bell GI, Nelson DJ, Steiner DF: Sequence and functional expression in Xenopus oocytes of a human insulinoma and islet potassium channel.
Proc Natl Acad Sci U S A
88
:
53
–57,
1991
31.
Bubacz DG, Dukes ID, McLean EW, Noe RA, Peat AJ, Szewczyk JR, Thomson SA, Worley JF: Kv2.1 antagonists.
WO 99/32487
,
1999
(PCT/EP98/08085)
32.
MacDonald PE, Sewing S, Wang J, Joseph JW, Smukler SR, Sakellaropoulos G, Saleh MC, Chan CB, Tsushima RG, Salapatek AM, Wheeler MB: Inhibition of Kv2.1 voltage-dependent K+ channels in pancreatic beta-cells enhances glucose-dependent insulin secretion.
J Biol Chem
277
:
44938
–44945,
2002
33.
MacDonald PE, Wang G, Tsuk S, Dodo C, Kang Y, Tang L, Wheeler MB, Cattral MS, Lakey JR, Salapatek AM, Lotan I, Gaisano HY: Synaptosome-associated protein of 25 kilodaltons modulates Kv2.1 voltage-dependent K+ channels in neuroendocrine islet beta-cells through an interaction with the channel N terminus.
Mol Endocrinol
16
:
2452
–2461,
2002
34.
Koch RO, Wanner SG, Koschak A, Hanner M, Schwarzer C, Kaczorowski GJ, Slaughter RS, Garcia ML, Knaus HG: Complex subunit assembly of neuronal voltage-gated K+ channels: basis for high-affinity toxin interactions and pharmacology.
J Biol Chem
272
:
27577
–27581,
1997
35.
Fiedor P, Rowinski W, Licinska I, Mazurek AP, Hardy MA: The survival identification of pancreatic islets of Langerhans: in vitro and in vivo effects of two dithizone preparations on staining of rat and human islets of Langerhans-preliminary study (Part I).
Acta Pol Pharm
52
:
431
–436,
1995
36.
Lynch KR, O’Neill GP, Liu Q, Im DS, Sawyer N, Metters KM, Coulombe N, Abramovitz M, Figueroa DJ, Zeng Z, Connolly BM, Bai C, Austin CP, Chateauneuf A, Stocco R, Greig GM, Kargman S, Hooks SB, Hosfield E, Williams DL, Jr, Ford-Hutchinson AW, Caskey CT, Evans JF: Characterization of the human cysteinyl leukotriene CysLT1 receptor.
Nature
399
:
789
–793,
1999
37.
Figueroa DJ, Hess JF, Ky B, Brown SD, Sandig V, Hermanowski-Vosatka A, Twells RC, Todd JA, Austin CP: Expression of the type I diabetes-associated gene LRP5 in macrophages, vitamin A system cells, and the islets of Langerhans suggests multiple potential roles in diabetes.
J Histochem Cytochem
48
:
1357
–1368,
2000
38.
Kalman K, Nguyen A, Tseng-Crank J, Dukes ID, Chandy G, Hustad CM, Copeland NG, Jenkins NA, Mohrenweiser H, Brandriff B, Cahalan M, Gutman GA, Chandy KG: Genomic organization, chromosomal localization, tissue distribution, and biophysical characterization of a novel mammalian Shaker-related voltage-gated potassium channel, Kv1.7.
J Biol Chem
273
:
5851
–5857,
1998
39.
Klein T, Ling Z, Heimberg H, Madsen OD, Heller RS, Serup P: Nestin is expressed in vascular endothelial cells in the adult human pancreas.
J Histochem Cytochem
51
:
697
–706,
2003
40.
Baetens D, Vasko M, Unger RH, Orci L: Ultrastructural detection of granulated cells in the autonomic ganglia of the rat pancreas.
Diabetologia
28
:
841
–846,
1985
41.
Persson-Sjogren S, Zashihin A, Forsgren S, Ushiki T, Watanabe S, Castorina S, Romeo R, Marcello MF: Nerve cells associated with the endocrine pancreas in young mice: an ultrastructural analysis of the neuroinsular complex type I.
Histochem J
33
:
373
–378,
2001
42.
Ushiki T, Watanabe S: Distribution and ultrastructure of the autonomic nerves in the mouse pancreas.
Microsc Res Tech
37
:
399
–406,
1997
43.
Castorina S, Romeo R, Marcello MF: Immunohistochemical study of intrinsic innervation in the human pancreas.
Boll Soc Ital Biol Sper
72
:
1
–7,
1996
44.
Swartz KJ, MacKinnon R: An inhibitor of the Kv2.1 potassium channel isolated from the venom of a Chilean tarantula.
Neuron
15
:
941
–949,
1995
45.
Rudy B, McBain CJ: Kv3 channels: voltage-gated K+ channels designed for high-frequency repetitive firing.
Trends Neurosci
24
:
517
–526,
2001
46.
Kelly RP, Sutton R, Ashcroft FM: Voltage-activated calcium and potassium currents in human pancreatic beta-cells.
J Physiol
443
:
175
–192,
1991
47.
Post MA, Kirsch GE, Brown AM: Kv2.1 and electrically silent Kv6.1 potassium channel subunits combine and express a novel current.
FEBS Lett
399
:
177
–182,
1996
48.
Salinas M, Duprat F, Heurteaux C, Hugnot JP, Lazdunski M: New modulatory alpha subunits for mammalian Shab K+ channels.
J Biol Chem
272
:
24371
–24379,
1997
49.
Blaine JT, Ribera AB: Heteromultimeric potassium channels formed by members of the Kv2 subfamily.
J Neurosci
18
:
9585
–9593,
1998
50.
Ottschytsch N, Raes A, Van Hoorick D, Snyders DJ: Obligatory heterotetramerization of three previously uncharacterized Kv channel alpha-subunits identified in the human genome.
Proc Natl Acad Sci U S A
99
:
7986
–7991,
2002
51.
MacDonald PE, Ha XF, Wang J, Smukler SR, Sun AM, Gaisano HY, Salapatek AM, Backx PH, Wheeler MB: Members of the Kv1 and Kv2 voltage-dependent K+ channel families regulate insulin secretion.
Mol Endocrinol
15
:
1423
–1435,
2001
52.
MacDonald PE, Wheeler MB: Voltage-dependent K+ channels in pancreatic beta cells: role, regulation and potential as therapeutic targets.
Diabetologia
46
:
1046
–1062,
2003
53.
Gopel SO, Kanno T, Barg S, Rorsman P: Patch-clamp characterisation of somatostatin-secreting-cells in intact mouse pancreatic islets.
J Physiol
528
:
497
–507,
2000