Low concentrations of insulin-like growth factor (IGF) binding protein-1 (IGFBP1) are associated with insulin resistance, diabetes, and cardiovascular disease. We investigated whether increasing IGFBP1 levels can prevent the development of these disorders. Metabolic and vascular phenotype were examined in response to human IGFBP1 overexpression in mice with diet-induced obesity, mice heterozygous for deletion of insulin receptors (IR+/−), and ApoE−/− mice. Direct effects of human (h)IGFBP1 on nitric oxide (NO) generation and cellular signaling were studied in isolated vessels and in human endothelial cells. IGFBP1 circulating levels were markedly suppressed in dietary-induced obese mice. Overexpression of hIGFBP1 in obese mice reduced blood pressure, improved insulin sensitivity, and increased insulin-stimulated NO generation. In nonobese IR+/− mice, overexpression of hIGFBP1 reduced blood pressure and improved insulin-stimulated NO generation. hIGFBP1 induced vasodilatation independently of IGF and increased endothelial NO synthase (eNOS) activity in arterial segments ex vivo, while in endothelial cells, hIGFBP1 increased eNOS Ser1177 phosphorylation via phosphatidylinositol 3-kinase signaling. Finally, in ApoE−/− mice, overexpression of hIGFBP1 reduced atherosclerosis. These favorable effects of hIGFBP1 on insulin sensitivity, blood pressure, NO production, and atherosclerosis suggest that increasing IGFBP1 concentration may be a novel approach to prevent cardiovascular disease in the setting of insulin resistance and diabetes.

Insulin resistance, obesity, and type 2 diabetes are associated with reduced bioavailability of endothelial nitric oxide (NO) and predisposition to atherosclerosis. Cardiovascular disease develops ∼15 years earlier in the presence of diabetes and accounts for the majority of deaths in these individuals (1). The current epidemic of diabetes (2) and the predicted increase in diabetes prevalence by the year 2030 (3) represent major challenges to global healthcare resources. Disappointing results from recent clinical trials investigating a strategy of intensive blood glucose control to reduce cardiovascular events argue for novel approaches to reduce cardiovascular risk in individuals with diabetes (4).

Insulin-like growth factor (IGF) binding proteins (IGFBPs) comprise a family of proteins that modulate IGF bioactivity through high-affinity binding (5). IGFBP1 is a 30 kDa circulating protein expressed predominantly in the liver that has been implicated in reproductive physiology and metabolic homeostasis (57). Both inhibitory and stimulatory effects of IGFBP1 on IGF bioactivity are recognized. In addition, in certain cell types, IGFBP1 regulates cellular actions independently of IGFs (8). Specifically, IGFBP1 modulates cell migration independently of IGF via an interaction of the Arg-Gly-Asp sequence in its COOH-terminal domain with cell surface integrin receptors (912). Under physiological conditions, insulin-mediated suppression of hepatic IGFBP1 production in response to nutritional cues confers dynamic regulation of IGF bioavailability (13). IGFBP1 has therefore been proposed as a player in glucose counterregulation and metabolic homeostasis (14,15). In cross-sectional studies, circulating IGFBP1 concentrations correlate with insulin sensitivity (1622), while in longitudinal studies, low circulating IGFBP1 concentrations predict the development of glucose intolerance and diabetes (23,24). In addition to these data supporting a role of IGFBP1 in metabolism, accumulating evidence suggests that IGFBP1 may contribute to cardiovascular pathophysiology. First, IGFBP1 concentrations are inversely associated with cardiovascular risk (16), carotid artery intima thickening (25), and overt macrovascular disease (26) in cross-sectional studies in humans. Second, we previously reported that transgenic (tg) overexpression of human IGFBP1 in mice was associated with increased vascular NO generation and lower blood pressure (27). Therefore, we hypothesized that low IGFBP1 levels may be permissive for the development of both metabolic diseases and related cardiovascular complications and that IGFBP1 could be a target for therapeutic manipulation.

Here, we investigated whether increasing IGFBP1 in mice subjected to obesity, insulin resistance, or atherosclerosis could ameliorate the development of overt metabolic and cardiovascular disease.

Mice and diet.

The tg mice overexpressing human (h)IGFBP1 (GenBank Accession Number NM_000596.2; transgene copy number ∼20) and generated as previously described (28) were backcrossed for a minimum of six generations on to a C57BL/6 background. Heterozygous hIGFBP1tg mice were used for experiments. Sequence similarity between human and murine IGFBP1 is 66%. However, because the NH2- and COOH-terminal domains of IGFBP1 (which participate in interactions with IGFs) remain highly conserved between species, hIGFBP1 is fully compatible with the murine-IGF axis (28). IR+/− mice were bred from a colony originally obtained from the Medical Research Council (Harwell, U.K.). IGF1Rfloxed mice were from Columbia University (New York, NY) and were crossed with Tie2-Cre tg mice (The Jackson Laboratory) for two to six generations to generate mice homozygous for the floxed allele and heterozygous for the Tie-2-Cre transgene. ApoE−/− mice were from a colony at our institution originally purchased from The Jackson Laboratory. Mice were housed in a conventional animal facility (12-h light/dark cycle) at constant temperature (22°C). Genotype was determined by PCR of ear samples. All mice were established on a C57BL/6 background or were backcrossed onto a C57BL/6 background for at least six generations. To avoid confounding by alterations in sex hormones, experiments were performed exclusively in male mice with littermates used as controls.

To induce obesity, mice received a high-fat/high-energy diet (F3282; Bio-Serv, Frenchtown, NJ) with the following composition: protein 20.5%, fat 36%, ash 3.5%, carbohydrate 35.7%, moisture <10%, and energy 5.49 kcal/g (60% of energy from fat). Control mice received standard rodent chow (BK001; Special Diets Services, Witham, Essex, U.K.) composed of protein 19.64%, fat 7.52%, ash 6.21%, moisture 10%, fiber 3.49%, nitrogen-free extract 54.90%, and energy 3.29 kcal/g. In accordance with our previous observation that diet F3282 rapidly induces an adverse cardiometabolic phenotype in mice (29), the diet was administered ad libitum from weaning for 8 weeks. Food intake was estimated by weighing food on a daily basis during the first 2 weeks of the feeding period. To induce atherosclerotic plaques, ApoE−/− mice received Western diet containing 21% pork fat and supplemented with 0.15% cholesterol (Special Diets Services). Animal experiments were approved by the ethical review committee at the University of Leeds and were performed in accordance with the Animals (Scientific Procedures) Act 1986.

Metabolic studies and plasma assays.

In glucose tolerance tests, mice were fasted overnight before injection with 1 mg/kg glucose i.p. For insulin tolerance tests, mice were fasted for 4 h before injection with 0.75 units/kg recombinant human insulin i.p. (Actrapid; Novo Nordisk). Blood glucose was measured with a portable glucometer. Plasma insulin was quantified by an ultrasensitive mouse ELISA kit (Crystal Chem, Downers Grove, IL), IGFBP1 was measured by an ELISA kit (Diagnostic Systems Laboratories, Webster, TX) that is unaffected by phosphorylation status and does not cross-react with other binding proteins, and IGF-I was quantified by a mouse/rat Quantikine ELISA kit (R&D Systems, Minneapolis, MN). Lipoprotein analyses were carried out in terminal blood samples using an automated analyzer in the Department of Clinical Chemistry, Leeds Teaching Hospitals National Health Service Trust, U.K.

Blood pressure measurement.

Blood pressure was measured by tail volume-pressure recording (CODA2; Kent Scientific, Torrington, CT) in conscious animals in a temperature-controlled restrainer as previously described (27,30,31). Animals were acclimatized to the restrainer during six training sessions before blood pressure measurement.

Obesity analysis.

Body mass was measured after 4 and 8 weeks of high-fat diet. Epididymal fat pads were weighed as a conventional measure of obesity in rodents. Samples of epididymal adipose tissue were fixed in 10% formalin and embedded in paraffin. Adipocyte area was calculated by hematoxylin-eosin stained sections as previously described (32)

Vasomotor studies.

Segments of thoracic aorta were suspended in physiological salt solution from strain gauge in an eight-chamber organ bath at 37°C as described (27,30,31). Dose-response curves were constructed (Chart V5.6, ADInstruments) for cumulative addition of phenylephrine after preincubation with insulin (100 mU/mL Actrapid; Novo Nordisk), hIGFBP1 (500 ng/mL with 1 mg/mL BSA carrier protein or BSA alone; Novozymes Biopharma AU Limited, Thebarton, Australia), IGF-I (100 nmol/L), NG-monomethyl-l-arginine (l-NMMA; 0.1 mmol/L), or LY294002 (10 μmol/L).

Cell culture.

Human umbilical vein endothelial cells (HUVECs) and human coronary artery endothelial cells (HCAECs) (PromoCell) were cultured in M199 medium supplemented with 20% FCS, 15 μg/mL endothelial cell growth factor, 1% l-glutamine, 20 mmol/L HEPES, 1 μmol/L sodium pyruvate, 5 units/mL heparin, 100 units/mL penicillin, 100 μg/mL streptomycin, and 25 μg/mL amphotericin and maintained in a humidified incubator with 5% CO2 at 37°C.

Immunoblotting and immunofluorescence microscopy.

Protein expression and phosphorylation status were analyzed in cell lysates or homogenized aorta by immunoblotting using the following antibodies: endothelial NO synthase (eNOS), Ser1177p-eNOS (BD Biosciences), Akt, Ser473p-Akt, GSK-3β, Ser21/9p-GSK-α/β (Cell Signaling Technology), and β-actin (Santa Cruz Biotechnology). All antibodies were used at 1:1,000 dilution with the exception of β-actin at 1:3,000. Horseradish peroxidase–conjugated secondary antibodies were visualized using an enhanced chemiluminescence kit (Pierce). For immunofluorescence, intact cells were fixed using 4% paraformaldehyde, permeabilized using 0.5% Triton X-100, blocked with fish-skin gelatin, and probed with primary anti-Ser1177 phospho-eNOS antibodies, using anti-mouse IgG (Invitrogen) for immunofluorescence detection. Slides were imaged under ×100 magnification (Olympus, Hamburg, Germany). Fluorescence intensity was estimated using CellB software (Version 3.0, Olympus Soft Imaging Solutions, Hamburg, Germany) by placing regions of interest within the cytoplasm of ∼100 cells per high-power field. Exposure times and number of cells counted were standardized across experiments.

eNOS activity.

A total of 0.5 μCi/mL 14C-arginine was added for 5 min to quiesced washed cells bathed in 0.25% HEPES-BSA, followed by hIGFBP1 (500 ng/mL) for 30 min. Chilled 5 mmol l-arginine per 4 mmol/L EDTA was used to stop the reaction, and cells were trypsinized, alcohol denatured, and centrifuged. Cell pellets were dissolved in 20 mmol/L HEPES-Na+ (pH 5.5) and soluble component separated by centrifuge. Equilibrated DOWEX resin was used to separate Arg from citrulline, with the latter then quantified by liquid-scintillation counting and normalized to total cell protein content.

Atherosclerosis.

ApoE−/− mice were crossed with hIGFBP1tg mice to generate ApoE−/− hIGFBP1tg mice. After attaining 20 g body mass, mice were fed Western diet for 12 weeks, which was shown in preliminary experiments to be optimal to induce atherosclerotic lesions (data not shown). Aortas were carefully excised after perfusion/fixation, opened longitudinally, fixed in paraformaldehyde overnight, and stained with Oil Red O. Washed aortas were opened and mounted en face and images digitally captured to allow quantification of plaque burden using Image-Pro software (version 7.0, Media Cybernetics). Paraffin-embedded sections of aortic sinus were stained with Miller stain, and plaque area was quantified by planimetry using Image-Pro software (version 7.0, Media Cybernetics). Necrotic core was quantified by planimetry of acellular regions of plaques covered by a fibrous cap. Fibrous cap thickness was quantified by measuring the mean thickness of plaques in each section.

IGFBP1 mRNA expression.

RNA was isolated from freshly harvested aorta or liver using Tri Reagent (Sigma-Aldrich). After DNAse treatment, 1 μg RNA was reverse transcribed using High Capacity RNA to cDNA kit. Real-time PCR was performed (Applied Biosystems) using SYBR Green PCR Master Mix and the following primers: human IGFBP: Forward: AGGCTCTCCATGTCACCAACA, Reverse: CTCCTGATGTCTCCTGTGCCTT; mouse IGFBP Forward: CAGAGATGACAGAGGAGCAGCT, Reverse: TGCTGCTATAGGTGCTGATGG. Results were normalized to expression of β-actin.

Statistical analysis.

Data are presented as mean ± SEM. Data were compared using Student t test, with the exception of aortic concentration-response curves, which were compared using two-way ANOVA followed by the application of post hoc Bonferroni test. P < 0.05 was considered significant.

Increasing hIGFBP1 concentrations improves insulin sensitivity in obesity.

To investigate whether increasing IGFBP1 levels can reverse the metabolic and vascular sequelae of obesity, we fed an obesogenic diet to mice overexpressing hIGFBP1. In control mice, obesity was associated with suppression of hepatic IGFBP1 mRNA expression (Fig. 1A) and a marked reduction in total circulating IGFBP1 concentration (Fig. 1B). As previously published, tg overexpression of hIGFBP1 in chow-fed animals results in a fivefold increase in circulating IGFBP1 concentration (28). In obesity, we found that tg overexpression of hIGFBP1 similarly increased plasma IGFBP1 concentration (Fig. 1C) without altering total plasma IGF-I (Fig. 1D). hIGFBP1tg mice developed a similar increase in body mass compared with wild-type (WT) littermates (Fig. 1E). Because constitutive overexpression of IGFBP1 has been reported to inhibit adipocyte expansion (33), we measured adipocyte diameter in epididymal fat depots after induction of obesity. In our mice, in which hIGFBP1 is expressed under the control of its native promoter and regulatory sequences, we found no effect on epididymal fat pad mass (28 ± 9 in WT vs. 34 ± 2 mg in tg mice; P = 0.47) or adipocyte cross-sectional area (Fig. 1F–I). Food intake was similar in hIGFBP1 mice and WT controls receiving the obesogenic diet (2.54 ± 0.07 vs. 2.57 ± 0.12 g/day; P = 0.85). hIGFBP1tg mice were at least partially protected from the metabolic consequences of obesity. Diet-induced obesity increased fasting blood glucose and induced glucose intolerance in WT animals; these effects were ameliorated in hIGFBP1tg mice (Fig. 2A). Insulin sensitivity, as indicated by an insulin tolerance test, was significantly enhanced in hIGFBP1tg animals (Fig. 2B). Plasma insulin concentrations were not significantly altered by IGFBP1 overexpression (Fig. 2C).

FIG. 1.

Diet-induced obesity and IGFBP1 expression and circulating plasma concentrations in C57BL/6 mice fed high-fat diet or chow (n = 8 per group). Hepatic murine IGFBP1 expression was quantified by real-time RT-PCR (A), and plasma concentrations were measured by enzyme-linked immunosorbent assay (ELISA) (B). *P < 0.02 vs. chow. C and D: Plasma IGFBP1 and IGF-I concentrations, measured using ELISA, in WT and hIGFBP1tg (TG) diet-induced obese mice (n = 8 per group). **P = 0.01 vs. WT. E: Body mass of WT and TG mice during induction of dietary obesity. FI: Representative sections of epididymal fat pads (magnification ×10) and distribution of adipocyte cross-sectional area in obese WT (F and H) and TG (G and I) mice (n = 8 per group). (A high-quality digital representation of this figure is available in the online issue.)

FIG. 1.

Diet-induced obesity and IGFBP1 expression and circulating plasma concentrations in C57BL/6 mice fed high-fat diet or chow (n = 8 per group). Hepatic murine IGFBP1 expression was quantified by real-time RT-PCR (A), and plasma concentrations were measured by enzyme-linked immunosorbent assay (ELISA) (B). *P < 0.02 vs. chow. C and D: Plasma IGFBP1 and IGF-I concentrations, measured using ELISA, in WT and hIGFBP1tg (TG) diet-induced obese mice (n = 8 per group). **P = 0.01 vs. WT. E: Body mass of WT and TG mice during induction of dietary obesity. FI: Representative sections of epididymal fat pads (magnification ×10) and distribution of adipocyte cross-sectional area in obese WT (F and H) and TG (G and I) mice (n = 8 per group). (A high-quality digital representation of this figure is available in the online issue.)

Close modal
FIG. 2.

hIGFBP overexpression improves whole-body and vascular insulin sensitivity in diet-induced obesity. A and B: Glucose and insulin tolerance test in fasted animals fed chow (lean) or high-fat diet (obese). A: Glucose tolerance test: obese hIGFBP1tg (TG) mice had lower fasting glucose concentrations than obese WT mice (6.3 ± 0.3 vs. 7.6 ± 0.6 mmol/L, P = 0.02) and were more glucose tolerant. Area under the curve: 1,287 ± 53 mmol/L per 120 min in obese TG vs. 1,645 ± 42 mmol/L per 120 min in obese WT mice (n = 8 per group). *P = 0.02. B: Insulin tolerance test: obese TG animals were more insulin sensitive than obese WT animals. Area under the curve: 753 ± 28 mmol/L per 120 min in obese TG vs. 926 ± 31 mmol/L per 120 min in obese WT mice (n = 8 per group). *P = 0.01. ○, obese WT; ●, obese TG; □, lean WT; ■, lean TG. C: Plasma insulin concentrations in fasting animals and repeated 30 min after injection of glucose (1 mg/g i.p.) (n = 8 per group). DF: Isometric tension studies in thoracic aorta from obese WT and TG mice (n = 8 per group). Phenylephrine (PE)-induced constriction was unaltered by insulin preincubation in WT mice (D) but was attenuated by insulin preincubation in TG mice (E). *P = 0.01 vs. WT two-way ANOVA. F: Relaxation of preconstricted aorta to acetylcholine (Ach) was unaltered. G: Ser phosphorylation of eNOS was quantified by immunoblotting of aorta harvested from diet-induced obese mice 15 min after injection of insulin (0.75 IU/kg i.p.) or vehicle. Ser1177 phospho-eNOS expression was normalized to expression of total eNOS and β-actin. *P < 0.05 for insulin-induced eNOS phosphorylation in TG mice vs. WT.

FIG. 2.

hIGFBP overexpression improves whole-body and vascular insulin sensitivity in diet-induced obesity. A and B: Glucose and insulin tolerance test in fasted animals fed chow (lean) or high-fat diet (obese). A: Glucose tolerance test: obese hIGFBP1tg (TG) mice had lower fasting glucose concentrations than obese WT mice (6.3 ± 0.3 vs. 7.6 ± 0.6 mmol/L, P = 0.02) and were more glucose tolerant. Area under the curve: 1,287 ± 53 mmol/L per 120 min in obese TG vs. 1,645 ± 42 mmol/L per 120 min in obese WT mice (n = 8 per group). *P = 0.02. B: Insulin tolerance test: obese TG animals were more insulin sensitive than obese WT animals. Area under the curve: 753 ± 28 mmol/L per 120 min in obese TG vs. 926 ± 31 mmol/L per 120 min in obese WT mice (n = 8 per group). *P = 0.01. ○, obese WT; ●, obese TG; □, lean WT; ■, lean TG. C: Plasma insulin concentrations in fasting animals and repeated 30 min after injection of glucose (1 mg/g i.p.) (n = 8 per group). DF: Isometric tension studies in thoracic aorta from obese WT and TG mice (n = 8 per group). Phenylephrine (PE)-induced constriction was unaltered by insulin preincubation in WT mice (D) but was attenuated by insulin preincubation in TG mice (E). *P = 0.01 vs. WT two-way ANOVA. F: Relaxation of preconstricted aorta to acetylcholine (Ach) was unaltered. G: Ser phosphorylation of eNOS was quantified by immunoblotting of aorta harvested from diet-induced obese mice 15 min after injection of insulin (0.75 IU/kg i.p.) or vehicle. Ser1177 phospho-eNOS expression was normalized to expression of total eNOS and β-actin. *P < 0.05 for insulin-induced eNOS phosphorylation in TG mice vs. WT.

Close modal

Increasing hIGFBP1 concentrations enhances vascular NO production and lowers blood pressure in obesity.

We next tested whether favorable effects on vascular function accompanied the protective effect of hIGFBP1 on glucose regulation in obesity. Impaired insulin-mediated NO production (34) is implicated in insulin resistance–associated vascular dysfunction. In nonobese mice, insulin induces a hypocontractile response to phenylephrine in aorta by enhancing NO generation (30,31). This effect was absent in aorta harvested from obese mice (Fig. 2D), consistent with vascular insulin resistance. Overexpression of hIGFBP1 restored hypocontractility to insulin in vessels from obese mice (Fig. 2E), indicating increased insulin-induced NO production in tg animals. Vasodilation of aorta to acetylcholine (Fig. 2F) or sodium nitroprusside (not shown) was unchanged. Insulin stimulates NO production via phosphorylation of eNOS at Ser residues (35). Aortic Ser1177 eNOS phosphorylation after insulin injection was significantly upregulated in hIGFBP1tg animals (Fig. 2G). hIGFBP1 overexpression ameliorated the increase in systolic blood pressure observed in WT obese animals (Table 1).

TABLE 1

hIGFBP1 overexpression lowers blood pressure in obese and insulin-resistant mice

hIGFBP1 overexpression lowers blood pressure in obese and insulin-resistant mice
hIGFBP1 overexpression lowers blood pressure in obese and insulin-resistant mice

Increasing hIGFBP1 concentrations enhances vascular NO production and lowers blood pressure in insulin resistance.

We next examined whether increasing hIGFBP1 improves vascular function in a nonobese model of insulin resistance. We crossed hIGFBP1tg mice with mice heterozygous for deletion of the insulin receptor (IR+/−). IR+/− mice have increased blood pressure and endothelial dysfunction despite maintaining normal glucose regulation through increased insulin secretion (31). Glucose tolerance and insulin sensitivity were unchanged when hIGFBP1 was overexpressed in IR+/− mice (Fig. 3A and B), but systolic blood pressure was increased (120 ± 3 vs. 102 ± 4 mmHg; P = 0.01). Overexpression of hIGFBP1 protected IR+/− mice from increased blood pressure (Table 1). Insulin did not alter the contractile response of aorta from IR+/− mice (Fig. 3C), in keeping with vascular insulin resistance. Overexpression of hIGFBP1 restored insulin-mediated hypocontractility (Fig. 3D), indicating that IGFBP1 reverses vascular insulin resistance. Vasodilatation to acetylcholine or sodium nitroprusside (data not shown) was unchanged by hIGFBP1 overexpression.

FIG. 3.

hIGFBP1 overexpression lowers blood pressure and enhances vascular insulin sensitivity in hemizygous insulin receptor null mice. A and B: Glucose and insulin tolerance tests. Blood glucose was measured at intervals after injection of glucose (1 mg/g i.p.) or insulin (0.75 IU/kg i.p.) in mice hemizygous for deletion of insulin receptors (IR+/−) and littermate IR+/− mice with tg overexpression of hIGFBP1 (IR+/−hIGFBP1tg) (n = 6–8 per group). There was no difference in the response to glucose tolerance test (area under the curve: 993 ± 42 vs. 840 ± 39 mmol/min/L) or insulin tolerance test (area under the curve: 513 ± 21 vs. 503 ± 18 mmol/min/L) between IR+/− and IR+/−hIGFBP1tg mice. C and D: Ex vivo isometric tension studies in thoracic aorta from IR+/− and IR+/−hIGFBP1tg mice (n = 6–8 per group). Phenylephrine (PE)-induced constriction was unaltered by insulin preincubation in IR+/− mice (C) but was attenuated by insulin preincubation in IR+/−IGFBP1tg mice (D). *P = 0.01 vs. IR+/− by two-way ANOVA.

FIG. 3.

hIGFBP1 overexpression lowers blood pressure and enhances vascular insulin sensitivity in hemizygous insulin receptor null mice. A and B: Glucose and insulin tolerance tests. Blood glucose was measured at intervals after injection of glucose (1 mg/g i.p.) or insulin (0.75 IU/kg i.p.) in mice hemizygous for deletion of insulin receptors (IR+/−) and littermate IR+/− mice with tg overexpression of hIGFBP1 (IR+/−hIGFBP1tg) (n = 6–8 per group). There was no difference in the response to glucose tolerance test (area under the curve: 993 ± 42 vs. 840 ± 39 mmol/min/L) or insulin tolerance test (area under the curve: 513 ± 21 vs. 503 ± 18 mmol/min/L) between IR+/− and IR+/−hIGFBP1tg mice. C and D: Ex vivo isometric tension studies in thoracic aorta from IR+/− and IR+/−hIGFBP1tg mice (n = 6–8 per group). Phenylephrine (PE)-induced constriction was unaltered by insulin preincubation in IR+/− mice (C) but was attenuated by insulin preincubation in IR+/−IGFBP1tg mice (D). *P = 0.01 vs. IR+/− by two-way ANOVA.

Close modal

hIGFBP1 increases endothelial NO production independently of IGF-I by stimulating eNOS phosphorylation via the phosphatidylinositol 3-kinase pathway.

To determine whether these phenotypes resulted from a direct effect of hIGFBP1, we carried out experiments in isolated segments of WT mouse aorta. Incubation of aorta with hIGFBP1 reduced contractility to phenylephrine (Fig. 4A). This was abolished by endothelial denudation (Fig. 4B) and coincubation with l-NMMA (Fig. 4C), indicating that hIGFBP1 stimulates endothelial NO generation. Coincubation with LY294022, an inhibitor of phosphatidylinositol 3-kinase (PI3K), abolished this response (Fig. 4D), indicating that PI3K activation is required for hIGFBP1-induced NO production. These effects were observed in a serum-free preparation, suggesting that hIGFBP1 stimulates vascular NO production independently of IGFs. To exclude a contribution from IGF contamination or local IGF secretion, we repeated our experiments in mice with endothelial-specific deletion of type 1 IGF receptors generated by crossing IGF1Rfloxed mice (36,37) with Tie2-Cre tg mice (36). As expected, aortas from these animals did not vasodilate in response to IGF-I (Fig. 4E). However, hIGFBP1 did reduce contractility to phenylephrine (Fig. 4F), reaffirming that hIGFBP1-induced NO generation is not mediated by type 1 IGF receptors.

FIG. 4.

hIGFBP1 induces vasodilatation by increasing NO bioavailability in isolated vessels. AD: Ex vivo isometric tension studies in thoracic aorta from WT mice (n = 6–8 per group). In A, phenylephrine (PE)-induced constriction was attenuated by preincubation with hIGFBP1 (500 ng/mL 2 h). *P = 0.02 vs. vehicle control containing 1 mg/mL BSA. This vasodilatory effect was blocked by mechanical removal of the endothelium (B) and by coincubation with the NO synthase inhibitor l-NMMA (0.1 mmol/L) (C) or the PI3K inhibitor LY294002 (10 μmol/L) (D). E and F: Isometric tension studies were repeated in aorta from mice with deletion of type 1 IGF receptors in endothelial cells (generated by crossing IGF1Rfloxed mice with Tie2-Cre tg mice) (n = 6 per group). PE-induced constriction was unaltered by incubation with IGF-I (100 nmol/L) (E) but was attenuated by incubation with hIGFBP1 (500 ng/mL) (F). *P = 0.01.

FIG. 4.

hIGFBP1 induces vasodilatation by increasing NO bioavailability in isolated vessels. AD: Ex vivo isometric tension studies in thoracic aorta from WT mice (n = 6–8 per group). In A, phenylephrine (PE)-induced constriction was attenuated by preincubation with hIGFBP1 (500 ng/mL 2 h). *P = 0.02 vs. vehicle control containing 1 mg/mL BSA. This vasodilatory effect was blocked by mechanical removal of the endothelium (B) and by coincubation with the NO synthase inhibitor l-NMMA (0.1 mmol/L) (C) or the PI3K inhibitor LY294002 (10 μmol/L) (D). E and F: Isometric tension studies were repeated in aorta from mice with deletion of type 1 IGF receptors in endothelial cells (generated by crossing IGF1Rfloxed mice with Tie2-Cre tg mice) (n = 6 per group). PE-induced constriction was unaltered by incubation with IGF-I (100 nmol/L) (E) but was attenuated by incubation with hIGFBP1 (500 ng/mL) (F). *P = 0.01.

Close modal

To confirm a direct effect of hIGFBP1 on endothelial NO production, we undertook experiments in primary human endothelial cells. hIGFBP1 induced concentration- and time-dependent eNOS Ser1177 phosphorylation in HCAECs (Fig. 5A–D). hIGFBP1 similarly stimulated dose-dependent Ser473 phosphorylation of Akt and Ser9 phosphorylation of its downstream substrate GSK-3β (Fig. 5E and F) but had no effect on total levels of expression of eNOS, Akt, or GSK-3β. hIGFBP1 induced Ser1177 eNOS phosphorylation in HUVECs (Fig. 5G–I), an effect blocked by coincubation with LY294022 (Fig. 5J). To confirm that the changes in eNOS phosphorylation resulted in changes in NO production, we demonstrated that hIGFBP1 stimulated LY294022-inhibitable eNOS activity in HUVECs (Fig. 5K).

FIG. 5.

hIGFBP1 increases eNOS activity in human endothelial cells by stimulating eNOS phosphorylation via a PI3K/Akt-mediated signaling pathway. AC: eNOS phosphorylation in HCAECs was assessed by immunoblotting (β-actin is shown as a loading control). hIGFBP1 induced dose-dependent (A) and time-dependent (B) Ser1177 eNOS phosphorylation, which was partially blocked by the PI3K inhibitor wortmannin (C). DF: Mean data for hIGFBP1-induced dose-dependent phosphorylation of eNOS, Akt, and GSK-3β, expressed as a ratio of the phosphorylated to nonphosphorylated form, each normalized for β-actin. *P < 0.03; **P < 0.05 vs. control. GJ: hIGFBP1-induced eNOS phosphorylation was confirmed in HUVECs with fluorescence microscopy using anti–phospho-Ser1177-eNOS antibodies. Representative untreated cells are shown in G, with hIGFBP1-stimulated cells shown in H. Mean fluorescence was increased by incubation with hIGFBP1 (500 ng/mL) (20.3 ± 1.9 fluorescence units vs. 16.4 ± 1.1 units in untreated [Con] cells, P = 0.03) (I). This was blocked by coincubation with LY294002 (10 μmol/L) (J). K: hIGFBP1 (500 ng/mL) increased eNOS activity in HUVECs by 46%. *P = 0.001 vs. control cells. This effect was blocked by coincubation with LY294002 (10 μmol/L). (A high-quality digital representation of this figure is available in the online issue.)

FIG. 5.

hIGFBP1 increases eNOS activity in human endothelial cells by stimulating eNOS phosphorylation via a PI3K/Akt-mediated signaling pathway. AC: eNOS phosphorylation in HCAECs was assessed by immunoblotting (β-actin is shown as a loading control). hIGFBP1 induced dose-dependent (A) and time-dependent (B) Ser1177 eNOS phosphorylation, which was partially blocked by the PI3K inhibitor wortmannin (C). DF: Mean data for hIGFBP1-induced dose-dependent phosphorylation of eNOS, Akt, and GSK-3β, expressed as a ratio of the phosphorylated to nonphosphorylated form, each normalized for β-actin. *P < 0.03; **P < 0.05 vs. control. GJ: hIGFBP1-induced eNOS phosphorylation was confirmed in HUVECs with fluorescence microscopy using anti–phospho-Ser1177-eNOS antibodies. Representative untreated cells are shown in G, with hIGFBP1-stimulated cells shown in H. Mean fluorescence was increased by incubation with hIGFBP1 (500 ng/mL) (20.3 ± 1.9 fluorescence units vs. 16.4 ± 1.1 units in untreated [Con] cells, P = 0.03) (I). This was blocked by coincubation with LY294002 (10 μmol/L) (J). K: hIGFBP1 (500 ng/mL) increased eNOS activity in HUVECs by 46%. *P = 0.001 vs. control cells. This effect was blocked by coincubation with LY294002 (10 μmol/L). (A high-quality digital representation of this figure is available in the online issue.)

Close modal

IGFBP1 overexpression reduces atherosclerosis.

Finally, we hypothesized that increasing IGFBP1 levels would result in protection from atherosclerosis. To address this, we crossed hIGFBP1tg mice with ApoE−/− mice. After feeding a Western-type diet for 12 weeks, plaque burden was significantly reduced in ApoE−/−IGFBP1tg mice, both in en face preparations of aorta (Fig. 6A and B) and in aortic sinus sections (Fig. 6C and D). Overexpression of hIGFBP1 did not affect plaque complexity as measured by analysis of necrotic core area (33.8 ± 3.7% in ApoE−/− vs. 29.1 ± 3.2% in ApoE−/−IGFBP1tg; P = 0.32) or fibrous cap thickness (36 ± 4 μm in ApoE−/− vs. 28 ± 4 μm in ApoE−/−IGFBP1tg; P = 0.17). There were no significant differences in plasma lipoprotein concentrations between ApoE−/−IGFBP1tg mice and ApoE−/− mice (Fig. 6E).

FIG. 6.

hIGFBP1 overexpression reduces atherosclerosis in ApoE-null mice. A: Representative images of Oil Red O–stained aorta demonstrating atherosclerotic lesions in ApoE−/− mice and ApoE−/−hIGFBP1tg mice (magnification ×200) (n = 7–15 per group). B: Mean aortic plaque area (expressed as percent of total vessel area) was significantly reduced in ApoE−/−hIGFBP1tg mice compared with ApoE−/− mice. *P < 0.001. C: Representative images of aortic sinus sections stained with Miller stain (magnification ×400) (n = 9–13 per group). D: Mean aortic sinus plaque area (expressed as percent of total sinus area) was significantly reduced in ApoE−/−hIGFBP1tg mice compared with ApoE−/− mice. **P < 0.05. E: Plasma total cholesterol (TC), LDL, HDL, and triglyceride concentrations were similar in ApoE−/− and ApoE−/−hIGFBP1tg mice. F: hIGFBP1 mRNA was readily detectable in aorta from ApoE−/−hIGFBP1tg mice but was undetectable in aorta from ApoE−/− mice, as expected. Murine (m)IGFBP1 mRNA was expressed at low levels in aorta from both ApoE−/− and ApoE−/−hIGFBP1tg mice. (A high-quality digital representation of this figure is available in the online issue.)

FIG. 6.

hIGFBP1 overexpression reduces atherosclerosis in ApoE-null mice. A: Representative images of Oil Red O–stained aorta demonstrating atherosclerotic lesions in ApoE−/− mice and ApoE−/−hIGFBP1tg mice (magnification ×200) (n = 7–15 per group). B: Mean aortic plaque area (expressed as percent of total vessel area) was significantly reduced in ApoE−/−hIGFBP1tg mice compared with ApoE−/− mice. *P < 0.001. C: Representative images of aortic sinus sections stained with Miller stain (magnification ×400) (n = 9–13 per group). D: Mean aortic sinus plaque area (expressed as percent of total sinus area) was significantly reduced in ApoE−/−hIGFBP1tg mice compared with ApoE−/− mice. **P < 0.05. E: Plasma total cholesterol (TC), LDL, HDL, and triglyceride concentrations were similar in ApoE−/− and ApoE−/−hIGFBP1tg mice. F: hIGFBP1 mRNA was readily detectable in aorta from ApoE−/−hIGFBP1tg mice but was undetectable in aorta from ApoE−/− mice, as expected. Murine (m)IGFBP1 mRNA was expressed at low levels in aorta from both ApoE−/− and ApoE−/−hIGFBP1tg mice. (A high-quality digital representation of this figure is available in the online issue.)

Close modal

To ascertain whether IGFBP1 is expressed in the vascular wall, we carried out real-time PCR to assess expression of IGFBP1 in atherosclerotic aorta. Murine IGFBP1 expression was detectable at low levels in the aorta of ApoE−/− and ApoE−/−IGFBP1tg mice (Fig. 6F). hIGFBP1 was detectable only in aorta from hIGFBP1tg mice (Fig. 6F), as expected.

During the past 2 decades, a series of epidemiological studies has linked low circulating IGFBP1 concentrations with insulin resistance, type 2 diabetes, and cardiovascular disease. We previously demonstrated that hIGFBP1 overexpression increased vascular NO generation in mice (27), suggesting that low IGFBP1 concentrations may play a mechanistic role in vascular pathophysiology. However, whether the effects of IGFBP1 on the vascular endothelium were direct or indirect, and whether increasing IGFBP1 concentrations could be of therapeutic potential in preventing disease, was unknown. In this study, we demonstrate for the first time, using a series of mouse models, that elevating IGFBP1 levels improves whole-body insulin sensitivity and glucose tolerance, lowers blood pressure, enhances vascular NO production, and reduces susceptibility to atherosclerosis.

A critical novel finding of the current study is that hIGFBP1 has a direct effect on vascular endothelium, resulting in increased NO generation. Mechanistically, although the proximal signaling steps are yet to be elucidated, we have shown that hIGFBP1 stimulates dose-dependent NO production in isolated murine vessels and in primary human endothelial cells. hIGFBP1-stimulated NO generation is mediated by activation of the PI3K/Akt signaling pathway, resulting in Ser phosphorylation of eNOS (Fig. 7). This mirrors the pathway by which insulin and growth factors stimulate NO generation in endothelial cells (38). hIGFBP1 overexpression did not alter arterial responses to acetylcholine, suggesting that calcium/calmodulin-mediated activation of eNOS is not affected by IGFBP1. It is important to note that hIGFBP1-induced NO production was demonstrated in the absence of IGF-I and in vessels in which endothelial type 1 IGF receptors were deleted. Although IGFBP1 has been shown to directly modulate cell migration in other cell types (912), this is the first time that IGFBP1 has been demonstrated to act independently of IGFs as a vasoactive molecule in its own right in cells of the vascular wall. Our findings parallel the recent observation that IGFBP3, another member of the IGFBP family, can affect vascular pathophysiology by modulation of NO (39). Although hepatic IGFBP1 production accounts for the majority of circulating IGFBP1, we found expression of both the native murine transcript and the human transgene in the vascular wall. Because IGFBP1 is known to be expressed in human atherectomy specimens (40), though, interestingly, not in primary culture of human vascular smooth muscle (41), our findings raise the possibility that increased local expression of hIGFBP1 as well as increased concentrations of hIGFBP1 in the circulation may contribute to the vascular phenotypes we observed. While other potential contributory factors cannot be excluded, it is tempting to speculate that increased NO generation promoted by elevated circulating IGFBP1 concentrations, or enhanced insulin-induced vascular hypocontractility, accounted for the reduction in blood pressure we observed. It is noteworthy that the plasma concentrations of IGFBP1 achieved through tg overexpression in our obesity model, which were similar to those recorded in insulin-resistant humans (18,19), remained lower than the circulating levels in nonobese WT mice. This suggests that a modest increase in IGFBP1 is sufficient to generate a favorable phenotypic effect.

FIG. 7.

Schematic of proposed effects of IGFBP1 on vascular endothelial cells. IGFBP1 forms high-affinity complexes with circulating IGFs in the circulation (1) and confers dynamic regulation of IGF-I activity at the type 1 IGF receptor (2). IGF-I acts in a similar manner to insulin in endothelial cells, stimulating NO generation by activating the PI3K/Akt signaling pathway (4). In the current study, we have demonstrated that IGFBP1, which is expressed in the vascular wall as well as present in the circulation, stimulates NO production independently of IGF and the type 1 IGF receptor. Although the receptor for IGFBP1 (6) and the proximal signaling intermediaries are yet to be identified, IGFBP1-stimulated NO production is also mediated through the PI3K/Akt pathway, culminating in phosphorylation of eNOS (7) and an increase in NOS activity. In addition to direct effects on endothelial cells, IGFBP1 also enhances insulin sensitivity in endothelial cells potentially by upregulating signaling via the insulin receptor (8). It is likely that this is a chronic effect, considering that we observed enhanced insulin signaling in isolated vessels ex vivo in the absence of hIGFBP1. Enhanced NO bioavailability may contribute to the lower blood pressure, reduced atherosclerosis, and improved insulin sensitivity we observed in hIGFBP1-overexpressing mice. It is also possible that IGFBP1 improves whole-body insulin sensitivity by stimulating the PI3K/Akt pathway in canonical insulin-sensitive tissues. IRS, insulin receptor substrate.

FIG. 7.

Schematic of proposed effects of IGFBP1 on vascular endothelial cells. IGFBP1 forms high-affinity complexes with circulating IGFs in the circulation (1) and confers dynamic regulation of IGF-I activity at the type 1 IGF receptor (2). IGF-I acts in a similar manner to insulin in endothelial cells, stimulating NO generation by activating the PI3K/Akt signaling pathway (4). In the current study, we have demonstrated that IGFBP1, which is expressed in the vascular wall as well as present in the circulation, stimulates NO production independently of IGF and the type 1 IGF receptor. Although the receptor for IGFBP1 (6) and the proximal signaling intermediaries are yet to be identified, IGFBP1-stimulated NO production is also mediated through the PI3K/Akt pathway, culminating in phosphorylation of eNOS (7) and an increase in NOS activity. In addition to direct effects on endothelial cells, IGFBP1 also enhances insulin sensitivity in endothelial cells potentially by upregulating signaling via the insulin receptor (8). It is likely that this is a chronic effect, considering that we observed enhanced insulin signaling in isolated vessels ex vivo in the absence of hIGFBP1. Enhanced NO bioavailability may contribute to the lower blood pressure, reduced atherosclerosis, and improved insulin sensitivity we observed in hIGFBP1-overexpressing mice. It is also possible that IGFBP1 improves whole-body insulin sensitivity by stimulating the PI3K/Akt pathway in canonical insulin-sensitive tissues. IRS, insulin receptor substrate.

Close modal

The contribution of IGFBP1 to glucose regulation has previously been attributed to modulation of IGF-I bioavailability (7). Our observations, however, indicate that hIGFBP1 functions as an insulin-sensitizing peptide per se. In contrast to our findings with hIGFBP2 (32), hIGFBP1 overexpression improved whole-body insulin sensitivity and reduced glucose intolerance in the setting of obesity in the absence of change in body weight or fat cell size. hIGFBP1 overexpression did not affect glucose regulation in our model of genetic insulin resistance (IR+/− mice). However, whole-body glucose homeostasis is relatively preserved in this model, in which we have demonstrated that insulin receptor deletion has a disproportionately greater effect on endothelial insulin sensitivity than on whole-body insulin sensitivity (31). In contrast, enhanced endothelial sensitivity to insulin, a critical determinant of vascular homeostasis (42), was demonstrated in both hIGFBP1tg obese mice and genetically insulin-resistant mice, in which overexpression of hIGFBP1 enhanced insulin-induced arterial relaxation and eNOS phosphorylation. Because IGFBP1 was not present in the organ bath salt solution, these enhanced vascular responses to insulin observed in murine vessels are likely to result from chronic exposure to increased IGFBP1 concentrations in vivo (Fig. 7). Defining the mechanistic basis for the insulin sensitization we observed is beyond the focus of this investigation. However, one can speculate that enhanced insulin-mediated NO generation may have contributed to the improvement in systemic insulin sensitivity (43) or that higher circulating IGFBP1 levels may have upregulated insulin signaling in metabolically active tissues in a similar manner to that we observed in the endothelium. Despite the systemic insulin sensitization we demonstrated in hIGFBP1-overexpressing nutritionally obese mice, it is noteworthy that plasma insulin concentrations were not lower in tg mice than in controls. This may be attributable to a direct effect of hIGFBP1 overexpression on pancreatic insulin secretion, considering that IGFBP1 has been shown to amplify glucose-stimulated insulin secretion in intact islets (44).

The favorable metabolic phenotypes of hIGFBP1 overexpression observed here are discordant with other murine models in which IGFBP1 was overexpressed under the control of heterologous promoters (45,46). Differences in tissue restriction of expression or absolute plasma IGFBP1 concentrations achieved may explain this discrepancy. Alternatively, it is possible that maintained responsiveness of IGFBP1 to nutritional cues, allowing dynamic regulation of plasma levels (achieved in our mouse but using the native promoter sequence to drive transgene expression), is required. It is intriguing that mice with knockout of IGFBP1 do not have any short-term major metabolic dysfunction (47), implying other factors can compensate for the lack of IGFBP1. Effects of IGFBP1 deletion on vascular function and long-term metabolism have not been studied.

The robust effect of IGFBP1 overexpression we observed on atherosclerotic plaque development in ApoE−/− mice was striking. It is tempting to speculate that the inhibition of atherosclerosis we observed in ApoE−/− mice overexpressing hIGFBP1 is attributable to enhanced NO bioavailability as a result of upregulation of Akt-mediated eNOS phosphorylation. Certainly, the evidence that Akt signaling and eNOS-derived NO play fundamental roles in atherosclerosis is compelling (48,49). However, we cannot exclude the possibility that other factors may have contributed to the reduced atherosclerosis we observed in hIGFBP1tg mice.

Although our observations of increased NO generation, reduced blood pressure, and reduced atherosclerotic plaque in IGFBP1tg mice are in keeping with the inverse associations between IGFBP1 and cardiovascular disease demonstrated in cross-sectional studies, we acknowledge that not all human data support a favorable association between IGFBP1 concentrations and cardiovascular risk. Specifically, high circulating concentrations of IGFBP1 have been linked with the development of heart failure in the elderly (50) and with an adverse prognosis after myocardial infarction (51,52). Associated changes in COOH-terminal provasopressin (copeptin) may explain the apparent prognostic importance of IGFBP1 concentrations highlighted in these trials (53); however, further studies of the molecular effects of IGFBP1 in these clinical scenarios are clearly warranted.

In conclusion, our findings demonstrate that hIGFBP1 has insulin-sensitizing, blood pressure–lowering, and antiatherosclerotic properties. We have identified a novel function of hIGFBP1 as a vasomodulatory molecule in its own right, here acting as a regulator of endothelial NO production independent of the type 1 IGF receptor by activating the PI3K/Akt/phospho-eNOS pathway. Our observations have significant clinical implications, raising the possibility that enhancing IGFBP1 levels may be a therapeutic option to protect individuals from insulin resistance, hypertension, and atherosclerosis.

This work was funded by the British Heart Foundation and supported in part through a Yorkshire Enterprise Fellowship for S.B.W.; S.B.W. is a British Heart Foundation Intermediate Clinical Research Fellow. A.R., V.E., E.R.D., R.M.C., M.B.K., A.Ab., and A.Az. held British Heart Foundation Clinical Research Training Fellowships. A.M.S. is a British Heart Foundation Professor of Cardiology.

No potential conflicts of interest relevant to this article were reported.

A.R. and M.B.K. prepared the manuscript and performed the in vitro and in vivo experiments. V.E., J.S., N.Y.Y., E.R.D., M.G., H.I., A.Ab., H.V., A.Az., and P.S. performed in vitro and in vivo experiments. A.V.-P., P.J.G., and K.E.P. supervised the project. R.M.C. and J.K.S. critically reviewed the manuscript. S.X. generated the IGF1Rfloxed mouse. A.M.S. and M.T.K. conceived the study, secured funding, designed the experiments, and supervised the project. S.B.W. conceived the study, secured funding, designed the experiments, supervised the project, and prepared the manuscript. S.B.W. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

1.
Booth
GL
,
Kapral
MK
,
Fung
K
,
Tu
JV
.
Relation between age and cardiovascular disease in men and women with diabetes compared with non-diabetic people: a population-based retrospective cohort study
.
Lancet
2006
;
368
:
29
36
[PubMed]
2.
Danaei
G
,
Finucane
MM
,
Lu
Y
, et al
;
Global Burden of Metabolic Risk Factors of Chronic Diseases Collaborating Group (Blood Glucose)
.
National, regional, and global trends in fasting plasma glucose and diabetes prevalence since 1980: systematic analysis of health examination surveys and epidemiological studies with 370 country-years and 2.7 million participants
.
Lancet
2011
;
378
:
31
40
[PubMed]
3.
Shaw
JE
,
Sicree
RA
,
Zimmet
PZ
.
Global estimates of the prevalence of diabetes for 2010 and 2030
.
Diabetes Res Clin Pract
2010
;
87
:
4
14
[PubMed]
4.
Tahrani
AA
,
Bailey
CJ
,
Del Prato
S
,
Barnett
AH
.
Management of type 2 diabetes: new and future developments in treatment
.
Lancet
2011
;
378
:
182
197
[PubMed]
5.
Kelley
KM
,
Oh
Y
,
Gargosky
SE
, et al
.
Insulin-like growth factor-binding proteins (IGFBPs) and their regulatory dynamics
.
Int J Biochem Cell Biol
1996
;
28
:
619
637
[PubMed]
6.
Baxter
RC
.
Insulin-like growth factor binding proteins in the human circulation: a review
.
Horm Res
1994
;
42
:
140
144
[PubMed]
7.
Lee
PD
,
Giudice
LC
,
Conover
CA
,
Powell
DR
.
Insulin-like growth factor binding protein-1: recent findings and new directions
.
Proc Soc Exp Biol Med
1997
;
216
:
319
357
[PubMed]
8.
Wheatcroft
SB
,
Kearney
MT
.
IGF-dependent and IGF-independent actions of IGF-binding protein-1 and -2: implications for metabolic homeostasis
.
Trends Endocrinol Metab
2009
;
20
:
153
162
[PubMed]
9.
Chesik
D
,
De Keyser
J
,
Bron
R
,
Fuhler
GM
.
Insulin-like growth factor binding protein-1 activates integrin-mediated intracellular signaling and migration in oligodendrocytes
.
J Neurochem
2010
;
113
:
1319
1330
[PubMed]
10.
Gleeson
LM
,
Chakraborty
C
,
McKinnon
T
,
Lala
PK
.
Insulin-like growth factor-binding protein 1 stimulates human trophoblast migration by signaling through alpha 5 beta 1 integrin via mitogen-activated protein kinase pathway
.
J Clin Endocrinol Metab
2001
;
86
:
2484
2493
[PubMed]
11.
Jones
JI
,
Gockerman
A
,
Busby
WH
 Jr
,
Wright
G
,
Clemmons
DR
.
Insulin-like growth factor binding protein 1 stimulates cell migration and binds to the alpha 5 beta 1 integrin by means of its Arg-Gly-Asp sequence
.
Proc Natl Acad Sci U S A
1993
;
90
:
10553
10557
[PubMed]
12.
Perks
CM
,
Newcomb
PV
,
Norman
MR
,
Holly
JM
.
Effect of insulin-like growth factor binding protein-1 on integrin signalling and the induction of apoptosis in human breast cancer cells
.
J Mol Endocrinol
1999
;
22
:
141
150
[PubMed]
13.
Brismar
K
,
Fernqvist-Forbes
E
,
Wahren
J
,
Hall
K
.
Effect of insulin on the hepatic production of insulin-like growth factor-binding protein-1 (IGFBP-1), IGFBP-3, and IGF-I in insulin-dependent diabetes
.
J Clin Endocrinol Metab
1994
;
79
:
872
878
[PubMed]
14.
Lewitt
MS
,
Denyer
GS
,
Cooney
GJ
,
Baxter
RC
.
Insulin-like growth factor-binding protein-1 modulates blood glucose levels
.
Endocrinology
1991
;
129
:
2254
2256
[PubMed]
15.
Yki-Järvinen
H
,
Mäkimattila
S
,
Utriainen
T
,
Rutanen
EM
.
Portal insulin concentrations rather than insulin sensitivity regulate serum sex hormone-binding globulin and insulin-like growth factor binding protein 1 in vivo
.
J Clin Endocrinol Metab
1995
;
80
:
3227
3232
[PubMed]
16.
Heald
AH
,
Cruickshank
JK
,
Riste
LK
, et al
.
Close relation of fasting insulin-like growth factor binding protein-1 (IGFBP-1) with glucose tolerance and cardiovascular risk in two populations
.
Diabetologia
2001
;
44
:
333
339
[PubMed]
17.
Liew
CF
,
Wise
SD
,
Yeo
KP
,
Lee
KO
.
Insulin-like growth factor binding protein-1 is independently affected by ethnicity, insulin sensitivity, and leptin in healthy, glucose-tolerant young men
.
J Clin Endocrinol Metab
2005
;
90
:
1483
1488
[PubMed]
18.
Maddux
BA
,
Chan
A
,
De Filippis
EA
,
Mandarino
LJ
,
Goldfine
ID
.
IGF-binding protein-1 levels are related to insulin-mediated glucose disposal and are a potential serum marker of insulin resistance [corrected in: Diabetes Care 2006;29:2571]
.
Diabetes Care
2006
;
29
:
1535
1537
[PubMed]
19.
Mohamed-Ali
V
,
Pinkney
JH
,
Panahloo
A
,
Cwyfan-Hughes
S
,
Holly
JM
,
Yudkin
JS
.
Insulin-like growth factor binding protein-1 in NIDDM: relationship with the insulin resistance syndrome
.
Clin Endocrinol (Oxf)
1999
;
50
:
221
228
[PubMed]
20.
Rajpathak
SN
,
McGinn
AP
,
Strickler
HD
, et al
.
Insulin-like growth factor-(IGF)-axis, inflammation, and glucose intolerance among older adults
.
Growth Horm IGF Res
2008
;
18
:
166
173
[PubMed]
21.
Travers
SH
,
Labarta
JI
,
Gargosky
SE
,
Rosenfeld
RG
,
Jeffers
BW
,
Eckel
RH
.
Insulin-like growth factor binding protein-I levels are strongly associated with insulin sensitivity and obesity in early pubertal children
.
J Clin Endocrinol Metab
1998
;
83
:
1935
1939
[PubMed]
22.
Yeap
BB
,
Chubb
SA
,
Ho
KK
, et al
.
IGF1 and its binding proteins 3 and 1 are differentially associated with metabolic syndrome in older men
.
Eur J Endocrinol
2010
;
162
:
249
257
[PubMed]
23.
Lewitt
MS
,
Hilding
A
,
Ostenson
CG
,
Efendic
S
,
Brismar
K
,
Hall
K
.
Insulin-like growth factor-binding protein-1 in the prediction and development of type 2 diabetes in middle-aged Swedish men
.
Diabetologia
2008
;
51
:
1135
1145
[PubMed]
24.
Sandhu
MS
,
Heald
AH
,
Gibson
JM
,
Cruickshank
JK
,
Dunger
DB
,
Wareham
NJ
.
Circulating concentrations of insulin-like growth factor-I and development of glucose intolerance: a prospective observational study
.
Lancet
2002
;
359
:
1740
1745
[PubMed]
25.
Leinonen
ES
,
Salonen
JT
,
Salonen
RM
, et al
.
Reduced IGFBP-1 is associated with thickening of the carotid wall in type 2 diabetes
.
Diabetes Care
2002
;
25
:
1807
1812
[PubMed]
26.
Heald
AH
,
Siddals
KW
,
Fraser
W
, et al
.
Low circulating levels of insulin-like growth factor binding protein-1 (IGFBP-1) are closely associated with the presence of macrovascular disease and hypertension in type 2 diabetes
.
Diabetes
2002
;
51
:
2629
2636
[PubMed]
27.
Wheatcroft
SB
,
Kearney
MT
,
Shah
AM
, et al
.
Vascular endothelial function and blood pressure homeostasis in mice overexpressing IGF binding protein-1
.
Diabetes
2003
;
52
:
2075
2082
[PubMed]
28.
Crossey
PA
,
Jones
JS
,
Miell
JP
.
Dysregulation of the insulin/IGF binding protein-1 axis in transgenic mice is associated with hyperinsulinemia and glucose intolerance
.
Diabetes
2000
;
49
:
457
465
[PubMed]
29.
Noronha
BT
,
Li
JM
,
Wheatcroft
SB
,
Shah
AM
,
Kearney
MT
.
Inducible nitric oxide synthase has divergent effects on vascular and metabolic function in obesity
.
Diabetes
2005
;
54
:
1082
1089
[PubMed]
30.
Duncan
ER
,
Walker
SJ
,
Ezzat
VA
, et al
.
Accelerated endothelial dysfunction in mild prediabetic insulin resistance: the early role of reactive oxygen species
.
Am J Physiol Endocrinol Metab
2007
;
293
:
E1311
E1319
[PubMed]
31.
Wheatcroft
SB
,
Shah
AM
,
Li
JM
, et al
.
Preserved glucoregulation but attenuation of the vascular actions of insulin in mice heterozygous for knockout of the insulin receptor
.
Diabetes
2004
;
53
:
2645
2652
[PubMed]
32.
Wheatcroft
SB
,
Kearney
MT
,
Shah
AM
, et al
.
IGF-binding protein-2 protects against the development of obesity and insulin resistance
.
Diabetes
2007
;
56
:
285
294
[PubMed]
33.
Rajkumar
K
,
Modric
T
,
Murphy
LJ
.
Impaired adipogenesis in insulin-like growth factor binding protein-1 transgenic mice
.
J Endocrinol
1999
;
162
:
457
465
[PubMed]
34.
Zeng
G
,
Quon
MJ
.
Insulin-stimulated production of nitric oxide is inhibited by wortmannin. Direct measurement in vascular endothelial cells
.
J Clin Invest
1996
;
98
:
894
898
[PubMed]
35.
Montagnani
M
,
Chen
H
,
Barr
VA
,
Quon
MJ
.
Insulin-stimulated activation of eNOS is independent of Ca2+ but requires phosphorylation by Akt at Ser(1179)
.
J Biol Chem
2001
;
276
:
30392
30398
[PubMed]
36.
Abbas
A
,
Imrie
H
,
Viswambharan
H
, et al
.
The insulin-like growth factor-1 receptor is a negative regulator of nitric oxide bioavailability and insulin sensitivity in the endothelium
.
Diabetes
2011
;
60
:
2169
2178
[PubMed]
37.
Kido
Y
,
Nakae
J
,
Hribal
ML
,
Xuan
S
,
Efstratiadis
A
,
Accili
D
.
Effects of mutations in the insulin-like growth factor signaling system on embryonic pancreas development and beta-cell compensation to insulin resistance
.
J Biol Chem
2002
;
277
:
36740
36747
[PubMed]
38.
Wang
Y
,
Nagase
S
,
Koyama
A
.
Stimulatory effect of IGF-I and VEGF on eNOS message, protein expression, eNOS phosphorylation and nitric oxide production in rat glomeruli, and the involvement of PI3-K signaling pathway
.
Nitric Oxide
2004
;
10
:
25
35
[PubMed]
39.
Kielczewski
JL
,
Jarajapu
YP
,
McFarland
EL
, et al
.
Insulin-like growth factor binding protein-3 mediates vascular repair by enhancing nitric oxide generation
.
Circ Res
2009
;
105
:
897
905
[PubMed]
40.
Grant
MB
,
Wargovich
TJ
,
Ellis
EA
, et al
.
Expression of IGF-I, IGF-I receptor and IGF binding proteins-1, -2, -3, -4 and -5 in human atherectomy specimens
.
Regul Pept
1996
;
67
:
137
144
[PubMed]
41.
Patel
VA
,
Zhang
QJ
,
Siddle
K
, et al
.
Defect in insulin-like growth factor-1 survival mechanism in atherosclerotic plaque-derived vascular smooth muscle cells is mediated by reduced surface binding and signaling
.
Circ Res
2001
;
88
:
895
902
[PubMed]
42.
Duncan
ER
,
Crossey
PA
,
Walker
S
, et al
.
Effect of endothelium-specific insulin resistance on endothelial function in vivo [corrected in: Diabetes 2009;58:511]
.
Diabetes
2008
;
57
:
3307
3314
[PubMed]
43.
Kim
JA
,
Montagnani
M
,
Koh
KK
,
Quon
MJ
.
Reciprocal relationships between insulin resistance and endothelial dysfunction: molecular and pathophysiological mechanisms
.
Circulation
2006
;
113
:
1888
1904
[PubMed]
44.
Zhang
F
,
Sjöholm
K
,
Zhang
Q
.
Attenuation of insulin secretion by insulin-like growth factor binding protein-1 in pancreatic beta-cells
.
Biochem Biophys Res Commun
2007
;
362
:
152
157
[PubMed]
45.
Dai
Z
,
Xing
Y
,
Boney
CM
,
Clemmons
DR
,
D’Ercole
AJ
.
Human insulin-like growth factor-binding protein-1 (hIGFBP-1) in transgenic mice: characterization and insights into the regulation of IGFBP-1 expression
.
Endocrinology
1994
;
135
:
1316
1327
[PubMed]
46.
Rajkumar
K
,
Krsek
M
,
Dheen
ST
,
Murphy
LJ
.
Impaired glucose homeostasis in insulin-like growth factor binding protein-1 transgenic mice
.
J Clin Invest
1996
;
98
:
1818
1825
[PubMed]
47.
Leu
JI
,
Crissey
MA
,
Craig
LE
,
Taub
R
.
Impaired hepatocyte DNA synthetic response posthepatectomy in insulin-like growth factor binding protein 1-deficient mice with defects in C/EBP beta and mitogen-activated protein kinase/extracellular signal-regulated kinase regulation
.
Mol Cell Biol
2003
;
23
:
1251
1259
[PubMed]
48.
Fernández-Hernando
C
,
Ackah
E
,
Yu
J
, et al
.
Loss of Akt1 leads to severe atherosclerosis and occlusive coronary artery disease
.
Cell Metab
2007
;
6
:
446
457
[PubMed]
49.
Kuhlencordt
PJ
,
Gyurko
R
,
Han
F
, et al
.
Accelerated atherosclerosis, aortic aneurysm formation, and ischemic heart disease in apolipoprotein E/endothelial nitric oxide synthase double-knockout mice
.
Circulation
2001
;
104
:
448
454
[PubMed]
50.
Kaplan
RC
,
McGinn
AP
,
Pollak
MN
, et al
.
High insulinlike growth factor binding protein 1 level predicts incident congestive heart failure in the elderly
.
Am Heart J
2008
;
155
:
1006
1012
[PubMed]
51.
Janszky
I
,
Hallqvist
J
,
Ljung
R
,
Hammar
N
.
Insulin-like growth factor binding protein-1 is a long-term predictor of heart failure in survivors of a first acute myocardial infarction and population controls
.
Int J Cardiol
2010
;
138
:
50
55
[PubMed]
52.
Wallander
M
,
Norhammar
A
,
Malmberg
K
,
Ohrvik
J
,
Rydén
L
,
Brismar
K
.
IGF binding protein 1 predicts cardiovascular morbidity and mortality in patients with acute myocardial infarction and type 2 diabetes
.
Diabetes Care
2007
;
30
:
2343
2348
[PubMed]
53.
Mellbin
LG
,
Rydén
L
,
Brismar
K
,
Morgenthaler
NG
,
Ohrvik
J
,
Catrina
SB
.
Copeptin, IGFBP-1, and cardiovascular prognosis in patients with type 2 diabetes and acute myocardial infarction: a report from the DIGAMI 2 trial
.
Diabetes Care
2010
;
33
:
1604
1606
[PubMed]