To investigate pyruvate dehydrogenase (PDH)-E1α subunit phosphorylation and whether free fatty acids (FFAs) regulate PDH activity, seven subjects completed two trials: saline (control) and intralipid/heparin (intralipid). Each infusion trial consisted of a 4-h rest followed by a 3-h two-legged knee extensor exercise at moderate intensity. During the 4-h resting period, activity of PDH in the active form (PDHa) did not change in either trial, yet phosphorylation of PDH-E1α site 1 (PDH-P1) and site 2 (PDH-P2) was elevated in the intralipid compared with the control trial. PDHa activity increased during exercise similarly in the two trials. After 3 h of exercise, PDHa activity remained elevated in the intralipid trial but returned to resting levels in the control trial. Accordingly, in both trials PDH-P1 and PDH-P2 decreased during exercise, and the decrease was more marked during intralipid infusion. Phosphorylation had returned to resting levels at 3 h of exercise only in the control trial. Thus, an inverse association between PDH-E1α phosphorylation and PDHa activity exists. Short-term elevation in plasma FFA at rest increases PDH-E1α phosphorylation, but exercise overrules this effect of FFA on PDH-E1α phosphorylation leading to even greater dephosphorylation during exercise with intralipid infusion than with saline.

Pyruvate dehydogenase (PDH) complex (PDC) catalyzes the irreversible conversion of pyruvate to acetyl CoA, and dysregulation of the PDC in skeletal muscle has been suggested to be implicated in type 2 diabetes (14). Fasting has been shown to reduce the activity of PDH in the active form (PDHa) in rat skeletal muscle (5,6), as has a high-fat diet in human muscle (7). While several studies have demonstrated an exercise-induced increase in PDHa activity during the initial 2 h of exercise (8,9), a subsequent decrease in PDHa activity during exercise exceeding 2 h has been demonstrated more recently (10,11).

The PDC complex is a multienzyme complex composed of several copies of three catalytic proteins (E1, E2, and E3): one structural (E3-binding protein) and two regulatory proteins (PDH kinase [PDK] and PDH phosphatase [PDP]). The E1 subunit, also named PDH, is a tetramer of 2α and 2β subunits, which catalyze the decarboxylation of pyruvate (12). The activity of the PDC complex is mainly regulated by phosphorylation-dehosphorylation of three specific serine residues on the E1α subunit (13,14). Phosphorylation of sites 1 and 2 determines the activity of the complex in skeletal muscle (6). Phosphorylation by one of four PDK isoforms inactivates the complex, while removal of the phosphate by one of two PDP isoforms activates the complex (5,6,12,15,16).

The activity of the PDP1 isoform is sensitive to Ca2+, while the PDK isoforms are regulated by the reduction and acetylation status of the E2 subunit and by pyruvate (5,6,12,15,16). Particular focus has been on PDK4, which shows marked changes at the transcriptional and/or protein levels in human skeletal muscle with fasting, high-fat diet, and acute exercise (7,17,18). Although the increased PDK4 transcription, when insulin and muscle glycogen are low and plasma free fatty acid (FFA) levels are high, provides evidence that factors associated with substrate availability exert an isoform-specific regulation of PDKs, it is difficult to separate the various possibilities in these previous studies (7,1820).

Regulation of PDHa activity in human skeletal muscle through changes in phosphorylation has until now been evaluated from measurements of PDHa activity (9) and PDK activity (7) in vitro. Understanding the phosphorylation state of sites 1 and 2 in the PDH-E1α subunit would, however, provide a more direct measure of the sum of the combined effects of the PDK and PDP activities in regulating PDHa activity at any given moment in vivo and enable the investigation of the role of specific phosphorylation sites for PDHa activity.

The aim of the present study was to establish a direct measure of the phosphorylation state of the PDH-E1α subunit and to test the hypothesis that an elevated plasma FFA concentration is an initial signal leading to phosphorylation and downregulation of PDHa activity in skeletal muscle of healthy humans, reflecting a mechanism for sparing carbohydrates.

Seven healthy ([means ± SE] age 25.4 ± 1.3 years, height 181 ± 2 cm, and weight 74 ± 3 kg) normally physically active subjects participated in the present study. The subjects were given both written and oral information about the experimental protocol and procedures and were informed about any discomfort that might be associated with the experiment before they gave their written consent. The study was performed according to the Declaration of Helsinki and approved by the Copenhagen and Frederiksberg Ethics Committee, Denmark.

The day before each experimental trial, the subjects refrained from exercise and consumed a prepackaged dinner and evening snack, which was standardized based on the body weight of the subject (60 and 12 kJ/kg body wt, respectively). On the experimental day, the subjects arrived to the laboratory 2 h after consuming a standardized breakfast consisting of two slices of rye bread, butter, jelly, and water.

Each subject completed two identical trials in random order separated by ∼3 weeks with either intralipid/heparin or saline being infused in an antecubital vein. An arterial line was used for blood sampling. While the subjects remained resting in the supine position for 4 h followed by 3 h of two-legged knee extensor exercise at ∼50% of Wmax (52 ± 12 Watts [mean ± SE]), a 20% intralipid emulsion (0.8 ml · kg body wt−1 · h−1; Fresinius Kabi, Uppsala, Sweden) and sodium heparin (24 units · kg body wt−1 · h−1, prime 3 units/kg body wt) were infused in one trial (intralipid) and saline in the other (control).

Blood samples were taken before infusion and at 60, 90, 120, 180, 210, and 240 min of rest during infusion and every 30 min during 3 h of exercise. Muscle biopsies were obtained from the vastus lateralis muscle using the percutaneous needle biopsy technique (21) with suction before infusion started, at 4 h of rest and after 45, 90, 135, and 180 min of exercise. Biopsies were taken from separate incisions using either leg and were rapidly frozen in liquid nitrogen.

Blood parameters.

Plasma FFA concentrations were determined using a Wako FA kit (Wako Chemical, Neuss, Germany) and an automatic spectrophotometer (Cobas FARA 2; Roche Diagnostic, Basel, Switzerland). Plasma insulin concentrations were determined using an insulin enzyme-linked immunosorbent assay kit (DakoCytomation, Glostrup, Denmark).

Muscle glycogen.

Muscle specimens were freeze dried and dissected free of blood, fat, and connective tissue under the microscope, and muscle glycogen content was determined as glycosyl units after acid hydrolysis using an automatic spectrophotometer (Cobas FARA 2; Roche Diagnostic) as previously described (22).

RNA isolation, reverse transcription, and cDNA content.

Total RNA was isolated from ∼20 mg of muscle tissue by a modified guanidinium thiocyanate–phenol-chloroform extraction method adapted from Chomczynski and Sacchi (23) as previously described (17). Reverse transcription was performed using the Superscript II RNase H system (Invitrogen, Carlsbad, CA) and Oligo dT as previously described (17). The amount of single-stranded DNA was determined in each reverse transcription sample using OliGreen reagent (Molecular Probes, Leiden, the Netherlands) as recently described (24).

Real-time PCR.

The mRNA content of a given gene was determined by PCR using the fluorogenic 5′ nuclease assay with TaqMan probes (ABI PRISM 7900 Sequence Detection System; Applied Biosystems, Foster City, CA) as previously described (24) using the primer and probe sequences given in Table 1. The obtained critical threshold values reflecting the initial content of the specific transcript in the samples were converted to an arbitrary amount by using a standard curve obtained from a serial dilution of a representative pooled sample. For each sample, the amount of a given target cDNA was normalized to the total cDNA content in the sample.

PDH antibodies.

Three polyclonal anti-PDH antibodies were made in sheep. One recognizing PDH independent of phosphorylation was made using a peptide corresponding to the COOH-terminal (296-309) part of the human PDH-E1α subunit (DPGVSYRTREEIQE). One recognizing PDH when phosphorylated on Ser293 (site 1) was made using a phospho-peptide corresponding to amino acid 287–299 in the COOH-terminal part of the human PDH-E1α subunit (YRYHGH(pS)MSDPGV). One recognizing PDH when phosphorylated on Ser300 (site 2) was made using a phospho-peptide corresponding to amino acid 294-306 in the COOH-terminal part of the human PDH-E1α subunit [MSDPGV(pS)YRTREE]. All peptides were synthesized with an additional cysteine at the NH2-terminus, coupled to keyhole limpet hemocyanin and used to immunize sheep as previously described (25). Sera for the phosphospecific antibodies were first passed through columns containing immobilized dephosphopeptides, and the antibodies specific for the phosphorylation state were then bound to columns containing immobilized peptides of the same phosphorylation state as the antigen used for immunization and eluted as previously described (25). Using these antibodies, PDH-E1α subunit protein expression, as well as phosphorylation of PDH-E1α subunit on sites 1 and 2, were measured in different muscle preparations by SDS-PAGE (Tris-HCl 10% gel; BioRad, Copenhagen, Denmark) and Western blotting using polyvinylidene fluoride membrane and semidry transfer. After blocking (Tris-buffered saline with Tween 20 plus 2% skim milk), the membranes were incubated with the primary antibody (in Tris-buffered saline with Tween 20 plus 2% skim milk), followed by incubation with horseradish peroxidase–conjugated secondary antibody (in Tris-buffered saline with Tween 20 plus 2% skim milk). ECL-plus (Amersham, Birkerod, Denmark) was used as detection system.

Characterization of the PDH-E1α subunit antibodies.

Using a Kodak Image Station 440CF, one specific band at 40 kDa was detectable with all three antibodies, corresponding to the expected mass of the PDH-E1α subunit. When rat muscle was fractionated into mitochondrial and remnant fractions, the protein was exclusively found in the mitochondrial fraction (Fig. 1A). It was confirmed that no signal was lost to the pellet (17,500 g) when human muscle lysates were prepared from muscle homogenates made in a detergent containing buffer (Fig. 1B). The specificity of the antibodies was evaluated by peptide competition assays (Fig. 1C). Thus, the signal obtained in human muscle lysate, using the two phosphospecificspecific antibodies, was totally blocked by the corresponding phosphospecific peptide used for immunization but not by the corresponding dephosphopeptide or by the phospho/dephosphospecific peptides used for immunization/purification in the production of the other phosphospecific antibody. Similarly, the signal obtained with the nonphosphospecific antibody was blocked by the peptide used for immunization but not by the two phosphospecific peptides.

The two phosphospecific antibodies against PDH-E1α sites 1 and 2 were tested for phosphospecificity by phosphatase treatment of human lysates. A human muscle sample was cut in minute pieces and divided into two pools. Then, lysates were prepared as previously described (26) in a homogenisation buffer with or without phosphatase inhibitors (Na-pyrophosphate, β-glycerophosphate, NaF, and Na3VO4). Equal amounts of protein from the two lysates were then incubated in 10 mmol/l HEPES (pH 7.2), 5 mmol/l MgCl2, 1 mmol/l EGTA, and 5 mmol/l MnCl2 with or without 2 units/μg λ-phosphatase (New England Biolabs, Hertfordshire, U.K.) at 30°C for 2 h. The reaction was stopped by adding sample buffer, after which the samples were subjected to normal SDS-PAGE and Western blot analysis. The signal from the antibody against total PDH-E1α was not affected by the treatment, whereas the bands from the two phosphospecific antibodies were completely abrogated by the λ-phosphatase treatment (Fig. 1D).

Mitochondria preparation.

Mixed gastrocnemius muscle from Wistar rats (250g) were minced (4°C, 100 mmol/l KCl, 40 mmol/l Tris-HCl, 10 mmol/l Tris-base, 5 mmol/l MgSO4, 5 mmol/l NaF, 1 mmol/l Na3VO4, 1 mmol/l Na4P2O7, 5 mmol/l EDTA, 5 mmol/l EGTA, and 3 mmol/l Benzamidine, pH 7.5) and left to rotate end over end for 15 min. The suspension was homogenized with a Polytron (PT3100; Kinematica, Lucerne, Switzerland) before being centrifuged (750g for 10 min). The top layer of debris was removed. The homogenate was centrifuged again (15,000g for 10 min) to collect the mitochondria. A sample of the supernatant was taken as a cytosolic control (the remnant). The mitochondria rich pellet was resuspended in Tris-EDTA buffer (10 mmol/l Tris-HCl, 1 mmol/l EDTA) with protease inhibitor cocktail, pH 7.5. All samples were frozen in liquid nitrogen and stored at −80°C.

Human muscle homogenate/lysate.

Muscle specimens were freeze dried and dissected free of blood, fat, and connective tissue under microscope and were homogenized (26). The supernatant (17,500g for 60 min, 4°C) was harvested, frozen in liquid nitrogen, and stored at −80°C. In a subset of samples, the homogenate, lysate, and pellet were saved for later analyses. Total protein content in the samples was determined using the bicinchoninic acid method (Pierce).

PDHa activity.

The activity of PDHa was determined in vitro as previously described (9,27,28) after homogenizing 8–15 mg of muscle tissue on ice for 50 s using a micro glass homogenizer (Kontes) and quick freezing the samples (<15 s) in liquid nitrogen.

Statistics.

Two-way ANOVA for repeated measures was applied to evaluate the effect of time and treatment using Student-Newman-Keuls’s post hoc test to locate differences. A one-way ANOVA for repeated measures was also applied to evaluate the effect of time separately for each trial. Differences were considered significant at P < 0.05, and a tendency is reported when 0.05 ≤ P < 0.1. The statistical analyses on mRNA data were conducted on logarithmic transformed ratios (target/cDNA content) to ensure a normal distribution. For presentation in figures, the mRNA data are given as fold changes relative to the preinfusion value in each trial, which was set to 1. Values presented are means ± SE.

FFAs.

In the control trial, the arterial concentration of plasma FFA remained similar to the prelevel (∼500 μmol/l) throughout the 4-h resting period and increased (P < 0.05) during exercise to ∼1,500 μmol/l at the end of exercise. At rest, intralipid infusion elevated (P < 0.05) the arterial plasma FFA concentration to ∼1,700 μmol/l. This increased further during exercise reaching 3,000 μmol/l after 3 h (Fig. 2).

Before infusion, arterial plasma triacylglyceride levels were ∼1,250 mmol/l and remained at ∼1,100 mmol/l in the control trial. Intralipid infusion resulted in plasma triacylglyceride levels between 1,700 and 2,000 mmol/l throughout the experiment, reflecting an efficient breakdown of the triacylglyceride provided in the intralipid emulsion.

Insulin.

To avoid effects of prolonged fasting, a light breakfast was provided to the subjects 2.5 h before the experiment was initiated, resulting in slight elevated plasma insulin levels at the beginning of infusion (27–40 pmol/l). The arterial plasma insulin concentration tended to decrease (P < 0.1) over the 4-h resting period in the control but with no change in the intralipid trial. The plasma insulin concentration decreased (P < 0.05) in the control trial relative to the preinfusion level to 15 pmol/l at 2 h of exercise, but this was not significant when related to 4 h rest. Intralipid infusion was, on the other hand, associated with lowered (P < 0.05) plasma insulin concentration relative to 4 h rest already at 1 h of exercise (10.9 pmol/l).

Muscle glycogen.

From similar muscle glycogen levels before infusion (588 ± 45 and 515 ± 37 mmol/kg dry wt in the control and intralipid trials, respectively), no changes were observed in muscle glycogen content over the 4-h resting period in either of the trials and no difference was present between the trials. Exercise induced in both trials a marked decrease (P < 0.05) in muscle glycogen concentration to 273 ± 38 and 160 ± 33 mmol/kg dry wt at the end of exercise in the control and intralipid trials, respectively. The rate of glycogen usage was more pronounced in both trials (P < 0.05) during the initial 45 min of exercise (control: 3.8 ± 0.7 and intralipid: 2.8 ± 0.5 mmol · min−1 · kg−1 dry wt) than the remaining part of exercise (control: 0.9 ± 0.4 and intralipid: 1.4 ± 0.2 mmol · min−1 · kg−1 dry wt). No significant differences were evident between trials, neither within specific time intervals nor over the total exercise period.

PDHa activity.

No significant changes occurred in PDHa activity during the 4-h resting period in either trial. Exercise elevated the PDHa activity to 3.6- and 2.8-fold higher (P < 0.05) at 45–90 min of exercise than at 4 h rest in the control and intralipid trials, respectively. By the end of exercise, the PDHa activity had returned to the initial resting levels in the control trial but remained (2.6-fold, P < 0.05) elevated in the intralipid trial. Likely due to the multiple sampling, there was no significant overall difference in PDHa activity between the intralipid and control trials when analyzed using ANOVA (Fig. 3A). However, statistical evaluation of the data obtained at 3 h of exercise alone (paired t test) revealed a tendency for a difference between trials (P < 0.1).

PDH-E1α protein and phosphorylation state.

Total PDH-E1α protein content was unchanged over the 4-h resting period and over the 3-h exercise period in both trials, and no difference was observed between trials (data not shown). Phosphorylation of the PDH-E1α subunit at site 1 (PDH-P1; P < 0.05) and at site 2 (PDH-P2; P < 0.1) was higher at rest with the intralipid infusion. During exercise, PDH-P1 and PDH-P2 decreased (P < 0.05) and the level reached was significantly lower in the control than in the intralipid trial. In accordance with the PDHa activity, the phosphorylation level was either not different (control trial) or still lowered (intralipid trial) at the end of exercise compared with 4 h rest (Fig. 3B–D).

Phosphorylation of both PDH-P1 and PDH-P2 was highly negatively associated with PDHa activity (Fig. 4A and B). The correlation coefficient (r2) obtained using a linear model was 0.34 and 0.40 for sites 1 and 2, respectively. However, visual inspection of the data (Fig. 4A and B) may suggest that a nonlinear relationship is present. In line, somewhat stronger correlations are evident if data are analyzed using an exponential model (r2 = 0.43 and 0.46, for sites 1 and 2, respectively). The r2 values predict that only ∼40% of the variation in PDHa activity can be explained by the changes in phosphorylation on one site indicating additional regulatory factors. In fact, a clear discrepancy between activity and phosphorylation is apparent at 4 h rest where activity was similar, but phosphorylation on both sites was different between the trials. It should be noticed, however, that the curve linear relationship at low PDHa activities is not solely due to data obtained at 4 h rest. A striking positive linear association (r2 = 0.89) was also evident between the site 1 and the site 2 phosphorylation (Fig. 4C), indicating a similar and coupled regulation of both sites.

PDK and PDP mRNA content.

While PDK4 mRNA tended to increase (P < 0.1, 4.5-fold) over the 4-h resting period in the control trial, intralipid infusion resulted in a significant increase (6.5-fold) relative to before infusion. From this elevated level of PDK4 mRNA at 4 h rest, exercise induced a significant increase (five- to sixfold relative to 4 h rest) only in control (Fig. 5A). PDP1 mRNA tended to be lower (P < 0.1, 43%) at 4 h rest in the intralipid trial than before infusion. During exercise, PDP1 mRNA only decreased significantly (55%) in the control trial relative to 4 h rest. No differences were present between the two trials (Fig. 5B). No significant changes were apparent in PDK1, PDK2, PDK3, or PDP2 mRNA at rest or during exercise, and no differences were observed between trials.

The main findings of the present study are that exercise induces a decrease in phosphorylation of both site 1 and site 2 in the PDH-E1α catalytic subunit of the PDH complex in human skeletal muscle. This dephosphorylation is more pronounced when exercise is accompanied by high FFAs. Intralipid infusion also postpones or prevents the normal decrease in PDHa activity at the later stages of prolonged exercise. The phosphorylation state of PDH-E1α is inversely related to the PDHa activity during exercise. Interestingly, however, at rest, intralipid infusion for 4 h promotes PDH-E1α phosphorylation without a corresponding decreased PDHa activity.

We hypothesized that elevated plasma FFAs initiate a signal to spare carbohydrates by downregulating PDHa activity. However, in contrast to the changes in PDHa activity induced by a high-fat diet (5,6,9,29), intralipid infusion for 4 h was not associated with decreased PDHa activity in resting muscle. Interestingly, PDH-E1α phosphorylation was markedly elevated in the intralipid trial, and it could be speculated that more prolonged elevations in plasma FFA, by intralipid infusion, may lead to changes in PDHa activity similar to those seen by diet manipulations. FFAs have been suggested to play a role in the apparent dysregulation of PDH in a rodent model of type 2 diabetes (1), and intralipid infusion leads to muscle insulin resistance and impairs PDHa activation by insulin in human skeletal muscle (30). Thus, it may be speculated that type 2 diabetes is associated with elevated phosphorylation of PDH-E1α at rest and that such phosphorylation reduces the PDHa activation upon insulin stimulation.

The present study also demonstrates that intralipid infusion results in a sustained elevation rather than a decrease in the PDHa activity during prolonged exercise, suggesting that elevated plasma FFA does not elicit a signal to induce glucose sparing in skeletal muscle. In accordance with the exercise-induced changes and effect of intralipid infusion on PDHa activity, exercise elicited a pronounced drop in phosphorylation state of both PDH-1Eα sites 1 and 2 and intralipid infusion associated with more marked changes than in the control trial. Moreover, phosphorylation had returned to resting levels in the control at the end of exercise but remained reduced at both sites in the intralipid trial, relative to both preinfusion and preexercise levels. Although the decline in PDHa activity during later stages of prolonged exercise under normal conditions cannot be explained by changes in acute regulatory molecules like pyruvate and acetyl CoA (10), an increased PDK activity has been reported (31). Together, this may suggest that the sustained elevation in PDHa activity with intralipid infusion may be caused by an FFA-induced inhibition of PDK activity.

The elevated phosphorylation of PDH-E1α at rest during intralipid infusion did not compromise the regulation of PDHa activity during exercise, suggesting that regulatory mechanisms activated during exercise overrule the regulation exerted by elevated FFAs at rest. A generalization of these results obtained from healthy subjects to metabolic diseases may be difficult. However, to the extent that intralipid infusion can mimic a patophysiological state with elevated circulating FFA levels, the present results suggest that exercise may overcome a dysregulation of PDH activity at rest in type 2 diabetes. This could potentially explain the observation that lipid and glucose metabolism is normal during exercise in muscles of patients with type 2 diabetes.

The present study provides for the first time a direct measure of the phosphorylation state of PDH-E1α sites 1 and 2, which are thought to be the important phosphorylation sites for PDHa activity in skeletal muscle. Previous estimation of PDH phosphorylation has been based on the assumption that the in vitro activity assay measuring activity of PDH in the active form reflected the phosphorylation state and not other covalent modifications. By establishing these tools, we have taken one step toward elucidating the role of specific phosphorylation sites for PDHa activity and eventually to the regulatory role of upstream kinases/phosphatases. The necessity of differentiating PDH phosphorylation estimated from PDHa activity and that of a direct measurement of PDH-E1α site 1 and 2 phosphorylation is seen from the present results. Thus, after 4 h rest, a marked difference in PDH-E1α site 1 and 2 phosphorylation is evident between the control and intralipid trials, but this is not reflected in similar changes in PDHa activity. These findings may suggest that PDH, under some conditions, is subject to other covalent modifications, which are powerful enough to overrule at least to some extent the influence, which PDH-E1α site 1 and 2 phosphorylation exerts on PDHa activity. Similar conclusions may be drawn from the nonlinear relationship between either PDH-E1α site 1 or 2 phosphorylation and PDHa activity. However, it should be noted that phosphorylation of either one of the two sites is sufficient to render the PDC complex inactive (32). It might therefore be speculated that as the degree of phosphorylation of one site increases, the probability that the protein will already be phosphorylated at the other site will increase, causing the nonlinear relationship. In that aspect, it is interesting that changes in the phosphorylation of sites 1 and 2 were very similar in response to both exercise and intralipid infusion, and the phosphorylation state of sites 1 and 2 was highly correlated (r2 = 0.89), which is in agreement with the findings that dephosphorylation of the sites occurs in a random order (33).

In agreement with fasting- and high-fat diet–induced upregulation of PDK4 transcription, mRNA and/or protein content in both rodent and human skeletal muscle (7,18,20,34), resting in the fasted state for 4 h resulted in a small elevation in PDK4 mRNA in the control trial and a more clear increase in PDK4 mRNA content, when the circulating FFA concentration was elevated by intralipid infusion. A recent study (35) reported no effect of intralipid infusion on PDK4 mRNA in resting skeletal muscle, but it may be noted that a nonsignificant change in PDK4 mRNA seemed apparent in that study. Taken together, FFAs do appear to have a regulatory effect on the PDK4 gene expression in resting human skeletal muscle.

The present results also demonstrate that although the plasma FFA concentration at rest in the intralipid trial was at a level similar to that observed during exercise in the control trial, the PDK4 mRNA content was far less than the level observed during exercise. This shows that FFAs cannot be the sole regulator of PDK4 gene expression in human skeletal muscle. This is in accordance with previous studies (12,19,36) suggesting that other factors are also potentially important in regulating PDK4 gene expression. Insulin infusion has been shown to reduce PDK4 mRNA expression in both rat (36) and human (4) skeletal muscle. Decreased plasma insulin concentration is therefore also a possible factor eliciting the increases in PDK4 transcription in human skeletal muscle during fasting and prolonged exercise. Thus, the different plasma FFA and plasma insulin levels may jointly have contributed to the difference in PDK4 mRNA expression in the intralipid and control trial in the present study. However, except for a possible role of FFAs at rest, no simple explanation is apparent during exercise.

The observed changes in PDK4 mRNA are in agreement with previous studies in humans (20,37) and rats (36) and reflect the distinct gene regulation of the PDK isoforms. We recently have shown that PDP1 mRNA is downregulated in human skeletal muscle in recovery from a 75-min exercise bout (20), and the present results reveal that the PDP1 mRNA content can already be reduced during prolonged exercise, while PDP2 mRNA is unaffected. Together, these findings underline the isoform-specific nature of the regulation of PDKs and PDPs in human skeletal muscle. Because the PDK and PDP isoforms not only have a unique tissue distribution but also isoform-specific sensitivity to activators and inhibitors (38,39), isoform-specific regulation of PDK and PDP expression may have an important impact on PDH-E1α phosphorylation and PDH activity and may be targets in dysregulation of PDH in type 2 diabetes, as previously indicated (1).

In conclusion, exercise is associated with decreased phosphorylation of PDH-E1α at both site 1 and 2 in human skeletal muscle, and intralipid infusion modifies this response with even lower phosphorylation of both sites. These changes in PDH-E1α phosphorylation are associated with corresponding changes in PDHa activity, including a more sustained elevation in the PDHa activity during the later stages of exercise with intralipid. The present findings reveal an inverse association between PDH-E1α phosphorylation and PDHa activity in human skeletal muscle. However, short-term elevation in plasma FFAs does not change PDHa activity, although phosphorylation of PDH-E1α is increased.

FIG. 1.

A: Eight milligrams of rat skeletal muscle homogenate, mitochondria, or cytosolic fraction (remnant; homogenate minus mitochondria) were separated by SDS-PAGE, and dephosphorylated and phosphorylated PDH-E1α were detected by Western blotting using the antibodies described in research design and methods. Because the loading was based on micrograms protein in each fraction, the band intensity is not directly comparable. It can be calculated that the loaded amount of mitochondria originates from 10 times the amount of homogenate loaded. B: Human skeletal muscle homogenate, lysate, and pellet were separated by SDS-PAGE, and dephosphorylated PDH-E1α was detected by Western blotting using the antibody described in research design and methods. The loaded amount of samples originates from a comparable amount of tissue. The numbers 1 and 2 refer to two different preparations. C: Four micrograms of human skeletal muscle lysate protein were separated by SDS-PAGE, and dephosphorylated and phosphorylated PDH-E1α was detected by Western blotting using the antibodies described in research design and methods. The antibody solutions (1 μg/ml) were pretreated for 30 min with 10 μg/ml of the peptide described at the top of the figure or without any peptide (−peptide). ND, not determined. D. Three micrograms of human muscle lysate prepared in the presences or absences of phosphatase inhibitors and/or λ-phosphatase were separated by SDS-PAGE, and dephosphorylated and phosphorylated PDH-E1α was detected by Western blotting using the antibodies described in research design and methods. λP, λ-phosphatase; PI, phosphatase inhibitors. MW mrk, molecular weight markers.

FIG. 1.

A: Eight milligrams of rat skeletal muscle homogenate, mitochondria, or cytosolic fraction (remnant; homogenate minus mitochondria) were separated by SDS-PAGE, and dephosphorylated and phosphorylated PDH-E1α were detected by Western blotting using the antibodies described in research design and methods. Because the loading was based on micrograms protein in each fraction, the band intensity is not directly comparable. It can be calculated that the loaded amount of mitochondria originates from 10 times the amount of homogenate loaded. B: Human skeletal muscle homogenate, lysate, and pellet were separated by SDS-PAGE, and dephosphorylated PDH-E1α was detected by Western blotting using the antibody described in research design and methods. The loaded amount of samples originates from a comparable amount of tissue. The numbers 1 and 2 refer to two different preparations. C: Four micrograms of human skeletal muscle lysate protein were separated by SDS-PAGE, and dephosphorylated and phosphorylated PDH-E1α was detected by Western blotting using the antibodies described in research design and methods. The antibody solutions (1 μg/ml) were pretreated for 30 min with 10 μg/ml of the peptide described at the top of the figure or without any peptide (−peptide). ND, not determined. D. Three micrograms of human muscle lysate prepared in the presences or absences of phosphatase inhibitors and/or λ-phosphatase were separated by SDS-PAGE, and dephosphorylated and phosphorylated PDH-E1α was detected by Western blotting using the antibodies described in research design and methods. λP, λ-phosphatase; PI, phosphatase inhibitors. MW mrk, molecular weight markers.

FIG. 2.

Arterial plasma FFA concentration during 4 h rest followed by 3 h two-legged knee extensor exercise with either saline infusion (control) (•) or intralipid/heparin infusion (intralipid) (○). Blood samples were obtained before infusion and at 1, 1.5, 2, 3, 3.5, and 4 h of rest and every 0.5 h during exercise. Values are means ± SE. *Significantly different from before infusion in the same trial; P < 0.05. #Significantly different from control at that time point; P < 0.05.

FIG. 2.

Arterial plasma FFA concentration during 4 h rest followed by 3 h two-legged knee extensor exercise with either saline infusion (control) (•) or intralipid/heparin infusion (intralipid) (○). Blood samples were obtained before infusion and at 1, 1.5, 2, 3, 3.5, and 4 h of rest and every 0.5 h during exercise. Values are means ± SE. *Significantly different from before infusion in the same trial; P < 0.05. #Significantly different from control at that time point; P < 0.05.

FIG. 3.

A: Activity of PDH in the active form (PDHa). B: Representative blot for PDH-1Eα protein and PDH-1Eα site 1 and 2 phosphorylation. PDH-1Eα site 1 phosphorylation (C) and PDH-1Eα site 2 phosphorylation (D) determined in the vastus lateralis muscle before infusion (Pre), at 4 h rest, and at 45, 90, 135, and 180 min of exercise (ex) with saline infusion (control) (▪) and intralipid/heparin infusion (intralipid) (□). Values are means ± SE. *Significantly different from 4 h rest in the same trial; P < 0.05. Significantly different from control at that time point; #P < 0.05 and §0.05 ≤ P < 0.1.

FIG. 3.

A: Activity of PDH in the active form (PDHa). B: Representative blot for PDH-1Eα protein and PDH-1Eα site 1 and 2 phosphorylation. PDH-1Eα site 1 phosphorylation (C) and PDH-1Eα site 2 phosphorylation (D) determined in the vastus lateralis muscle before infusion (Pre), at 4 h rest, and at 45, 90, 135, and 180 min of exercise (ex) with saline infusion (control) (▪) and intralipid/heparin infusion (intralipid) (□). Values are means ± SE. *Significantly different from 4 h rest in the same trial; P < 0.05. Significantly different from control at that time point; #P < 0.05 and §0.05 ≤ P < 0.1.

FIG. 4.

A: Relationship between PDH-E1α site 1 phosphorylation and PDHa activity. B: Relationship between PDH-E1α site 2 phosphorylation and PDHa activity. C: Relationship between PDH-E1α site 1 and 2 phosphorylation. Significant coefficients were found with linear (r2 = 0.34 and 0.40) and exponential regression (r2 = 0.43 and 0.46) for PDH-E1α site 1 (A) and PDH-E1α site 2 (B), respectively. A close linear correlation (r2 = 0.89) was evident between PDH-E1α site 1 and 2 phosphorylation.

FIG. 4.

A: Relationship between PDH-E1α site 1 phosphorylation and PDHa activity. B: Relationship between PDH-E1α site 2 phosphorylation and PDHa activity. C: Relationship between PDH-E1α site 1 and 2 phosphorylation. Significant coefficients were found with linear (r2 = 0.34 and 0.40) and exponential regression (r2 = 0.43 and 0.46) for PDH-E1α site 1 (A) and PDH-E1α site 2 (B), respectively. A close linear correlation (r2 = 0.89) was evident between PDH-E1α site 1 and 2 phosphorylation.

FIG. 5.

The mRNA content of PDK4 (A) and PDP1 (B) determined in the vastus lateralis muscle before infusion (Pre), at 4 h rest, and at 45, 90, 135, and 180 min of exercise (ex) with saline infusion (control) (▪) and intralipid/heparin infusion (intralipid) (□). The target mRNA content was normalized to the cDNA content and presented as fold change relative to before infusion, which was set to one. Values are means ± SE. Significant difference between before infusion and 4 h rest in the same trial; ‡P < 0.05 and †0.05 ≤ P < 0.1. Significantly different from 4 h rest in the same trial; *P < 0.05 and ¤0.05 ≤ P < 0.1. Significantly different from control at that time point; #P < 0.05.

FIG. 5.

The mRNA content of PDK4 (A) and PDP1 (B) determined in the vastus lateralis muscle before infusion (Pre), at 4 h rest, and at 45, 90, 135, and 180 min of exercise (ex) with saline infusion (control) (▪) and intralipid/heparin infusion (intralipid) (□). The target mRNA content was normalized to the cDNA content and presented as fold change relative to before infusion, which was set to one. Values are means ± SE. Significant difference between before infusion and 4 h rest in the same trial; ‡P < 0.05 and †0.05 ≤ P < 0.1. Significantly different from 4 h rest in the same trial; *P < 0.05 and ¤0.05 ≤ P < 0.1. Significantly different from control at that time point; #P < 0.05.

TABLE 1

Primer and TaqMan probe sequences used for real-time PCR

GeneForward primerReverse primerProbe
PDP1 5′ TGTCTAATGACCACAATGCTCAAA 3′ 5′ CGACACTCTTGGCCTCACTCT 3′ 5′ TGGATGTTCCAATTTCAGCCGTTCTAGTTCT 3′ 
PDP2 5′ TGTCCAAGAGGACAATGGCAT 3′ 5′ AGCTCGGCCTGGTTCCAG 3′ 5′ TTGTCTGCCCCTTACACGTGACCACA 3′ 
PDK1 5′ TTCTACATGAGTCGCATTTCAATTAGA 3′ 5′ TGTTTTCGATGAGATGGACTTCCT 3′ 5′ TTGCCTTTTCCACCAAACAATAAAGAGTGCTGA 3′ 
PDK2 5′ ATCGCACCCTGAGCCAGTT 3′ 5′ ATCGCCGTAGGTGTCCTTGTAC 3′ 5′ CGCCCTGGTCACCATCCGGAA 3′ 
PDK3 5′ TCAATGAGAGCGACAGTTGAACTCT 3′ 5′ TTAATGGATAAGTCTTCTTTACCCAAAGTA 3′ 5′ AAAGAGGGCTACCCTGCTGTTAAAACCCTC 3′ 
PDK4 5′ TCCACTGCACCAACGCCT 3′ 5′ TGGCAAGCCGTAACCAAAA 3′ 5′ ATAATTCCCGGAATGCTCCTTTGGCTG 3′ 
GeneForward primerReverse primerProbe
PDP1 5′ TGTCTAATGACCACAATGCTCAAA 3′ 5′ CGACACTCTTGGCCTCACTCT 3′ 5′ TGGATGTTCCAATTTCAGCCGTTCTAGTTCT 3′ 
PDP2 5′ TGTCCAAGAGGACAATGGCAT 3′ 5′ AGCTCGGCCTGGTTCCAG 3′ 5′ TTGTCTGCCCCTTACACGTGACCACA 3′ 
PDK1 5′ TTCTACATGAGTCGCATTTCAATTAGA 3′ 5′ TGTTTTCGATGAGATGGACTTCCT 3′ 5′ TTGCCTTTTCCACCAAACAATAAAGAGTGCTGA 3′ 
PDK2 5′ ATCGCACCCTGAGCCAGTT 3′ 5′ ATCGCCGTAGGTGTCCTTGTAC 3′ 5′ CGCCCTGGTCACCATCCGGAA 3′ 
PDK3 5′ TCAATGAGAGCGACAGTTGAACTCT 3′ 5′ TTAATGGATAAGTCTTCTTTACCCAAAGTA 3′ 5′ AAAGAGGGCTACCCTGCTGTTAAAACCCTC 3′ 
PDK4 5′ TCCACTGCACCAACGCCT 3′ 5′ TGGCAAGCCGTAACCAAAA 3′ 5′ ATAATTCCCGGAATGCTCCTTTGGCTG 3′ 

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The study was supported by grants from the Danish National Research Foundation, the Danish Medical Research Council, the Danish Natural Science Research Council, the Novo Nordisk Foundation, and an Integrated Project (LSHM-CT-2004-005272) from the European Commission. The Centre of Inflammation and Metabolism is funded by the Danish National Research Foundation (no. 02-512-55). The Copenhagen Muscle Research Centre is supported by grants from the Copenhagen Hospital Corporation and the University of Copenhagen. J.W. was supported by a Hallas Møller Stipendium from the Novo Nordisk Foundation.

The authors thank the subjects who participated in the study for their extraordinary effort. The technical assistance of Kristina Møller Kristensen, Carsten Nielsen, Birgitte Jessen, and the medical assistance of José Calbet are gratefully acknowledged.

1.
Bajotto G, Murakami T, Nagasaki M, Tamura T, Tamura N, Harris RA, Shimomura Y, Sato Y: Downregulation of the skeletal muscle pyruvate dehydrogenase complex in the Otsuka Long-Evans Tokushima Fatty rat both before and after the onset of diabetes mellitus.
Life Sci
75
:
2117
–2130,
2004
2.
Kelley DE, Mandarino LJ: Hyperglycemia normalizes insulin-stimulated skeletal muscle glucose oxidation and storage in noninsulin-dependent diabetes mellitus.
J Clin Invest
86
:
1999
–2077,
1990
3.
Mandarino LJ, Consoli A, Kelley DE, Reilly JJ, Nurjhan N: Fasting hyperglycemia normalizes oxidative and nonoxidative pathways of insulin-stimulated glucose metabolism in noninsulin-dependent diabetes mellitus.
J Clin Endocrinol Metab
71
:
1544
–1551,
1990
4.
Majer M, Popov KM, Harris RA, Bogardus C, Prochazka M: Insulin downregulates pyruvate dehydrogenase kinase (PDK) mRNA: potential mechanism contributing to increased lipid oxidation in insulin-resistant subjects.
Mol Genetics Metab
65
:
181
–186,
1998
5.
Roche TE, Baker JC, Yan X, Hiromasa Y, Gong X, Peng T, Dong J, Turkan A, Kasten SA: Distinct regulatory properties of pyruvate dehydrogenase kinase and phosphatase isoforms.
Prog Nucleic Acid Res Mol Biol
70
:
33
–75,
2001
6.
Sugden MC, Holness MJ: Recent advances in mechanisms regulating glucose oxidation at the level of the pyruvate dehydrogenase complex by PDK’s.
Am J Physiol
284
:
E855
–E862,
2003
7.
Peters SJ, Harris RA, Wu P, Pehleman TL, Heigenhauser GJ, Spriet LL: Human skeletal muscle PDH kinase activity and isoform expression during a 3-day high-fat/low-carbohydrate diet.
Am J Physiol
281
:
E1151
–E1158,
2001
8.
Ward GR, Sutton JR, Jones NL, Toews CJ: Activation by exercise of human skeletal muscle pyruvate dehydrogenase in vivo.
Clin Sci
63
:
87
–92,
1982
9.
Putman CT, Spriet LL, Hultman E, Lindinger MI, Lands LC: Pyruvate dehydrogenase activity and acetyl group accumulation during exercise after different diets.
Am J Physiol
265
:
E752
–E760,
1993
10.
Watt MJ, Heigenhauser GJ, Dyck DJ, Spriet LL: Intramuscular triacylglycerol, glycogen and acetyl group metabolism during 4 h of moderate exercise in man.
J Physiol
541
:
969
–978,
2002
11.
Mourtzakis M, Saltin B, Graham T, Pilegaard H: Carbohydrate metabolism during prolonged exercise and recovery: interactions between pyruvate dehydrogenase, fatty acids and amino acids.
J Appl Physiol
100
:
1822
–1830,
2006
12.
Harris RA, Huang B, Wu P: Control of pyruvate dehydrogenase kinase gene expression.
Advan Enzym Regul
41
:
269
–288,
2001
13.
Linn TC, Pettit FH, Hucho F, Reed LJ: α-Keto acid dehydrogenase complexes. X. Regulation of the activity of the pyruvate dehydrogenase complex from beef kidney mitochondria by phosphorylation and dephosphorylation.
Proc Natl Acad Sci U S A
62
:
234
–241,
1969
14.
Yeaman SJ, Hutcheson ET, Roche TE, Pettit FH, Brown JR, Reed LJ, Watson DC, Dixon GH: Sites of phosphorylation on pyruvate dehydrogenase from bovine kidney and heart.
Biochem
17
:
2364
–2370,
1978
15.
Patel MS, Korotchkina LG: Regulation of mammalian pyruvate dehydrogenase complex by phosphorylation sites and kinases.
Exp Mol Med
33
:
191
–197,
2001
16.
Reed LJ: A trail of research from lipoic acid to α-keto acid dehydrogenase complexes.
J Biol Chem
276
:
38329
–38336,
2001
17.
Pilegaard H, Ordway GA, Saltin B, Neufer PD: Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise.
Am J Physiol
279
:
E806
–E814,
2000
18.
Pilegaard H, Saltin B, Neufer PD: Short-term fasting and refeeding on transcriptional regulation of metabolic genes in human skeletal muscle.
Diabetes
52
:
657
–662,
2003
19.
Pilegaard H, Keller C, Steensberg A, Helge JW, Petersen BK, Saltin B, Neufer PD: Importance of glycogen content for the exercise-induced gene expression in human skeletal muscle.
J Physiol
541
:
261
–271,
2002
20.
Pilegaard H, Osada T, Andersen L, Helge JW, Saltin B, Neufer PD: Substrate availability and transcriptional regulation of metabolic genes in human skeletal muscle during recovery from exercise.
Metabolism
54
:
1048
–1055,
2005
21.
Bergström J: Muscle electrolytes in man.
Scan J Clin Lab Invest
68
:
1
–110,
1962
22.
Lowry OH, Passonneau JV:
A Flexible System of Enzymatic Analysis.
London, Academic Press,
1972
23.
Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiiocyanate-phenol-chloroform extraction.
Anal Biochem
162
:
156
–159,
1987
24.
Lundby C, Nordsborg N, Kusuhara K, Kristensen KM, Neufer PD, Pilegaard H: Gene expression in human skeletal muscle: alternative normalization method and effect of repeasted biopsies.
Eur J Appl Physiol
95
:
351
–360,
2005
25.
Sugden C, Crawford RM, Halford NG, Hardie DG: Regulation of spinach SNF1-related (SnRK1) kinases by protein kinases and phosphatases is associated with phosphorylation of the T loop and is regulated by 5′-AMP.
Plant J
19
:
433
–439,
1999
26.
Markuns JF, Wojtaszewski JF, Goodyear LJ: Insulin and exercise decrease glycogen synthase kinase-3 activity by different mechanisms in rat skeletal muscle.
J Biol Chem
274
:
24896
–24900,
1999
27.
Cederblad G, Carlin JI, Constantin-Teodosiu D, Harper P, Hultman E: Radioisotopic assays of CoASH and carnitine and their acetylated forms in human skeletal muscle.
Anal Biochem
185
:
274
–278,
1990
28.
Constantin-Teodosiu D, Cederblad G, Hultman E: A sensitive radioisotopic assay of pyruvate dehydrogenase complex in human muscle tissue.
Anal Biochem
198
:
347
–351,
1991
29.
Turvey EA, Heigenhauser GJF, Parolin M, Peters SJ: Elevated n-3 fatty acids in a high-fat diet attenuate the increase in PDH kinase activity but not PDH activity in human skeletal muscle.
J Appl Physiol
98
:
350
–355,
2005
30.
Kelley DE, Mokan M, Simoneau JA, Mandarino LJ: Interaction between glucose and free fatty acid metabolism in human skeletal muscle.
J Clin Invest
92
:
91
–98,
1993
31.
Watt MJ, Heigenhauser GJF, LeBlanc PJ, Inglis JG, Spriet LL, Peters SJ: Rapid upregulation of pyruvate dehydrogenase kinase activity in human skeletal muscle during prolonged exercise.
J Appl Physiol
97
:
1261
–1267,
2004
32.
Sugden PH, Randle PJ: Regulation of pig heart pyruvate dehydrogenase by phosphorylation: studies on the subunit and phosphorylation stoicheiometries.
Biochem J
173
:
659
–668,
1978
33.
Korotchkina LG, Patel MS: Mutagenesis studies of the phosphorylation sites of recombinant human pyruvate dehydrogenase: site-specific regulation.
J Biol Chem
270
:
14297
–14304,
1995
34.
Wu P, Inskeep K, Bowker-Kinley MM, Popov KM, Harris RA: Mechanism responsible for inactivation of skeletal muscle pyruvate dehydrogenase complex in starvation and diabetes.
Diabetes
48
:
1593
–1599,
1999
35.
Tunstall RJ, Cameron-Smith D: Effect of elevated lipid concentration on human skeletal muscle gene expression.
Metabolism
54
:
952
–959,
2005
36.
Lee FN, Zhang L, Zheng D, Choi WS, Youn JH: Insulin suppresses PDK-4 expression in skeletal muscle independently of plasma FFA.
Am J Physiol
287
:
E69
–E74,
2004
37.
LeBlanc PJ, Peters SJ, Tunstall RJ, Cameron-Smith D, Heigenhauser GJF: Effects of aerobic training on pyruvate dehydrogenase and pyruvate dehydrogenase kinase in human skeletal muscle.
J Physiol
557
:
559
–570,
2004
38.
Bowker-Kinley MM, Davis WI, Wu P, Harris RA, Popov KM: Evidence for existence of tissue-specific regulation of the mammalian pyruvate dehydrogenase complex.
Biochem J
329
:
191
–196,
1998
39.
Korotchkina LG, Patel MS: Site specificity of four pyruvate dehydrogenase kianse isoenzymes toward the three phosphorylation sites of human pyruvate dehydrogenase.
J Biol Chem
276
:
37223
–37229,
2001