OBJECTIVE—In pregestational diabetes, the placenta at term of gestation is characterized by various structural and functional changes. Whether similar alterations occur in the first trimester has remained elusive. Placental development requires proper trophoblast invasion and tissue remodeling, processes involving matrix metalloproteinases (MMPs) of which the membrane-anchored members (MT-MMPs) such as MT1-MMPs are key players. Here, we hypothesize a dysregulation of placental MT1-MMP in the first trimester of type 1 diabetic pregnancies induced by the diabetic environment.
RESEARCH DESIGN AND METHODS—MT1-MMP protein was measured in first-trimester placentas of healthy (n = 13) and type 1 diabetic (n = 13) women. To identify potential regulators, first-trimester trophoblasts were cultured under hyperglycemia and various insulin, IGF-I, IGF-II, and tumor necrosis factor-α (TNF-α) concentrations in presence or absence of signaling pathway inhibitors.
RESULTS—MT1-MMP was strongly expressed in first-trimester trophoblasts. In type 1 diabetes, placental pro–MT1-MMP was upregulated, whereas active MT1-MMP expression was only increased in late first trimester. In isolated primary trophoblasts, insulin, IGF-I, IGF-II, and TNF-α upregulated MT1-MMP expression, whereas glucose had no effect. The insulin effect was dependent on phosphatidylinositol 3-kinase, the IGF-I effect on mitogen-activated protein kinase, and the IGF-II effect on both.
CONCLUSIONS—This is the first study reporting alterations in the first-trimester placenta in type 1 diabetes. The upregulated MT1-MMP expression in type 1 diabetes may be the result of higher maternal insulin and TNF-α levels. We speculate that the elevated MT1-MMP will affect placental development and may thus contribute to long-term structural alterations in the placenta in pregestational diabetes.
Despite improvement in the quality of metabolic control over the past decades, maternal pregestational diabetes, in particular type 1 diabetes, is still often associated with a range of maternal and fetal complications (1). In addition to the effects on fetal growth, the structural and functional development of the placenta is affected. In contrast to the well-known placental changes at term of diabetic pregnancies (2–4), the effect of pregestational diabetes on the placenta in the first trimester has remained elusive. We have recently proposed that a diabetic insult early in pregnancy will alter long-term placental development and thus result in the observed changes at term (5).
Key processes early in placental development involve implantation and placentation. These require proliferation, migration, and invasion of trophoblast cells as well as extensive uterine tissue remodeling (6,7). Trophoblast invasion is a process that is tightly controlled in time and space in a paracrine and autocrine manner. A multitude of factors have been implicated in its control, including the nonclassical major histocompatibility complex class I molecule HLA-G (8), which is expressed on a specialized trophoblast subpopulation, the extravillous trophoblast.
Matrix metalloproteinases (MMPs) have been implicated in tissue remodeling. They form a large family of proteolytic enzymes capable of degrading extracellular matrix (ECM). MMPs are members of the metzincin group of proteases, which have a conserved Met residue and a zinc ion at their active site (9). Mammalian MMPs share a conserved domain structure that consists of a catalytic domain and an auto-inhibitory pro-domain. When the pro-domain is destabilized or removed by proteolytic cleavage, the active site becomes available for substrates (10). Various MMP family members are highly expressed in the first-trimester placenta (11,12).
New emerging data show that the membrane-anchored subfamily of MMPs, i.e., MT-MMPs, are major modifiers of the pericellular environment and key regulators of tumor cell behavior (13). To date, the MT-MMP family includes six members, MT1-, MT2-, MT3-, MT4-, MT5-, and MT6-MMP (13). MT1-MMP plays an outstanding role in tissue remodeling, migration, and invasion (7,14,15). Apart from its role in ECM breakdown and activation of other metalloproteinases, i.e., MMP2 and MMP13, MT1-MMP is also able to activate or inactivate several cytokines and chemokines by cleaving their pro-forms, e.g., tumor necrosis factor-α (TNF-α), or active forms such as of interleukin-8 (IL-8), growth-regulated protein (GRO)-α, and GRO-γ (16,17). The resulting active cytokines may affect further placental development.
MT1-MMP levels can be regulated at various stages, including transcription, translation, activity, and degradation (13,18). MT1-MMP is synthesized as an inactive, 63-kDa zymogen (pro–MT1-MMP) and, after transport to the cell membrane, is cleaved into the 57-kDa active enzyme at a furin recognition motif. Shedding of the membrane-anchored MT1-MMP results in degradation products among which the soluble 50-kDa fragment remains active, whereas both 44- and 32-kDa products are proteolytically inactive (18). In the human placenta in early gestation, MT1-MMP is highly expressed by various trophoblast subpopulations such as extravillous invading and noninvading cytotrophoblasts and the proliferating cytotrophoblasts of cell islands (11).
MMPs in general are dysregulated in various diabetes-associated complications such as nephropathy, retinopathy, and vascular complications (19–22). Notably, MMP2 is implicated in diabetes-induced changes (23–25) and is also dysregulated in the rat placenta in diabetes (26). MT1-MMP is the only MT-MMP member that has been reported to be dysregulated in diabetes (19,21,22).
The overall hypothesis tested in this study predicted changes in placental MT-MMP expression associated with pregestational diabetes. After identification of MT1- and MT2-MMP as the only membrane-type MMPs present in the placenta, we focused on MT1-MMP because of its pleiotropic effects. It is predominantly found in the extravillous trophoblast (11). Therefore, we determined differential expression of MT-MMPs in the HLA-G–expressing, invasive versus the HLA-G–negative, noninvasive trophoblast subpopulations. We further hypothesized that potential changes in MT1-MMP synthesis are accounted for by the diabetic environment. To identify the diabetes-associated factors causing MT1-MMP dysregulation, in vitro experiments were performed using isolated primary trophoblasts from the first trimester of pregnancy. They were treated with insulin, TNF-α, and glucose, factors with elevated concentrations in the maternal circulation in diabetes, and their effect on MT1-MMP expression was determined. Because IGF-I and IGF-II share some signaling pathways with insulin, they were included in the in vitro experiments.
RESEARCH DESIGN AND METHODS
First-trimester placental samples.
After pregnancy termination for psychosocial reasons (interrupted pregnancies) or missed abortions, tissue samples (Table 1) were collected in Medium 199 supplemented with penicillin/streptomycin (Gibco, Invitrogen, Carlsbad, CA), washed immediately in PBS, and snap-frozen. The gestational age was calculated from the last menstrual period and corrected after endovaginal ultrasound examination using published charts (27). The study was approved by the institutional review board and ethical committee of the Medical University of Graz and informed consent of the patients.
Isolation of first-trimester trophoblasts.
Primary trophoblasts were isolated from first-trimester placentas after pregnancy terminations for psychosocial reasons as described previously (28). The cells thus obtained constitute a mixture of both trophoblast subpopulations, i.e., villous and extravillous trophoblasts. All cell preparations were subjected to rigorous immunocytochemical characterization (28). Trophoblasts were tested for viability by measuring human chorionic gonadotropin (hCG) levels secreted into the culture medium (Dade Behring, Deerfield, IL). Only preparations with a purity ≥99% and the characteristic kinetics of hCG secretion (29) were used.
Cell culture.
Primary trophoblasts were cultured in gelatin-coated plates with Dulbecco's modified Eagle's medium (DMEM) (Gibco) supplemented with 2% (vol/vol) FCS in a humidified atmosphere of 5% CO2 at 37°C. For growth factor and glucose treatment, isolated trophoblasts were seeded in gelatin-coated 24-well plates (50,000 cells/well) and cultured in DMEM with 2% (vol/vol) FCS. After 24 h, medium was replaced by fresh medium supplemented with insulin (0.1 and 1 nmol/l; Calbiochem, Merck, Darmstadt, Germany), IGF-I (50 and 100 ng/ml; R&D Systems, Minneapolis, MN), IGF-II (165 and 300 ng/ml; R&D Systems), TNF-α (10 and 25 ng/ml; Sigma), and glucose (25 mmol/l; Sigma), and the cells were cultured for a further 48 h. The experimental levels of insulin, IGF-I, and IGF-II were chosen to lie within the (patho)-physiological range to avoid low-affinity binding to others aside from their specific receptor (30). The concentrations of insulin (1 nmol/l) and glucose (25 mmol/l) were chosen as to lie about two- to threefold higher than the maternal in vivo concentrations attained either postprandially (glucose) or after pharmacological administration (insulin) (31). The IGF-I level (85 ng/ml) parallels the maternal IGF-I levels in the first trimester of gestation (32). IGF-II was used in the concentration range that showed the highest effect on trophoblast invasion in vitro (between 125 and 625 ng/ml) (33). The concentration of TNF-α (25 ng/ml) is a standard concentration used to study the effect of TNF-α (34).
In experiments with inhibition of phosphatidylinositol 3-kinase (PI 3-kinase) or MAPK/ERK kinase 1 (MEK1), cells were pretreated for 5 h with either Wortmannin (100 nmol/l; Calbiochem) or U0126 (10 μmol/l; Calbiochem) dissolved in DMSO before being stimulated with 1 nmol/l insulin for 48 h. In unstimulated control cells and insulin-stimulated cells, the same volume of DMSO without inhibitors was added as vehicle control.
Separation of HLA-G–positive and HLA-G–negative first-trimester trophoblasts.
Immediately after isolation, first-trimester trophoblasts were separated into subpopulations expressing or lacking surface HLA-G. Trophoblasts were incubated with immunomagnetic beads (Dynabeads M-450) conjugated with anti–HLA-G antibody (MEM-G/9; Abcam, Cambridge, U.K.). The unbound, HLA-G–devoid cells and the cells bound to the beads were separated by applying a magnet above the tube. The two cell populations thus obtained were subsequently cultured in DMEM supplemented with 10% (vol/vol) FCS.
Microarray analysis of placental primary cell RNA.
Total RNA from 10 first-trimester trophoblast preparations isolated from different placentas was pooled, and 5 μg RNA was prepared for hybridization as described previously (35). For expression analysis, cRNA was hybridized against HU133A-chips (Affymetrix, Santa Clara, CA) according to the manufacturer's instructions. Raw data were normalized globally and processed with Microarray Suite, version 5.0, and Data Mining Tool (Affymetrix) software. Annotations were obtained from NetAffx (Affymetrix), and the data were screened for membrane-anchored MMPs (MT-MMPs).
Isolation of RNA and RT-PCR for various MT-MMPs in first-trimester trophoblasts.
Total RNA was isolated from first-trimester trophoblasts with TRIzol (MRC, Cincinnati, OH). Primers (Table 2) for ribosomal protein L30 (RPL30) and the MT-MMPs (MT1-MMP, MT2-MMP, MMP16, MMP17, MMP24, and MMP25) were designed using the public web-page Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and purchased from Ingenetix (Vienna, Austria). The primer pairs included splicing sites within the amplicon. Because of its stable expression within the different placental cell types, the mRNA amount of the RPL30 was used as an internal control (35). Two hundred nanograms total RNA was used for the one-step RT-PCR kit from Qiagen (Hilden, Germany) according to the manufacturer's instructions. For RPL30 24 cycles and for all MT-MMPs, 27 cycles were used. For all primer pairs, the annealing temperature was 60°C. PCR products were electrophoresed on 3% agarose gels, documented with the Eagle-Eye system (Stratagene, La Jolla, CA), and quantified with the AlphaDigiDoc 1000 (Alpha Innotech, San Leandro, CA) software. To validate primer pairs, RT-PCRs were carried out using human RNA from brain, lung, and colon as positive controls. These gave distinct bands with sizes corresponding to the calculated size of the amplicon in at least one organ. In preliminary experiments using first-trimester trophoblast RNA, the optimal RT-PCR cycle number for MT1-MMP, MT2-MMP, and L30 was determined to lie within the linear range of the amplification.
Preparation of proteins and Western blot analysis.
Tissue was homogenized, and cells were lysed in buffer containing 0.01 mol/l Tris, pH 7.4, 1% SDS, 1 mmol/l sodium-orthovanadate, and Complete protease inhibitor (Roche) mixed with an equal volume of Laemmli sample buffer (Sigma). Before electrophoresis, samples were centrifuged and boiled for 5 min at 99°C. Equal amounts of protein, determined according to Lowry, were used for SDS-PAGE on a 10% gel (Pierce, Rockford, IL). After electroblotting, membranes were blocked for 1 h with 5% (wt/vol) nonfat dry milk (Bio-Rad, Hercules, CA) and 0.1% (vol/vol) Tween-20 (Sigma) in 0.14 mol/l Tris-buffered saline, pH 7.3, at room temperature. This solution was used for subsequent washings and as a diluent for the antibodies. The membranes were incubated overnight at 4°C with antibodies against MT1-MMP (1:2,000; Chemicon, Millipore, Bedford, MA) or β-actin (1:10,000; Amersham, Little Chalfont, U.K.). After washing, membranes were incubated with the adequate secondary antibody (Bio-Rad; 1:1,000) for 1 h at room temperature. Immunolabeling was visualized using the SuperSignal CL-HRP Substrate System (Pierce). To allow comparison between gels, an internal standard sample was prepared as lysate from one first-trimester placental tissue to which all optical densities within each blot were normalized. Membranes were exposed to Hyperfilm (Amersham) and densitometrically scanned using a digital camera and the AlphaDigiDoc 1000 software within the linear range of film and camera.
Statistical analysis.
Statistical analysis used Sigma Stat 3.1 software (Jandel Scientific, San Rafael, CA). After testing for normal distribution (Kolmogorov-Smirnov), the Mann-Whitney U test for nonparametric data or a Student's t test was used to test for differences in the amounts of pro–, active, and total MT1-MMP protein and mRNA of various MT-MMPs. To test for treatment effects, Kruskal-Wallis one-way ANOVA on ranks with Dunn's method as post hoc test was used. Correlations were analyzed by person-product moment correlation. Significances were accepted at a level of P < 0.05.
RESULTS
Expression of various MT-MMPs in first-trimester trophoblasts.
Among all six MT-MMPs surveyed by microarray analysis, only MT1-MMP and MT2-MMP were expressed in isolated primary trophoblasts from the first-trimester of gestation (Table 3). This was further confirmed by RT-PCR, which demonstrated a similar amount of MT1-MMP and MT2-MMP expression (Fig. 1A and B). Thus, MT3-MMP–MT6-MMP were either absent or present at levels below the sensitivity threshold of both methods, i.e., microarray and RT-PCR. After separation of the trophoblasts in subpopulations according to their surface HLA-G expression, the HLA-G–positive trophoblasts representing the more invasive phenotype of trophoblasts had a 33% (P = 0.0004) higher expression level of MT1-MMP (Fig. 1C and D).
MT1-MMP protein expression in first-trimester placental tissue of healthy and type 1 diabetic women.
In first-trimester placentas complicated by type 1 diabetes, MT1-MMP expression was increased (P < 0.0001) by 100% (Fig. 2). When the two bands of active (57 kDa) and pro–MT1-MMP (63 kDa) were analyzed separately, an upregulation of both zymogen (96%; P = 0.0001) and active proteinase (111%; P = 0.04) was observed. The ratio between active and pro–MT1-MMP did not differ between both groups. No other bands at lower molecular weight, i.e., 50, 44, and 32 kDa, were detected, which would represent processed MT1-MMP species.
When the data were stratified according to the gestational age, i.e., early (≤8 weeks) and late (>8 weeks) first-trimester, active MT1-MMP levels were lower by 60% (P = 0.026) in the control samples from late compared with early first trimester (Fig. 3). Because the type 1 diabetic samples did not show this change, their MT1-MMP levels were higher by 72% (P = 0.0018) after week 8 in the first-trimester. No change between early and late first trimester could be found in total and pro–MT1-MMP expression (not shown). No difference in MT1-MMP was found between the miscarriages (missed abortions) and the interrupted pregnancies within and between both study groups (not shown).
Neither total nor active or pro–MT1-MMP levels correlated with maternal A1C values. However, the daily insulin dose of the type 1 diabetic subjects correlated (r = 0.626, P = 0.04) with the total MT1-MMP protein levels (not shown).
Regulation of MT1-MMP expression in first-trimester trophoblasts by insulin, IGF-I, IGF-II, glucose, and TNF-α.
When primary first-trimester trophoblasts were analyzed by Western blotting, only the 57-kDa band of active MT1-MMP could be detected. Insulin, IGF-II, and TNF-α increased MT1-MMP expression in a dose-dependent manner (ANOVA) (Fig. 4). IGF-I upregulation was only significant with Student's t test. Glucose had no effect. In the culture supernatant, none of the shedded MT1-MMP species (50 and 44 kDa) could be detected by immunoblotting (not shown). The 113% induction (P = 0.05) caused by insulin was attenuated by inhibition of the PI 3-kinase pathway but not affected by inhibition with U0126 of MEK1, a central kinase of the extracellular signal–related kinase (ERK) 1/2 mitogen-activated protein kinase (MAPK) pathway (Fig. 5). The IGF-I–induced stimulation was only inhibited by U0126, whereas the IGF-II effect was abolished by inhibition of both the PI 3-kinase and the ERK1/2 pathway. The effects of insulin, IGF-I, IGF-II, and TNF-α did not differ between isolated primary trophoblasts from early versus late first trimester (not shown).
DISCUSSION
This study identified MT1-MMP and MT2-MMP as the only members of the membrane-anchored family of MMPs expressed at high mRNA levels in the first-trimester trophoblast of the human placenta.
The prominent expression of MT1-MMP early in gestation suggests a major role in processes involved in early placental development. This notion is further supported by its predominant presence in the HLA-G–expressing trophoblast subpopulation, which represents the invasive extravillous trophoblast. The high MT1-MMP expression in the HLA-G–positive trophoblasts is in accordance with results of in situ hybridization in first-trimester placental tissue (11).
During the first trimester of pregnancy the amount of active MT1-MMP notably decreased in the nondiabetic control group. The underlying mechanism is unclear. The decrease of active MT1-MMP but not of total or pro–MT1-MMP in the late first trimester suggests a change in pro–MT1-MMP activation. This may result from a reduction of expression or activity of furin or the pro-protein convertase PCSK6, both of which can activate pro–MT1-MMP (36). The absence of different MT1-MMP levels or effects in the isolated cells from different gestational weeks indicates stability of the intrinsic responsiveness of the cells during the first trimester and suggests changes in placental environment to contribute to the decrease in tissue MT1-MMP expression.
The period in gestation from week 6 to week 12 is characterized by an increase in oxygen tension in the intervillous space (37). Analysis of the MT1-MMP promoter sequence found no potential binding site of hypoxia-inducible factor 1 (HIF-1) that could directly upregulate MT1-MMP expression. However, furin expression is upregulated under hypoxic conditions by HIF-1 (38). Hence, as a hypothesis, lower furin expression under normoxic conditions in the late first trimester may result in lower levels of cleaved, active MT1-MMP. This decrease of MT1-MMP synthesis was absent in the type 1 diabetic group.
To the best of our knowledge this is the first study carried out on placental tissue from first-trimester diabetic pregnancies. Therefore, it is unknown whether the oxygen tension in the intervillous space is lower in type 1 diabetes than in nondiabetic pregnancies. Moreover, it is also unknown whether utero-placental function associated with MMP activity such as trophoblast migration, invasion, or uterine tissue remodeling is altered.
In other tissues, MT1-MMP expression is decreased (19,21) or increased (22,39) in diabetes. Hence, the ultimate effect of the diabetic environment on MT1-MMP expression strongly depends on the specific tissue and on the proportion of factors dysregulated in this pathology such as glucose, insulin, and TNF-α.
Miscarriage is a pregnancy problem that may have several underlying causes, including inadequate trophoblast invasion (40). Pregestational diabetes is associated with an increased risk for spontaneous abortions (41). Given the prominent role that is attributed to MT1-MMP, it was of special interest that placental MT1-MMP expression did not differ between both groups regardless of presence or absence of maternal diabetes. This strongly suggests that MT1-MMP dysfunction is not involved in the pathogenesis of miscarriages.
Even in the first trimester, the placenta is a complex tissue comprising several cell types. Here, only total tissue samples were analyzed, and, hence, the differences between type 1 diabetic and control samples cannot be directly attributed to a specific cell type. However, because in situ hybridization did not detect MT1-MMP mRNA in the villous stroma in the first-trimester placenta (11), we conclude trophoblast cells to account for the observed changes of MT1-MMP in placental tissue. Therefore, primary trophoblasts were used for the further in vitro experiments.
In first-trimester trophoblasts in vitro, only one MT1-MMP species was detected that corresponded to active MT1-MMP. This may be the result of high trophoblast expression of furin and PCSK6 found by microarray analysis (U. Hiden and G. Desoye, unpublished data). In the absence of other potential substrates such as ECM in cell culture, the high proteolytic activity against pro–MT1-MMP may result in full activation of the enzyme.
This study did not measure maternal IGF-I, IGF-II, and TNF-α levels because restrictions from the ethical committee did not permit measurements other than the A1C values. Hence, the concentrations for the in vitro experiments were chosen from published values for first-trimester levels of IGF-I, IGF-II, and TNF-α in maternal type 1 diabetes. Under this condition, maternal IGF-I and IGF-II serum levels are unchanged (42). To our knowledge no published data about serum TNF-α levels of type 1 diabetic women in the first trimester are available, but TNF-α is elevated in nonpregnant type 1 diabetic patients (43). Furthermore, rodents have increased uterine TNF-α expression throughout diabetic pregnancy (44).
The increase of MT1-MMP expression in type 1 diabetes was paralleled by upregulation of MT1-MMP in isolated primary trophoblasts after treatment with insulin and TNF-α, both factors with elevated concentrations in the diabetic environment. Insulin shares some intracellular signaling pathways with IGF-I and IGF-II. Therefore, both IGFs were included in the study despite their lack of concentration change in the first-trimester type 1 diabetic pregnancies. Because glucose had no effect on MT1-MMP expression, insulin and the proinflammatory TNF-α are likely candidates to account for the observed changes in placental MT1-MMP expression in type 1 diabetes. The promoter of MT1-MMP includes a binding site for the nuclear transcription factor SP-1 and several transforming growth factor-β1 inhibitory element-like sequences (45). Both insulin and TNF-α can activate SP-1 (46,47) and thereby could stimulate MT1-MMP expression. IGF-I and IGF-II also upregulated MT1-MMP expression in trophoblasts. The stimulatory IGF-I effect, however, was only significant with Student's t test. We assume that ANOVA missed the concentration effect as a result from the already maximum stimulation of MT1-MMP with the lower IGF-I concentration (50 ng/ml). None of the treatments resulted in the occurrence of an additional MT1-MMP species, indicating that enzyme processing was not affected. The key role of insulin in regulating placental MT1-MMP production as found in vitro is corroborated further by the correlation of total MT1-MMP protein with the daily insulin dose of the type 1 diabetic subjects.
Insulin can activate two major signaling pathways, i.e., the MAPK and the PI 3-kinase pathway, respectively. Both pathways can transcriptionally activate MT1-MMP expression in various cells (48,49). When PI 3-kinase was inhibited by Wortmannin, the notably strong effect of insulin was reduced. In contrast, the IGF-I effect was diminished by inhibition of the ERK1/2 pathway. The IGF-II effect was absent after inhibition of both pathways, which may be accounted for by the ability of IGF-II to bind to and activate the IGF-I receptor and the short insulin receptor isoform (50). Thus, the induction of MT1-MMP synthesis by IGF-II may be mediated by the IGF-I receptor and ERK1/2 and by the insulin receptor and PI 3-kinase. The IGF-I effect in trophoblasts was different from tumor cells (49) in which IGF-I stimulated MT1-MMP expression via the PI 3-kinase/Akt pathway, which may reflect changes in tumor cell signaling resulting from malignant transformation. Thus, transcriptional activation of MT1-MMP in trophoblasts can be accomplished by signaling through different pathways, i.e., the PI 3-kinase and the ERK1/2 pathway.
The consequences of the diabetes-associated alterations in MT1-MMP expression and processing are unknown. Among all MMPs, MT1-MMP has a notably broad range of substrates, including ECM components such as fibronectin, collagen I-III, laminin 1 and 5, pro-MMPs such as pro-MMP2 and pro-MMP13, and cytokines and chemokines, including pro–TNF-α, IL-8, GRO-α, and GRO-γ (16,17). Therefore, one can picture several scenarios by which higher levels of MT1-MMP may affect placental development: 1) MT1-MMP degrades ECM. 2) Other MMPs are activated, which subsequently cleave ECM components; both mechanisms may directly affect villous differentiation and development. 3) Overactivation (pro–TNF-α) or enhanced degradation and, hence, inactivation (IL-8, GRO-α, and GRO-γ) of cytokines and chemokines involved in trophoblast function (16) may further indirectly modify cellular processes relevant for placental development.
We propose that some of the well-described structural alterations of the placenta at the end of a type 1 diabetic pregnancy may begin already in the first trimester of pregnancy. Obviously, tight glycemic control in the first gestational weeks by insulin treatment does not prevent all diabetes-associated changes in placental development, as dysregulation of placental MT1-MMP expression is dependent on insulin levels.
Expression of MT-MMP mRNAs in human first-trimester trophoblasts. A: RT-PCR revealed that MT1-MMP and MT2-MMP are expressed. No bands were detected for MT3-, MT4-, MT5-, and MT6-MMP (not shown). B: Mean mRNA expression levels did not differ between MT1-MMP and MT2-MMP. MT1-MMP mRNA is present in HLA-G–positive (+) and HLA-G–negative (−) trophoblasts (C), with higher expression in the HLA-G–positive trophoblast subpopulation (D). The RPL30 was used as an internal control; n = 4 trophoblast preparations from different placentas.
Expression of MT-MMP mRNAs in human first-trimester trophoblasts. A: RT-PCR revealed that MT1-MMP and MT2-MMP are expressed. No bands were detected for MT3-, MT4-, MT5-, and MT6-MMP (not shown). B: Mean mRNA expression levels did not differ between MT1-MMP and MT2-MMP. MT1-MMP mRNA is present in HLA-G–positive (+) and HLA-G–negative (−) trophoblasts (C), with higher expression in the HLA-G–positive trophoblast subpopulation (D). The RPL30 was used as an internal control; n = 4 trophoblast preparations from different placentas.
MT1-MMP protein expression (means ± SE) in first-trimester placental tissue from control (n = 13) and type 1 diabetic (T1D) (n = 13) pregnancies. A: Six representative Western blots are shown. Before data analysis, all samples were normalized to the internal control (placenta extract). The graph (B) displays the expression of total MT1-MMP and separate expression of the pro–MT1-MMP zymogen (63 kDa) and the active MT1-MMP (57 kDa).
MT1-MMP protein expression (means ± SE) in first-trimester placental tissue from control (n = 13) and type 1 diabetic (T1D) (n = 13) pregnancies. A: Six representative Western blots are shown. Before data analysis, all samples were normalized to the internal control (placenta extract). The graph (B) displays the expression of total MT1-MMP and separate expression of the pro–MT1-MMP zymogen (63 kDa) and the active MT1-MMP (57 kDa).
Box plot depicting expression of active MT1-MMP protein (57 kDa) in early (≤week 8; n = 6) and late (>week 8; n = 7) first-trimester placental tissue of type 1 diabetic (T1D) and healthy (control) women.
Box plot depicting expression of active MT1-MMP protein (57 kDa) in early (≤week 8; n = 6) and late (>week 8; n = 7) first-trimester placental tissue of type 1 diabetic (T1D) and healthy (control) women.
A: Representative Western blot of active MT1-MMP (57 kDa) in first-trimester primary trophoblasts (n = 5 preparations from different placentas) stimulated for 48 h with insulin (I) (1 nmol/l), TNF-α (25 ng/ml), IGF-I (100 ng/ml), IGF-II (300 ng/ml), and glucose (G) (25 mmol/l) compared with the untreated controls (C). The graphs (B–E) show MT1-MMP protein expression (means ± SE) in trophoblasts treated with different concentrations of insulin (0.1 and 1 nmol/l), TNF-α (10 and 25 ng/ml), IGF-I (50 and 100 ng/ml), and IGF-II (165 and 300 ng/ml). The data are expressed relative to the controls (= 100%). Statistical tests used the raw data. *Significant change (P < 0.05) vs. controls using post hoc test. §Significant change using Student's t test.
A: Representative Western blot of active MT1-MMP (57 kDa) in first-trimester primary trophoblasts (n = 5 preparations from different placentas) stimulated for 48 h with insulin (I) (1 nmol/l), TNF-α (25 ng/ml), IGF-I (100 ng/ml), IGF-II (300 ng/ml), and glucose (G) (25 mmol/l) compared with the untreated controls (C). The graphs (B–E) show MT1-MMP protein expression (means ± SE) in trophoblasts treated with different concentrations of insulin (0.1 and 1 nmol/l), TNF-α (10 and 25 ng/ml), IGF-I (50 and 100 ng/ml), and IGF-II (165 and 300 ng/ml). The data are expressed relative to the controls (= 100%). Statistical tests used the raw data. *Significant change (P < 0.05) vs. controls using post hoc test. §Significant change using Student's t test.
Induction of active (57 kDa) MT1-MMP in primary first-trimester trophoblasts after 48 h of treatment with insulin (1 nmol/l), IGF-I (100 ng/ml), and IGF-II (300 ng/ml) in the presence or absence of the PI 3-kinase inhibitor Wortmannin (100 nmol/l) or the MEK1 inhibitor U0126 (10 μmol/l). The graphs (A–C) display the protein expression (n = 4 trophoblast preparations from different placentas; means ± SE) compared with the untreated control. P values refer to differences versus controls.
Induction of active (57 kDa) MT1-MMP in primary first-trimester trophoblasts after 48 h of treatment with insulin (1 nmol/l), IGF-I (100 ng/ml), and IGF-II (300 ng/ml) in the presence or absence of the PI 3-kinase inhibitor Wortmannin (100 nmol/l) or the MEK1 inhibitor U0126 (10 μmol/l). The graphs (A–C) display the protein expression (n = 4 trophoblast preparations from different placentas; means ± SE) compared with the untreated control. P values refer to differences versus controls.
Characteristics of study subjects
| Control group | Type 1 diabetes group | |
|---|---|---|
| No. of subjects | 13 | 13 |
| Interrupted pregnancies | 9 | 9 |
| Miscarriages | 4 | 4 |
| Gestational age (weeks) | ||
| Means ± SD | 8 ± 2 | 9 ± 2 |
| Range | 7–12 | 7–12 |
| A1C (%) | ||
| Means ± SD | n.d. | 7.5 ± 2.1 |
| Control group | Type 1 diabetes group | |
|---|---|---|
| No. of subjects | 13 | 13 |
| Interrupted pregnancies | 9 | 9 |
| Miscarriages | 4 | 4 |
| Gestational age (weeks) | ||
| Means ± SD | 8 ± 2 | 9 ± 2 |
| Range | 7–12 | 7–12 |
| A1C (%) | ||
| Means ± SD | n.d. | 7.5 ± 2.1 |
A1C values of the control group were not determined (n.d.). The cutoff A1C value for nondiabetic pregnant women as established by the local clinical laboratory was 6%.
Primers used for RT-PCR
| Gene | Forward primer | Reverse primer |
|---|---|---|
| RPL30 | CCTAAGGCAGGAAGATGGTG | CAGTCTGTTCTGGCATGCTT |
| MT1-MMP | AAGGCACACTTGCTCCTGTT | CACTGGTGAGACAGGCTTGA |
| MT2-MMP | GGCCGACATCATGGTACTCT | GTCAACGTCCTTCCACTGGT |
| MT3-MMP | GCTGACCCAAGGAAAAATGA | CACAAAATTCCCGTCGCTAT |
| MT4-MMP | CTGTACTGGCGCTACGATGA | GGCTCTGGTCATGTTGTCCT |
| MT5-MMP | CAAACCCAACATCTGTGACG | TAGGTCTTGCCCACAGGTTC |
| MT6-MMP | GATCGATGTGAGGGCAATTT | TAGGTCTTCCCGTTCTGTGG |
| Gene | Forward primer | Reverse primer |
|---|---|---|
| RPL30 | CCTAAGGCAGGAAGATGGTG | CAGTCTGTTCTGGCATGCTT |
| MT1-MMP | AAGGCACACTTGCTCCTGTT | CACTGGTGAGACAGGCTTGA |
| MT2-MMP | GGCCGACATCATGGTACTCT | GTCAACGTCCTTCCACTGGT |
| MT3-MMP | GCTGACCCAAGGAAAAATGA | CACAAAATTCCCGTCGCTAT |
| MT4-MMP | CTGTACTGGCGCTACGATGA | GGCTCTGGTCATGTTGTCCT |
| MT5-MMP | CAAACCCAACATCTGTGACG | TAGGTCTTGCCCACAGGTTC |
| MT6-MMP | GATCGATGTGAGGGCAATTT | TAGGTCTTCCCGTTCTGTGG |
Microarray analysis of MT-MMP family members expressed in first-trimester trophoblasts
| MT-MMP family members | Accession number | Signal |
|---|---|---|
| MT1-MMP (MMP14) | NM_004995 | 2341 |
| MT2-MMP (MMP15) | NM_002428 | 2145 |
| MT3-MMP (MMP16) | NM_022564 | ND |
| MT4-MMP (MMP17) | NM_016155 | ND |
| MT5-MMP (MMP24) | NM_006690 | ND |
| MT6-MMP (MMP25) | NM_022468 | ND |
| MT-MMP family members | Accession number | Signal |
|---|---|---|
| MT1-MMP (MMP14) | NM_004995 | 2341 |
| MT2-MMP (MMP15) | NM_002428 | 2145 |
| MT3-MMP (MMP16) | NM_022564 | ND |
| MT4-MMP (MMP17) | NM_016155 | ND |
| MT5-MMP (MMP24) | NM_006690 | ND |
| MT6-MMP (MMP25) | NM_022468 | ND |
Total RNA from 10 preparations isolated from 10 different placentas was used. Expression of some metalloproteinases was not detectable (ND).
Published ahead of print at http://diabetes.diabetesjournals.org on 17 October 2007. DOI: 10.2337/db07-0903.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Article Information
U.H. has received grant 10896 from the Jubilee Fund, Austrian National Bank, Vienna. G.D. has received grants 10053 and 12601 from the Jubilee Fund, Austrian National Bank, Vienna.
