The IDDM5 gene, which is identified by whole-genome searches, is located on chromosome 6q25. TAB2 (MAP3K7IP2 [mitogen-activating protein kinase kinase kinase 7 interacting protein 2]) is a potential candidate gene for type 1 diabetes because it is located on chromosome 6q25 and is involved in nuclear factor (NF)-κB regulation. We have conducted familial association studies using 478 families and demonstrate that a type 1 diabetes susceptibility gene resides within a 212-kb region containing the TAB2 gene (Tsp = 1.0 × 10−2 to 4.0 × 10−4). No amino acid polymorphisms were detected in TAB2; however, multiple single nucleotide polymorphisms (SNPs) found within 5′ untranslated, 3′ untranslated, and intron regions were associated with type 1 diabetes susceptibility. Two additional genes, LOC340152, a predicted gene with currently unknown function, and SMT3, which has homology to SUMO (small ubiquitin-related modifier) were found within the 212-kb region and were associated with type 1 diabetes susceptibility. Functional studies of the three genes will be required to determine their biological relevance to type 1 diabetes. However, both TAB2 and SUMO are involved in NF-κB activation and may thus be involved in type 1 diabetes through apoptosis in pancreatic β-cells.

Type 1 diabetes is characterized by selective β-cell destruction, an absolute requirement for exogenous insulin, and a young, albeit heterogeneous, age of onset. The etiology and pathogenetic mechanisms of β-cell destruction are not completely understood, although an autoimmune process is clearly involved. The inheritance of type 1 diabetes is genetically determined, although in a complex manner. In humans, two type 1 diabetes susceptibility genes have been studied in great detail: the HLA region on chromosome 6p21, IDDM1 (13), and the insulin gene region, IDDM2, on chromosome 11p15 (49). IDDM1 and IDDM2 contribute 42 and 10%, respectively, to the familial inheritance of the disease, and it can be further extrapolated that while other type 1 diabetes susceptibility genes exist, none can have the relatively large contribution described for IDDM1 (9,10). At present, many new putative type 1 diabetes susceptibility loci have been proposed as a result of random genome searches: IDDM3 on 15q26, IDDM4 on 11q13, IDDM5 on 6q25, IDDM6 on 18q12-q21, IDDM7 on 2q31-32, IDDM8 on 6q27, as well as additional susceptibility genes on chromosomes 1q42, 2q33-34, 3q21-25, 5q31-33, 6q21, 10p11-q11, 10q25, 14q24.3-q31, 16p11-13, 17q25, and 19q11 (11).

TAB2 (MAP3K7IP2 [mitogen-activating protein kinase kinase kinase 7 interacting protein 2]) is an interesting candidate gene for type 1 diabetes because it is located on chromosome 6q25 in the IDDM5 region and is involved in nuclear factor (NF)-κB regulation (12). NF-κB is central to the overall immune response through its ability to activate genes coding for regulators of apoptosis and cell proliferation (13). TAB2 knockout mice are embryonic lethals in the homozygous state due to liver degeneration and apoptosis, a phenotype similar to that of the NF-κB knockout (14). Decreased production and activation of NF-κB occurs in NOD mice (15), an animal model for human type 1 diabetes, and double-stranded RNA produced by many viruses induces NF-κB–dependent apoptosis in pancreatic β-cells (16). Together, these findings suggest a plausible connection between TAB2, NF-κB activation, and type 1 diabetes susceptibility. Here, we report that multiple single nucleotide polymorphisms (SNPs) located within the TAB2 gene are associated with susceptibility to type 1 diabetes and postulate that these sequence variations may influence TAB2 protein levels and NF-κB activation.

We typed DNA from 478 families, the majority having two affected siblings with type 1 diabetes. The 256 American families were from the Human Biological Data Interchange (Philadelphia, PA), whereas the remaining 222 English families were from the British Diabetes Association’s Warren Repository (London, U.K.). All families were Caucasian, with the proband diagnosed with type 1 diabetes and having an age of onset of ≤18 years. Differences were not detected in the frequencies of DNA polymorphisms in the families from the Human Biological Data Interchange and British Diabetes Association’s Warren Repository, and data were pooled for subsequent data analyses.

Genotyping.

SNP genotyping was done using a three-step primer extension assay (17). First, a defined region was amplified using 30 cycles of PCR consisting of 1 min at 94°C (denaturation), 1 min at 55°C (annealing), and 1 min at 72°C (extension). In the next step, deoxynucleoside triphosphates and primers remaining from the PCR were removed by enzymatic digestion using shrimp alkaline phosphatase and exonuclease I (both from Amersham Pharmacia, Piscataway, NJ). In the final step, a single base extension (SBE) reaction using an oligonucleotide primer that resides directly adjacent to the nucleotide in question was used. The SBE reaction contained the extension primer, all four dideoxy deoxynucleoside triphosphates (Amersham Pharmacia), Taq polymerase (PGC Scientifics, Gaithersburg, MD), and the purified PCR product. The SBE assay was done using 49 cycles of denaturation at 96°C for 30 s, annealing at 55°C for 30 s, and extension at 60°C for 30 s. After the SBE primer was extended with the nucleotide analog, the resulting products were analyzed using ion-pair, reverse-phase high-performance liquid chromatography with the Wave System (Transgenomic, Omaha, NE). Locations of SNPs and flanking sequences can be found in the Human Genome Database (http://www.ncbi.nlm.nih.gov/). PCR and SBE primers are shown in Table 1. Markers 47, 57, and 244 were insertions/deletions of two or three base pairs and were detected on the Wave System by size. All markers tested contained only two alleles. Nucleotide sequence analysis was conducted at our core sequencing facility at Baylor College of Medicine.

Genetic analyses.

Haplotypes were determined by visual inspection of alleles in the parents and offspring, assuming a lack of recombination between the closely linked loci. The transmission disequilibrium test (TDT) was used to access linkage disequilibrium (LD) between common marker alleles and disease (18). The TDT test statistic is a χ2 (1 degree of freedom) statistic that tests deviation of transmission from the expected 50% transmission of an allele from heterozygous parents to offspring. However, in cases where linkage is already known, the analysis of multiple affected children invalidates the χ2 statistic with respect to LD. To address this problem, we analyzed the TDT statistic in the probands only. Markers were also examined in unaffected siblings, but these were randomly distributed, and the data are not shown. Unaffected siblings were used to show that the TDT statistic was not due to a general segregation distortion to all siblings. To determine familial association, we also used the Tsp statistic, which is an extension of TDT that allows for multiple affected children (19). Tsp examines whether a heterozygous parent transmits the same or different marker alleles to each of their affected children (sibpairs) and provides a valid χ2 test for LD in the presence of linkage. Tsp is generally a more powerful statistic than TDT using the proband only (19). The D′ value for LD was also examined (20). Values range from 1 (complete disequilibrium) to 0 (complete equilibrium) to −1 (alleles never found on the same haplotype).

We have taken a candidate gene approach and selected TAB2 because it is located on chromosome 6q25 (IDDM5), which is involved in NF-κB regulation (12). Figure 1 shows a 300-kb segment of genomic DNA containing the physical map of TAB2, which is encoded by seven exons, spanning 94 kb. Two additional gene sequences were identified within this stretch of DNA: LOC340152, a predicted gene with unknown function that is located adjacent to the 3′ end of TAB2, and SMT3, which has homology to SUMO (small ubiquitin-related modifier) (21) and is located within intron 6 of TAB2 (Fig. 1). The nucleotide sequence of the coding regions of each gene (13 exons total) were determined in 12 unrelated type 1 diabetic individuals. In addition, randomly selected regions located within introns and flanking regions were tested for sequence variation using the Wave System. In total, 18 DNA polymorphisms were identified, confirmed by nucleotide sequence analysis, and typed in our families (Table 2). All but three of the DNA polymorphisms (Table 2) were independently found by the Human Genome Project.

The 14 markers between positions 87 and 244 were in strong LD (D′ > 0.92) and were present on eight haplotypes; however, four haplotypes were relatively rare (haplotypes E–H) (Table 3). In contrast, markers at positions 47, 57, 269, and 300 were randomly associated with all markers tested between 87 and 244 (D′ < 0.16). The 87–244 markers thus form a haplotype block, with the outer boundaries of the block currently defined by markers 57 and 269 (a 212-kb stretch of DNA). We used these haplotypes to examine linkage of the TAB2 region with IDDM5. In our affected sibpair families having heterozygous parents, the affected sibpairs shared one and zero haplotypes in 312 and 260 cases, respectively (54.6%, χ2 = 4.7, logarithm of odds = 1.03). Previously, in a study of 767 families (11), a logarithm of odds score of 1.96 was obtained for IDDM5. These results indicate that the TAB2 region defined here and the IDDM5 region previously defined are contributing to the overall diabetes susceptibility in families, even though the linkage is relatively weak.

In contrast, in our familial association studies, 10 of the 18 markers were associated with diabetes susceptibility as determined by both TDT analysis of the probands (TDT, P = 0.05–0.006) (Table 2) and Tsp analysis of multiple affected siblings (Tsp, P = 1.0 × 10−2 to 4.0 × 10−4) (Table 2). Because of LD, many of these associations are not independent, as the markers on haplotypes A and C are positively associated and the markers on haplotype D are negatively associated with type 1 diabetes susceptibility (comparison of Tables 2 and 3). The frequencies of haplotypes E–H are too rare to evaluate the significance of diabetes associations. Normally when typing multiple markers and/or haplotypes, a statistical correction for multiple tests is warranted. However, in this study, strong LD exists within the TAB2 gene (D′ > 0.92), and the majority of the markers and haplotypes were associated with the disease. Thus, P values were not corrected for multiple comparisons in this study because any correction would be very small and not very meaningful.

No SNPs leading to amino acid substitutions were detected in the coding region of the TAB2 gene in 24 alleles that we sequenced or are described in the Human Genome Project (http://www.ncbi.nlm.nih.gov/). We did detect polymorphisms in the TAB2 5′ (244-GGC+1, six copies of the nucleotide triplet versus five copies) and 3′ untranslated regions (152-C) (Table 2). It remains to be determined if the described polymorphisms in the TAB2 5′ and 3′ untranslated regions are involved in mRNA regulation or if other polymorphisms in introns or flanking regions modulate TAB2 gene expression. In addition to TAB2, we identified LOC340152, which is a predicted gene with currently unknown function, and SMT3, which is homologous to SUMO (21) (Fig. 1). Nucleotide sequence analysis of these genes identified one DNA polymorphism in exon 2 of LOC340152 (position 87) and one in the SUMO gene (position 161) (Fig. 1 and Table 2). The SNPs in LOC340152 and SMT3 were associated with diabetes susceptibility (Table 2) and resulted in the predicted amino acid substitutions of Pro to Leu and Met to Val, respectively. Whether these associations are secondary to those in LD with TAB2 or if they are biologically significant will require studies that genetics alone cannot answer.

We report a strong familial association of genetic markers with type 1 diabetes susceptibility within our candidate TAB2 gene on chromosome 6q25 (strongest association, P = 4.0 × 10−4). Diabetes association maps within a 212-kb region. Although, TAB2 was selected as our candidate gene and covers 94 kb of the 212 kb, we have not formally proven that TAB2 is biologically relevant to the pathogenesis of the type 1 diabetes susceptibility. Indeed, a proline-to-leucine amino substitution in LOC340152 and a methionine-to-valine substitution in SUMO were also associated with the diabetes susceptibility. It is possible that more than one type 1 diabetes susceptibility gene lies within this region. Indeed, both TAB2 and SMT3 (SUMO) may be involved in NF-κB activation (12,21). Furthermore, TAB2 is normally membrane bound and migrates to the cytoplasm after cytokine stimulation (12). This process is consistent with a sumoylation step (21), and TAB2 indeed appears to have the requisite sumoylation sequence (12). Therefore, both the TAB2 and SUMO genes may influence NF-κB activation and apoptosis in pancreatic β-cells, either directly by abnormal expression or indirectly through sumoylation with a variant SUMO polymorphism.

FIG. 1.

A 300-kb map of chromosome 6q25 containing the TAB2 gene. The locations of DNA polymorphisms are shown by arrows and are described in Table 2. The marker numbers refer to relative distance in kilobases (kb). Marker 152 is located at position 53835904 of the minus strand (http://www.ncbi.nlm.nih.gov/). SMT3 is encoded by a single exon within intron 6 of TAB2. The small intron located between exons 4 and 5 of LOC240152 and the two small introns located between exons 4 and 6 of TAB2 are not shown.

FIG. 1.

A 300-kb map of chromosome 6q25 containing the TAB2 gene. The locations of DNA polymorphisms are shown by arrows and are described in Table 2. The marker numbers refer to relative distance in kilobases (kb). Marker 152 is located at position 53835904 of the minus strand (http://www.ncbi.nlm.nih.gov/). SMT3 is encoded by a single exon within intron 6 of TAB2. The small intron located between exons 4 and 5 of LOC240152 and the two small introns located between exons 4 and 6 of TAB2 are not shown.

TABLE 1

PCR and SBE primers

MarkerForward PCR primerReverse PCR primerSBE primer
47 GTGGGCCACAACAGCA GTCTTAACCCAATACAGTCACAG size variation 
57 GAAGTATTTCATACTACAAAAATACATAAACG CTGCTAGATACAATGTTCACAGC size variation 
87 GCTCATGTCTGCAGGGGCT CACAGGAGCCCCGAG CATGCTGTGCCCAGC 
116 CACAATGAGAGCCATTCTC GCACTGCTCATCTCCCT GCTTGGGTCACGTGC 
139A GGTACAGATGGGGTGCT CTGTCCCATGTGCCAAG GCCTCAAGCGATCCTC 
139B GGTACAGATGGGGTGCT CTGTCCCATGTGCCAAG GCAGGGTCTTCAGTGC 
148 CTGACTAGGAACTGCATTGTC CTGATCTTCAGGTCAGCC GGATCAGAATTTGATGTTTCA 
152 GACACCAAGCAGATGAAGC GAACGTGTCTCCACTCTGTG GATCTGTACAGTAGGAAAAGCTTT 
161 GCAATATGCTTGTGTACACATAC CACAGAAGAAGTCAAGACTGAG GAACCACGGGGATTGTCA 
163 CACGGGTAAGTGGTAAACTG GTGCTGTTCTAGAAACTACAATCC CTGTTTAGTTACTTAAGTCCATGTTTGAT 
169 GACATACCTAGTTGGTTGACTTG GAGCAAAAGTGTCTCTGCTG GTTGGTTGACTTGTCTAGGTATG 
172 GCAGTGAACAGATGATGAAG CTCCATTGTTCGTGAGCTAAC GTAATTTAAGCATGCAACTCTCTC 
175 CTCACACACAGCTGGTGA CTCACTCAGCACTAGGCAAC CTGCTGAAAAGGTGGAAAAAA 
220A GTCCTTATGCTTGGTAGGCT GCCTGCTACCTAGTTGTTG CTAAGAAACTAATCCCACAGGAGT 
220B GTCCTTATGCTTGGTAGGCT GCCTGCTACCTAGTTGTTG GTGTGCTGCTCTCAAATTATCATAGA 
244 GAGAGCCAGGTTGGGGAT GAGACGGCTGCCCTAGT size variation 
269 CTGAAAGTCACGAAGCCTGG CAGGTACGTATCTTCACTAG size variation 
300 CCTGAGTTGCACATGCAA CACGGTGTACTGACAGCATT GTTGTAGCCTTAGACATCAGTTAGCTAT 
MarkerForward PCR primerReverse PCR primerSBE primer
47 GTGGGCCACAACAGCA GTCTTAACCCAATACAGTCACAG size variation 
57 GAAGTATTTCATACTACAAAAATACATAAACG CTGCTAGATACAATGTTCACAGC size variation 
87 GCTCATGTCTGCAGGGGCT CACAGGAGCCCCGAG CATGCTGTGCCCAGC 
116 CACAATGAGAGCCATTCTC GCACTGCTCATCTCCCT GCTTGGGTCACGTGC 
139A GGTACAGATGGGGTGCT CTGTCCCATGTGCCAAG GCCTCAAGCGATCCTC 
139B GGTACAGATGGGGTGCT CTGTCCCATGTGCCAAG GCAGGGTCTTCAGTGC 
148 CTGACTAGGAACTGCATTGTC CTGATCTTCAGGTCAGCC GGATCAGAATTTGATGTTTCA 
152 GACACCAAGCAGATGAAGC GAACGTGTCTCCACTCTGTG GATCTGTACAGTAGGAAAAGCTTT 
161 GCAATATGCTTGTGTACACATAC CACAGAAGAAGTCAAGACTGAG GAACCACGGGGATTGTCA 
163 CACGGGTAAGTGGTAAACTG GTGCTGTTCTAGAAACTACAATCC CTGTTTAGTTACTTAAGTCCATGTTTGAT 
169 GACATACCTAGTTGGTTGACTTG GAGCAAAAGTGTCTCTGCTG GTTGGTTGACTTGTCTAGGTATG 
172 GCAGTGAACAGATGATGAAG CTCCATTGTTCGTGAGCTAAC GTAATTTAAGCATGCAACTCTCTC 
175 CTCACACACAGCTGGTGA CTCACTCAGCACTAGGCAAC CTGCTGAAAAGGTGGAAAAAA 
220A GTCCTTATGCTTGGTAGGCT GCCTGCTACCTAGTTGTTG CTAAGAAACTAATCCCACAGGAGT 
220B GTCCTTATGCTTGGTAGGCT GCCTGCTACCTAGTTGTTG GTGTGCTGCTCTCAAATTATCATAGA 
244 GAGAGCCAGGTTGGGGAT GAGACGGCTGCCCTAGT size variation 
269 CTGAAAGTCACGAAGCCTGG CAGGTACGTATCTTCACTAG size variation 
300 CCTGAGTTGCACATGCAA CACGGTGTACTGACAGCATT GTTGTAGCCTTAGACATCAGTTAGCTAT 
TABLE 2

Genetic analysis of marker alleles

Location (kb)GeneExon/intronAllele
dbSNPTDT proband
P (Tsp)
SpecificityFrequencyPositive*Negative*%TP
47 —  CA+1 0.14 New 41 49 45.6 NS NS 
57 —  AAA+1 0.13 New 51 55 48.1 NS NS 
87 LOC340152 Exon 2 G/A 0.27 7747948 209 166 55.7 ≤0.03 ≤4.3 × 10−3 
116 —  G/A 0.11 409099 108 82 56.8 ≤0.05 ≤2.9 × 10−3 
139A —  C/G 0.49 237017 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
139B —  C/T 0.10 237018 68 90 45.3 NS NS 
148 —  A/T 0.49 366905 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
152 TAB2 Exon 7 G/C 0.26 7896 200 152 56.8 ≤0.01 ≤1.0 × 10−2 
161 TAB2/SMT3 Intron 6 G/A 0.49 237025 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
163 TAB2 Intron 5 C/T 0.11 237027 108 82 56.8 ≤0.05 ≤2.9 × 10−3 
169 TAB2 Intron 4 G/C 0.10 2789490 68 90 45.3 NS NS 
172 TAB2 Intron 4 A/T 0.49 237034 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
175 TAB2 Intron 4 G/T 0.10 237037 68 90 45.3 NS NS 
220A TAB2 Intron 1 G/C 0.49 6942381 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
220B TAB2 Intron 1 G/A 0.10 494340 68 90 45.3 NS NS 
244 TAB2 Exon 1 GGC+1 0.11 New 108 82 56.8 ≤0.05 ≤2.9 × 10−3 
269 —  TC+1 0.31 2308137 58 56 50.9 NS NS 
300 —  G/A 0.25 6914987 68 90 43.0 NS NS 
Location (kb)GeneExon/intronAllele
dbSNPTDT proband
P (Tsp)
SpecificityFrequencyPositive*Negative*%TP
47 —  CA+1 0.14 New 41 49 45.6 NS NS 
57 —  AAA+1 0.13 New 51 55 48.1 NS NS 
87 LOC340152 Exon 2 G/A 0.27 7747948 209 166 55.7 ≤0.03 ≤4.3 × 10−3 
116 —  G/A 0.11 409099 108 82 56.8 ≤0.05 ≤2.9 × 10−3 
139A —  C/G 0.49 237017 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
139B —  C/T 0.10 237018 68 90 45.3 NS NS 
148 —  A/T 0.49 366905 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
152 TAB2 Exon 7 G/C 0.26 7896 200 152 56.8 ≤0.01 ≤1.0 × 10−2 
161 TAB2/SMT3 Intron 6 G/A 0.49 237025 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
163 TAB2 Intron 5 C/T 0.11 237027 108 82 56.8 ≤0.05 ≤2.9 × 10−3 
169 TAB2 Intron 4 G/C 0.10 2789490 68 90 45.3 NS NS 
172 TAB2 Intron 4 A/T 0.49 237034 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
175 TAB2 Intron 4 G/T 0.10 237037 68 90 45.3 NS NS 
220A TAB2 Intron 1 G/C 0.49 6942381 246 189 56.6 ≤0.006 ≤4.0 × 10−4 
220B TAB2 Intron 1 G/A 0.10 494340 68 90 45.3 NS NS 
244 TAB2 Exon 1 GGC+1 0.11 New 108 82 56.8 ≤0.05 ≤2.9 × 10−3 
269 —  TC+1 0.31 2308137 58 56 50.9 NS NS 
300 —  G/A 0.25 6914987 68 90 43.0 NS NS 
*

Positive and negative indicate the number of alleles transmitted or not, respectively, to the proband. dbSNP, SNPs with locations found in the Human Genome Database. %T, percent transmission of parental alleles to proband.

TABLE 3

Composition of IDDM5 haplotypes

Haplotype
Marker alleles*
Diabetes association
IDFrequency87116139A139B148152161163169172175220A220B244
0.24 (GGC)5 Positive 
0.10 (GGC)5 Neutral 
0.11 (GGC)6 Positive 
0.48 (GGC)5 Negative 
0.03 (GGC)5 
0.02 (GGC)5 
0.01 (GGC)5 
0.01 (GGC)5 
Haplotype
Marker alleles*
Diabetes association
IDFrequency87116139A139B148152161163169172175220A220B244
0.24 (GGC)5 Positive 
0.10 (GGC)5 Neutral 
0.11 (GGC)6 Positive 
0.48 (GGC)5 Negative 
0.03 (GGC)5 
0.02 (GGC)5 
0.01 (GGC)5 
0.01 (GGC)5 
*

All marker alleles shown are SNPs except 244, which are triplet repeats.

This work was supported in part by grants from the Juvenile Diabetes Foundation and the Harry B. and Aileen B. Gordon Foundation.

We thank Dr. Stan Lilleberg of Transgenomic for assistance in setting up the SBE assay.

1.
Platz P, Jakobsen BK, Morling N, Ryder LP, Sveygaard A, Thomsen M, Cristy M, Kromann H: HLA-D and HLA-DR antigens in genetic analysis of insulin-dependent diabetes mellitus.
Diabetologia
21
:
1108
–1115,
1981
2.
Wolf E, Spencer KM, Cudworth AG: The genetic susceptibility to type I (insulin-dependent) diabetes: analysis of the HLA-DR association.
Diabetologia
24
:
224
–230,
1983
3.
Walker A, Cudworth AG: Type I (insulin-dependent) diabetic multiplex families: mode of genetic transmission.
Diabetes
29
:
1036
–1039,
1980
4.
Bell GI, Horita S, Karam JH: A polymorphic locus near the human insulin gene is associated with insulin-dependent diabetes mellitus.
Diabetes
33
:
176
–183,
1984
5.
Hitman GA, Tarn AC, Winter RM, Drummond V, Williams LC, Jowett NI, Bottazzo GF, Galton DJ: Type I (insulin-dependent) diabetes and a highly variable locus close to the insulin gene on chromosome 11.
Diabetologia
28
:
218
–222,
1985
6.
Julier C, Hyer RN, Davies J, Merlin F, Soularue P, Briant L, Cathelineau G, Deschamps I, Rotter JI, Froguel P, Boitard C, Bell JI, Lathrop GM: Insulin-IGF2 region on chromosome 11p encodes a gene implicated in HLA-DR4-dependent diabetes susceptibility.
Nature
354
:
155
–159,
1991
7.
Bain SC, Prins JB, Hearne CM, Rodriques NR, Rowe BR, Pritchard LE, Ritchie RJ, Hall JRS, Undlien DE, Ronningen KS, Dunger DB, Barnett AH, Todd JA: Insulin gene region-encoded susceptibility to type I diabetes is not restricted to HLA-DR4 positive individuals.
Nat Genet
2
:
212
–215,
1992
8.
Owerbach D, Gabbay KH: Linkage of the VNTR/insulin-gene and type I diabetes mellitus: increased gene sharing in affected sibling pairs.
Am J Hum Genet
54
:
909
–912,
1994
9.
Davies JL, Kawaguchi Y, Bennett ST, Copeman JB, Cordell HJ, Pritchard LE, Reed PW, Gough SCL, Jenkins SC, Palmer SM, Balfour KM, Rowe BR, Farrall M, Barnett AH, Bain SC, Todd JA: A genome-wide search for human type 1 diabetes susceptibility genes.
Nature
371
:
130
–136,
1994
10.
Hashimoto L, Habita C, Beressi JP, Delepine M, Besse C, Cambon-Thomsen A, Deschamps I, Rotter JI, Djoulah S, James MR, Froguel P, Weissenbach J, Lathrop GM, Julier C: Genetic mapping of a susceptibility locus for insulin-dependent diabetes mellitus on chromosome 11q.
Nature
371
:
161
–164,
1994
11.
Cox NJ, Wapelhorst B, Morrison VA, Johnson L, Pinchuk L, Spielman RS, Todd JA, Concannon P: Seven regions of the genome show evidence of linkage to type I diabetes in consensus analysis of 767 multiplex families.
Am J Hum Genet
69
:
820
–830,
2001
12.
Takaesu G, Kishida S, Hiyama A, Yamaguchi K, Shibuya KJ, Ninomiya-Tsuji J, Matsumoto K: TAB2, a novel adaptor protein, mediates activation of TAK1 MAPKKKK by linking TAK1 to TRAF6 in IL-1 signal transduction pathway.
Mol Cell
5
:
649
–658,
2000
13.
Ghosh S, Karin M: Missing pieces in the NF-kappaB puzzle.
Cell
109
:
S81
–S96,
2002
29
14.
Sanjor H, Takeda K, Tsujimura T, Ninomiya-Tsuji J, Matsumoto K, Akira S: TAB2 is essential for prevention of apoptosis in fetal liver but not for interleukin-1 signaling.
Mol Cell Biol
23
:
1231
–1238,
2003
15.
Hayashi T, Faustman D: NOD mice are defective in proteasome production and activation of NF-kappaB.
Mol Cell Biol
12
:
8646
–8659,
1999
16.
Liu D, Cadozo AK, Darville MI, Eizirik DL: Double-stranded RNA cooperates with interferon-gamma and IL-1beta to induce both chemokine expression and nuclear factor-kappaB-dependent apoptosis in pancreatic beta-cells: potential mechanisms for viral-induced insulitis and β-cell death in type I diabetes mellitus.
Endocrinology
143
:
1225
–1234,
2002
17.
Devaney JM, Pettit EL, Daler SG, Vallone PM, Butler JM, Marino MA: Genotyping of two mutations in the HFE gene using single-base-extension and high-performance liquid chromatography.
Anal Chem
73
:
620
–624,
2001
18.
Spielman RS, McGinnis RE, Ewens WJ: Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM).
Am J Hum Genet
52
:
506
–516,
1993
19.
Martin ER, Kaplan NL, Weir BS: Tests for linkage and association in nuclear families.
Am J Hum Genet
61
:
439
–448,
1997
20.
Devlin B, Risch N: A comparison of linkage disequilibrium measures for fine-scale mapping.
Genomics
29
:
311
–322,
1996
21.
Muller S, Hoege C, Pyrowolakis G, Jentsch S: SUMO, ubiquitin’s mysterious cousin.
Nature
2
:
202
–208,
2001