There is an increasing worldwide epidemic of type 2 diabetes that poses major health problems. We have identified a novel physiological system that increases glucose uptake in skeletal muscle but not in white adipocytes. Activation of this system improves glucose tolerance in Goto-Kakizaki rats or mice fed a high-fat diet, which are established models for type 2 diabetes. The pathway involves activation of β2-adrenoceptors that increase cAMP levels and activate cAMP-dependent protein kinase, which phosphorylates mammalian target of rapamycin complex 2 (mTORC2) at S2481. The active mTORC2 causes translocation of GLUT4 to the plasma membrane and glucose uptake without the involvement of Akt or AS160. Stimulation of glucose uptake into skeletal muscle after activation of the sympathetic nervous system is likely to be of high physiological relevance because mTORC2 activation was observed at the cellular, tissue, and whole-animal level in rodent and human systems. This signaling pathway provides new opportunities for the treatment of type 2 diabetes.

The marked increase in type 2 diabetes worldwide (1) emphasizes the importance of novel treatments that rectify glucose homeostasis. Ideally, this involves signaling pathways that are not dependent on insulin. Although activation of adrenoceptors in vitro has been shown to stimulate glucose uptake in skeletal muscle (210), the signaling pathways involved and the potential for treating type 2 diabetes have been unclear. In vivo, sympathetic effects on glucose homeostasis are complex, being influenced by glucose outflow from the liver, insulin release from the pancreas, as well as glucose uptake into peripheral tissues such as white fat, brown fat, and muscle. Long-term activation of β2-adrenoceptors in rats causes skeletal muscle hypertrophy (11), leading to decreased plasma insulin levels, increased insulin sensitivity, and improved glucose tolerance (12,13); in humans, there are beneficial metabolic changes (14,15), although some β-blockers exacerbate diabetes (16). Despite this circumstantial evidence (210), the mechanisms involved in adrenergic facilitation of glucose uptake in peripheral tissues and their potential therapeutic role are poorly understood.

Skeletal muscle is the most important organ in the body for glucose clearance and utilization (17). High sympathetic nervous system activity (e.g., exercise, fight, or flight) is associated with enhanced glucose uptake into skeletal muscle, resulting primarily from norepinephrine release from adrenergic nerve terminals (18). Catecholamines released during sympathetic activation stimulate adrenoceptors at the cell surface. Mechanisms that have been proposed to explain adrenergically mediated glucose uptake include stimulation of the transcription and translation of proteins, non–carrier mediated and unspecific effects, and translocation or activation of GLUTs (10,19,20), emphasizing the lack of a unifying concept for the mechanisms involved. Previously, we showed that β-adrenoceptors profoundly affect glucose uptake by an AMPK-independent pathway (3) that is not secondary to the lowering of ATP levels or energy deficiency, inasmuch as activation also increases glycogen formation in L6 skeletal muscle cells (4,21). Based on these studies and others (22), we have examined the mechanism used by β-adrenoceptors to increase glucose uptake in skeletal muscle and whether activation of this pathway could improve the condition of individuals with type 2 diabetes.

We describe here for the first time that specific activation of β2-adrenoceptors in skeletal muscle, but not white adipocytes, causes translocation of GLUT4 to increase glucose uptake, by a mechanism dependent on mammalian (or mechanistic) target of rapamycin (mTOR) complex 2 (mTORC2). Stimulation of this pathway improves glucose tolerance in rat and mouse models of type 2 diabetes. These studies reveal a physiological pathway and a novel mechanism that challenges accepted views of the role of G-protein–coupled receptor (GPCR) signaling in glucose metabolism. Furthermore, it identifies novel targets that could be exploited for the treatment of type 2 diabetes.

Animals

129Sv mice (Charles River Laboratories) were bred at the Stockholm University animal facility. β1β2 knockout (KO) mice (The Jackson Laboratory) (23) were of mixed background (129 × 1/SvJ, C57BL/6J, DBA/2, and FVB/N). Male C57BL/6J mice (45–57 g after being fed a high-fat diet for 6 months were provided by Dr. Natasa Petrovic [Stockholm University, Stockholm, Sweden]). The high-fat diet contained 45% fat, 35% carbohydrates, and 20% proteins (catalog no. D12451; Research Diets). Sprague-Dawley rats (male) (Scanbur, Sollentuna, Sweden) and 12-month-old male Goto-Kakizaki (GK) rats (260–390 g) were provided by Professor Gustav Dallner (Stockholm University).

Ethical Approval

All studies were approved by the North Stockholm Animal Ethics committee (permission N123/09, N69/12, N51/12). Animals were killed by CO2 under anesthesia.

Glucose Tolerance Test in GK Rats and High-Fat Diet–Fed C57BL/6J Mice

The glucose tolerance test (24) was performed by intraperitoneal injection of glucose (2 g/kg) (Riedel-de Haën AG, Buchs, Switzerland) in fasted (6 h) GK rats or high-fat diet–fed C57BL/6J mice. Blood glucose levels were measured from a drop of blood obtained from the tail before and after 15, 30, 60, 90, and 120 min of glucose administration. Animals were treated with clenbuterol (Sigma-Aldrich, St. Louis, MO), 30 mg/L, in their drinking water for 4 days, and the glucose tolerance test was performed on the 5th day.

In Vivo Glucose Uptake

In vivo glucose uptake was performed according to the methods of Liu and Stock (5) with minor modifications. Wild-type (WT) 129Sv mice or β12 KO mice were fasted for 5 h and anesthetized with pentobarbital (60 mg/kg i.p.). Mice were injected with KU0063794 (KU) (10 mg/kg) in DMSO or vehicle 10 min before treatment with insulin (1 mg/kg), isoproterenol (1 mg/kg), or saline solution. After 20 min, 130 μCi/kg [3H]-2-deoxy-D-glucose (8 Ci/mmol; PerkinElmer, Waltham MA) was injected intraperitoneally. Animals were killed 1 h later by CO2, and skeletal muscle (quadriceps) was dissected and lysed in 0.5 mol/L NaOH, and radioactivity was measured by liquid scintillation counting.

Glucose Uptake in White Adipocytes

Epididymal white fat depots were isolated (25) from Sprague-Dawley rats, digested in buffer (HEPES with 0.2% collagenase, 0.9 g/L glucose, and 1.5% BSA) at 37°C with gentle shaking for 30 min, and filtered (nylon mesh, 250 μm). Mature adipocytes were collected from the top of the suspension. Cells were washed with DMEM containing 3% BSA. Mature adipocytes were incubated with agonists in glucose-free DMEM containing 3% BSA for up to 1 h at 37°C. After incubation, [3H]-2-deoxy-d-glucose (50 nmol/L) was added to the cells for a further 60 s at 37°C. Cells were then separated from the incubation medium by centrifugation though a layer of silicone oil, and frozen at −20°C (26). Frozen cell cakes were removed and transferred to scintillation vials for counting.

Glucose Uptake in Soleus Muscle Ex Vivo

Soleus muscle was dissected from Sprague-Dawley rats and suspended with hooks stretching the muscle very gently in water-jacketed organ baths containing 30 mL Krebs-Henseleit bicarbonate (KHB) buffer (118.5 mmol/L NaCl, 4.7 mmol/L KCl, 1.2 mmol/L KH2PO4, 25 mmol/L NaHCO3, 2.5 mmol/L CaCl2, 1.2 mmol/L MgSO4, and 5 mmol/L HEPES, pH 7.4) containing 5 mmol/L glucose and 15 mmol/L mannitol, bubbled with 95% O2/5% CO2, and maintained at 37°C. Tissues were equilibrated for 5 min before KU (100 nmol/L) or vehicle was added for 30 min, followed by the addition of either insulin (100 nmol/L) or isoproterenol (100 nmol/L) for 1 h. Muscles were rinsed with KHB buffer (containing 20 mmol/L mannitol) for 10 min, then incubated in KHB buffer (containing 8 mmol/L 3-O-methylglucose, 12 mmol/L mannitol, 438 µCi/mmol 3-O-methyl[3H]glucose [PerkinElmer; 80.2 Ci/mmol] and 42 µCi/mmol [14C] mannitol [PerkinElmer; 58.8 mCi/mmol]) for 12 min. Muscles were rinsed with PBS, frozen in liquid nitrogen, weighed, and dissolved in 1 mL of 0.5 mol/L NaOH at 60°C. 3H and 14C radioactivity was measured by liquid scintillation counting. Total muscle 3-O-methylglucose and extracellular space were measured as described previously (23) and were expressed as a rate of 3-O-methylglucose transport per milliliter of intracellular water per hour.

Cell Culture

L6 cells (ATCC, Manassas, VA) or L6-GLUT4-myc cells (Professor Amira Klip, Hospital for Sick Children, Toronto, ON, Canada) were grown in DMEM supplemented with 4 mmol/L l-glutamine, 10% FBS, 100 units/mL penicillin, 100 μg/mL streptomycin, and 10 mmol/L HEPES, in a 37°C incubator with 8% CO2. Differentiation was induced by growing cells to ∼90% confluence and lowering of FBS to 2% for 7 days. Human primary skeletal muscle cells (SKMCs) were purchased from Karocell AB (Stockholm, Sweden), Lonza (Basel, Switzerland), and PromoCell GmbH (Heidelberg, Germany), and were grown in Hams F-10 nutrient mixture containing 20% heat-inactivated FBS, 2 mmol/L l-glutamine, 50 units/mL penicillin, and 50 μg/mL streptomycin. Differentiation was initiated by growing cells to ∼90% confluence and reducing FBS to 4% for 3 days then to 2% for 4 days. Prior to experiments, cells were kept in serum-free media overnight. All cell media were purchased from Sigma-Aldrich (St. Louis, MO).

Glucose Uptake in L6 and SKMCs

Cells were incubated overnight in serum-free medium (0.5% BSA), and [3H]-2-deoxy-d-glucose (50 nmol/L, 8 Ci/mmol; PerkinElmer) uptake was measured as previously described (6). Cells were pretreated with inhibitors for 30 min, and then exposed to insulin, isoproterenol, or 8-Br-cAMP for 2 h, unless otherwise stated. Radioactivity was detected by liquid scintillation counting.

Quantitative PCR

L6 cells were harvested in 1 mL Ultraspec RNA isolation reagent (Biotecx Laboratories, Houston, TX), and RNA was isolated according to the manufacturer’s instructions. Total RNA was dissolved in DEPC-water (Invitrogen, Carlsbad, CA) and quantified in a DU-50 Beckman (Fullerton, CA) spectrophotometer. Total RNA was reverse transcribed (Applied Biosystems, Carlsbad, CA) using random hexamers for first-strand cDNA synthesis. Primers for GLUT1 (forward: AGAACCGGGCCAAGAGT; reverse: GAACAGCTCCAAGATGGTGAC), GLUT4 (forward: TTGCAGTGCCTGAGTCTTCTT; reverse: CCAGTCACTCGCTGCTGA), and general transcription factor IIB (forward: GTTCTGCTCCAACCTTTGCCT; reverse: TGTGTAGCTGCCATCTGCACTT) as endogenous controls were designed by Universal Probe Library (Roche Applied Science, Penzberg, Germany) and were purchased from Invitrogen. SYBR Green PCR Master Mix (Applied Biosystems) was mixed with reference dye and primers, and loaded onto 96-well MicroAmp plates (Applied Biosystems). A 2-μL cDNA template was added in duplicate. General transcription factor IIB was used as a control.

Immunoblotting

L6 myotubes were used in all immunoblotting experiments. Cells were serum starved overnight before the experiment. Immunoblotting was performed as previously described (27,28). Primary antibodies (Akt, phospho-Akt threonine 308 [T308], phospho-Akt serine 473 [S473], phospho-AS160 threonine 642 [T642], phospho-TBC1D1 [Thr590], GLUT4, GLUT1, Myc-tag, phospho-mTOR S2448, phospho-mTOR S2481, phospho-p70-S6 kinase (p70S6K), Raptor, and Rictor, diluted 1:1,000) were all from Cell Signaling Technology (Danvers, MA) and were detected using a secondary antibody (horseradish peroxidase–linked anti-rabbit IgG; Cell Signaling Technology) diluted 1:2,000 and measured using enhanced chemiluminescence (Amersham Biosciences).

Immunocytochemistry and Immunofluorescence

L6 or SKMCs were grown in 4- or 8-well culture chamber glass-bottom slides (BD Biosciences, Franklin Lakes, NJ), treated with drugs, washed in DMEM, fixed with 4% formaldehyde in PBS for 5 min, quenched with 50 mmol/L glycine in PBS for 10 min, blocked with 5% BSA in PBS for 1 h, and incubated with GLUT4 (Santa Cruz Biotechnology) or Myc-tag antibody (Cell Signaling Technology) (1:200 dilution in 1.5% BSA in PBS) overnight at 4°C. Cells were washed in PBS and incubated with Alexa Fluor 488–conjugated goat anti-rabbit IgG, Alexa Fluor 555–conjugated goat anti-rabbit IgG, or Alexa Fluor 488–conjugated rabbit anti-goat IgG secondary antibody (1:500 dilution, 1.5% BSA in PBS) for 1 h. Phosphatidylinositol 3,4,5-trisphosphate (PIP3) was visualized in permeabilized L6 cells (0.5% Triton X-100 in water, 15 min) and blocked with 10% rat serum in Tris-buffered saline (TBS) overnight at 4°C. Cells were incubated for 1 h at 37°C with mouse anti-PIP3 conjugated to a biotinylated goat anti-mouse IgM (diluted 1:100) and washed three times (10% rat serum in TBS), and a secondary antibody was added (streptavidin-Alexa Fluor 488, 1:2,000 in TBS, 30 min, 37°C). Slides were mounted in ProLong Gold antifade reagent (Invitrogen), and images were observed in an inverted laser-scanning microscope (LSM 510 META; Carl Zeiss Microscopy, Jena, Germany). Laser power, offset, and gain including other conditions were the same for each experiment. Stained cells were quantified using ImageJ (National Institutes of Health).

Transient Transfection of siRNA

L6 cells were transfected with GLUT4-myc-GFP constructs (from Professor Jeffrey E. Pessin, Albert Einstein College of Medicine, New York, NY) or small interfering RNA (siRNA) (Qiagen, Hilden, Germany) against rat GLUT4, Rictor, or Raptor. Scrambled siRNAs were used as control. Myotubes or myoblasts were detached using trypsin/EDTA, transferred to Eppendorf tubes and centrifuged at 1,000g for 3 min, resuspended in 20 μL SE Cell Line Nucleofector solution for L6 cells and P1 primary Nucleofector solution for SKMCs (Lonza), and 100 pmol siRNA (L6 myotubes) or 0.8 μg GLUT4-myc-GFP construct (L6 myoblasts and human SKMCs) were added. L6 cells were nucleofected by using the DS-137 program and SKMCs with the DS-138 program in the Lonza 4D-Nucleofector. Cells were electroporated in 16-well microcuvette plates (Lonza), prewarmed RPMI 1640 medium was added (80 μL), and then cells were transferred to 1.5-mL microcentrifuge tubes or glass-bottom slides (BD Biosciences) containing DMEM with 10% FBS for 8 h. Medium was changed to serum-free medium (0.1% BSA), and cells were incubated overnight. The transfection did not affect cell viability assessed by trypan blue staining (data not shown). Because myotubes do not easily reattach, these cells were kept in suspension in microcentrifuge tubes, whereas myoblasts (used for confocal experiments) were seeded on slides. Twenty-four hours after transfection, glucose uptake, immunohistochemistry, or Western blotting was performed.

Glucose Uptake in Cells in Suspension

On the day of the experiment, transfected cells were stimulated with insulin (1 μmol/L) or isoproterenol (1 μmol/L) for 2 h in microcentrifuge tubes at 37°C. Cells were centrifuged and pelleted (1,000g, 2 min), media were carefully removed and changed to glucose-free media, and insulin and isoproterenol were added again. After incubation for 15 min, 50 nmol/L 2-deoxy-d-[1-3H] glucose (8 Ci/mmol) was added for 10 min. Uptake of 2-deoxy-d-[1-3H] glucose was terminated by washing with ice-cold PBS twice with centrifugation (1,000g, 30 s), and 400 µL of 0.2 mol/L NaOH was added to lyse the cells. Radioactivity was measured by liquid scintillation counting.

Statistical Analysis

Experiments were performed in duplicate, and the results are expressed as the mean ± SEM. The statistical significance of differences between groups was analyzed by Student paired two-tailed t test, or, for more than two groups, one-way or two-way ANOVA was used (*P < 0.05, **P < 0.01, ***P < 0.001). Data are presented as the increase expressed as the percent of basal levels, if not otherwise stated.

β2-Adrenoceptor Activation Increases Glucose Uptake in Skeletal Muscle In Vitro and In Vivo

GK rats and high-fat diet–fed C57BL/6J mice are two established models of type 2 diabetes (Fig. 1A and B) that were treated with the β2-adrenoceptor agonist clenbuterol (30 mg/L in the drinking water, 4 days) or normal drinking water prior to a glucose tolerance test. Clenbuterol-treated GK rats had greatly improved glucose tolerance after 60, 90, and 120 min, and C57BL/6J mice after 30 and 60 min of glucose administration compared with untreated animals (Fig. 1A and B), demonstrating that β2-adrenoceptor stimulation greatly improves glucose tolerance in two different models of type 2 diabetes. Clenbuterol, like isoproterenol and insulin, also increased glucose uptake in L6 myotubes (Supplementary Fig. 1A). We then investigated whether this effect results from actions in glucose uptake in tissues such as white fat and skeletal muscle. The general β-adrenoceptor agonist isoproterenol was used to rule out effects on α1-adrenoceptors that increase glucose uptake via an AMPK-mediated mechanism (3). Isoproterenol increased glucose uptake in vivo in WT mouse skeletal muscle to a greater extent than insulin, and this effect was absent in β12-adrenoceptor KO mice (Fig. 1C), indicating that the effect of isoproterenol is mediated by β-adrenoceptors (almost certainly β2-adrenoceptors, see 25Discussion). Glucose uptake was also stimulated by isoproterenol ex vivo in intact rat soleus muscle (Fig. 1D), but not in rat isolated white adipocytes, showing that the pathway is present in skeletal muscle but not in white adipocytes (Fig. 1E).

Figure 1

Activation of β-adrenoceptors improves glucose tolerance in diabetic animals and increases glucose uptake in vivo, ex vivo, and in vitro. A: In GK rats, a model of type 2 diabetes, clenbuterol (30 mg/L) administration in the drinking water for 4 days reduced blood glucose levels at 60, 90, and 120 min after glucose administration (2 g/kg i.p.) compared with untreated GK rats (n = 4). B: High-fat diet–induced type 2 diabetic C57BL/6J mice were treated with clenbuterol (30 mg/L) in the drinking water for 4 days, which reduced blood glucose levels at 30 and 60 min after glucose (2 g/kg i.p.) compared with untreated mice (n = 5). C: The effects of isoproterenol (1 mg/kg) and insulin (1 mg/kg) on glucose uptake in vivo in WT and β12-adrenoceptor KO mouse skeletal muscle (n = 4). Isoproterenol (100 nmol/L, 2 h) and insulin (100 nmol/L, 2 h) both increased glucose uptake in isolated rat soleus muscle ex vivo (n = 3) (D); whereas treatment with insulin (1 µmol/L, 1 h), but not isoproterenol (1 µmol/L, 1 h), significantly increased glucose uptake in mature adipocytes (n = 7) (E). Isoproterenol (1 µmol/L, 2 h) or insulin (1 µmol/L, 2 h) increased glucose uptake in human SKMCs (n = 5) (F), and the same treatments increased 2-deoxy-[3H]-glucose uptake in L6 myoblasts (n = 5) (G) and in myotubes (H) (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001.

Figure 1

Activation of β-adrenoceptors improves glucose tolerance in diabetic animals and increases glucose uptake in vivo, ex vivo, and in vitro. A: In GK rats, a model of type 2 diabetes, clenbuterol (30 mg/L) administration in the drinking water for 4 days reduced blood glucose levels at 60, 90, and 120 min after glucose administration (2 g/kg i.p.) compared with untreated GK rats (n = 4). B: High-fat diet–induced type 2 diabetic C57BL/6J mice were treated with clenbuterol (30 mg/L) in the drinking water for 4 days, which reduced blood glucose levels at 30 and 60 min after glucose (2 g/kg i.p.) compared with untreated mice (n = 5). C: The effects of isoproterenol (1 mg/kg) and insulin (1 mg/kg) on glucose uptake in vivo in WT and β12-adrenoceptor KO mouse skeletal muscle (n = 4). Isoproterenol (100 nmol/L, 2 h) and insulin (100 nmol/L, 2 h) both increased glucose uptake in isolated rat soleus muscle ex vivo (n = 3) (D); whereas treatment with insulin (1 µmol/L, 1 h), but not isoproterenol (1 µmol/L, 1 h), significantly increased glucose uptake in mature adipocytes (n = 7) (E). Isoproterenol (1 µmol/L, 2 h) or insulin (1 µmol/L, 2 h) increased glucose uptake in human SKMCs (n = 5) (F), and the same treatments increased 2-deoxy-[3H]-glucose uptake in L6 myoblasts (n = 5) (G) and in myotubes (H) (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001.

The potential relevance of these findings to humans was tested in human primary SKMCs, where isoproterenol stimulation increased glucose uptake to a greater extent than insulin (Fig. 1F). L6 cells were used to further investigate the mechanism of β2-adrenoceptor–mediated glucose uptake. Isoproterenol increased glucose uptake in both L6 myoblasts and myotubes (Fig. 1G and H), with the effect in myotubes being more than twice that in myoblasts (41.5 vs. 18 fmol/well). The effect of isoproterenol was concentration dependent, and displayed the same efficacy and potency as insulin (Supplementary Fig. 1B), with the effect measureable by 30 min and peaking by 2 h (Supplementary Fig. 1C).

β2-Adrenoceptors Stimulate Glucose Uptake Independently of Major Components of the Insulin Signaling Pathway

Insulin-mediated glucose uptake occurs by activation of a well-characterized signaling pathway involving phosphoinositide 3-kinase (PI3K), Akt, and AS160 (29). To investigate whether β2-adrenoceptor–mediated glucose uptake requires PI3K, we used the PI3K-phosphatidyl-inositol-3-kinase–like (PIKK) inhibitor PI-103. A role for PI3K or related kinases was suggested by the inhibition of both insulin- and isoproterenol-stimulated glucose uptake by PI-103 (half-maximal inhibitory concentration 0.7 μmol/L) (Fig. 2A). However, Akt, a downstream target of PI3K activation, was clearly not phosphorylated at T308 or S473 after β2-adrenoceptor stimulation (in contrast to insulin that increased Akt phosphorylation at both sites at all time points examined) (Fig. 2B). The Akt inhibitor X (10 μmol/L) or SH-6 (1 μmol/L), which prevent Akt activation by interfering with its phosphatidyl-binding domain (30,31), both inhibited insulin-stimulated glucose uptake, Akt phosphorylation, and AS160 phosphorylation, but had no effect on β2-adrenoceptor–mediated glucose uptake (Fig. 2C–E and Supplementary Fig. 2A and B). TBC1D1 phosphorylation at Thr590 was increased only after insulin, but not isoproterenol, stimulation (Supplementary Fig. 2C). Insulin, but not isoproterenol, increased PIP3 content, and this effect was inhibited by LY294002, a widely used PI3K inhibitor (32) (Fig. 2F). These results show that β2-adrenoceptor–stimulated glucose uptake does not use major components of the insulin pathway.

Figure 2

Akt is not involved in isoproterenol-mediated glucose uptake in skeletal muscle. A: The PI3K/PIKK inhibitor PI-103 concentration-dependently reduced insulin (1 µmol/L), and isoproterenol (1 µmol/L) stimulated glucose uptake (n = 4). B: Akt phosphorylation on T308 and S473 in response to insulin (1 µmol/L) but not isoproterenol (1 µmol/L, n = 3). C: The Akt inhibitor X (10 µmol/L) did not affect isoproterenol-stimulated (1 µmol/L) but reduced insulin-stimulated (1 µmol/L) glucose uptake (2 h, n = 8). D: The Akt inhibitor X (1 μmol/L, 30 min pretreatment) abolished Akt T308 or S473 phosphorylation in response to insulin (1 μmol/L, n = 4). E: The Akt inhibitor X (1 μmol/L, 30 min pretreatment) abolished AS160 phosphorylation at T642 in response to insulin (1 µmol/L, n = 3). F: PIP3 immunoflourescence staining in L6 cells treated with isoproterenol (1 µmol/L, 5 min) or insulin (1 µmol/L, 5 min) in the absence or presence of LY294002 (1 µmol/L, 30 min). p, phosphorylated. **P < 0.01.

Figure 2

Akt is not involved in isoproterenol-mediated glucose uptake in skeletal muscle. A: The PI3K/PIKK inhibitor PI-103 concentration-dependently reduced insulin (1 µmol/L), and isoproterenol (1 µmol/L) stimulated glucose uptake (n = 4). B: Akt phosphorylation on T308 and S473 in response to insulin (1 µmol/L) but not isoproterenol (1 µmol/L, n = 3). C: The Akt inhibitor X (10 µmol/L) did not affect isoproterenol-stimulated (1 µmol/L) but reduced insulin-stimulated (1 µmol/L) glucose uptake (2 h, n = 8). D: The Akt inhibitor X (1 μmol/L, 30 min pretreatment) abolished Akt T308 or S473 phosphorylation in response to insulin (1 μmol/L, n = 4). E: The Akt inhibitor X (1 μmol/L, 30 min pretreatment) abolished AS160 phosphorylation at T642 in response to insulin (1 µmol/L, n = 3). F: PIP3 immunoflourescence staining in L6 cells treated with isoproterenol (1 µmol/L, 5 min) or insulin (1 µmol/L, 5 min) in the absence or presence of LY294002 (1 µmol/L, 30 min). p, phosphorylated. **P < 0.01.

β-Adrenoceptor–Stimulated Glucose Uptake Involves cAMP and mTOR

To further investigate β-adrenoceptor–mediated glucose uptake, we used cAMP analogs because β2-adrenoceptor activation increased cAMP levels in L6 cells (Supplementary Fig. 2D). Glucose uptake was increased by the cell-permeable cAMP analogs 8-bromoadenosine 3′,5′-cAMP (8-Br-cAMP, 1 mmol/L), N6,2′-O-dibutyryladenosine 3′,5′-cAMP (db-cAMP, 1 mmol/L), and cAMP (2 mmol/L), whereas the cell-impermeable analog 8-hydroxyadenosine- 3′,5′-cAMP (8-OH, 1 mmol/L) had no effect (Fig. 3A). This suggested that increases in cAMP levels were associated with increased glucose uptake in L6 cells. Because the PI3K inhibitor PI-103 also inhibits other PIKK family kinases (33,34), including mTOR, we examined more selective inhibitors. The mTOR inhibitors Torin-1 and KU blocked β2-adrenoceptor–mediated and cAMP-mediated glucose uptake in L6 myotubes (Fig. 3B and C). KU also inhibited isoproterenol-mediated glucose uptake in intact rat soleus muscle ex vivo and in mouse skeletal muscle in vivo (Fig. 3D and E).

Figure 3

mTOR is a key factor in isoproterenol-mediated glucose uptake. A: Glucose uptake in response to isoproterenol (1 µmol/L) or the cell-permeable cAMP analogs 8-bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP, 1 mmol/L), N6,2′-O-dibutyryladenosine 3′,5′-cyclic monophosphate (db-cAMP, 1 mmol/L), cAMP (2 mmol/L), the non–cell-permeable analog 8-hydroxyadenosine-3′,5′-cyclic monophosphate (8-OH, 1 mmol/L), or insulin (1 µmol/L) (n = 4–10). B: The mTOR inhibitor Torin-1 (10 nmol/L, 30 min) inhibited glucose uptake in response to insulin (1 μmol/L, 2 h), isoproterenol (1 μmol/L, 2 h), or 8-Br-cAMP (1 mmol/L, 2 h) (n = 4). C: The mTOR inhibitor KU concentration-dependently inhibited insulin-mediated (1 µmol/L, 2 h), isoproterenol-mediated (1 µmol/L, 2 h), or 8-Br-cAMP–mediated (1 mmol/L, 2 h) glucose uptake (n = 4). D: In ex vivo experiments with rat soleus muscle, KU (100 nmol/L) blocked glucose uptake in response to isoproterenol (100 nmol/L, 2 h) and insulin (100 nmol/L, 2 h) (n = 4). E: KU (10 mg/kg) inhibited isoproterenol-stimulated (1 mg/kg), and insulin-stimulated (1 mg/kg) glucose uptake in WT mouse skeletal muscle (n = 5). Both ex vivo and in vivo glucose uptake was detected by [3H]-2-deoxy-D-glucose. *P < 0.05; **P < 0.01; ***P < 0.001.

Figure 3

mTOR is a key factor in isoproterenol-mediated glucose uptake. A: Glucose uptake in response to isoproterenol (1 µmol/L) or the cell-permeable cAMP analogs 8-bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP, 1 mmol/L), N6,2′-O-dibutyryladenosine 3′,5′-cyclic monophosphate (db-cAMP, 1 mmol/L), cAMP (2 mmol/L), the non–cell-permeable analog 8-hydroxyadenosine-3′,5′-cyclic monophosphate (8-OH, 1 mmol/L), or insulin (1 µmol/L) (n = 4–10). B: The mTOR inhibitor Torin-1 (10 nmol/L, 30 min) inhibited glucose uptake in response to insulin (1 μmol/L, 2 h), isoproterenol (1 μmol/L, 2 h), or 8-Br-cAMP (1 mmol/L, 2 h) (n = 4). C: The mTOR inhibitor KU concentration-dependently inhibited insulin-mediated (1 µmol/L, 2 h), isoproterenol-mediated (1 µmol/L, 2 h), or 8-Br-cAMP–mediated (1 mmol/L, 2 h) glucose uptake (n = 4). D: In ex vivo experiments with rat soleus muscle, KU (100 nmol/L) blocked glucose uptake in response to isoproterenol (100 nmol/L, 2 h) and insulin (100 nmol/L, 2 h) (n = 4). E: KU (10 mg/kg) inhibited isoproterenol-stimulated (1 mg/kg), and insulin-stimulated (1 mg/kg) glucose uptake in WT mouse skeletal muscle (n = 5). Both ex vivo and in vivo glucose uptake was detected by [3H]-2-deoxy-D-glucose. *P < 0.05; **P < 0.01; ***P < 0.001.

mTORC2 Is Obligatory for β2-Adrenoceptor–Stimulated Glucose Uptake

mTOR exists as two complexes: mTORC1 that is associated with Raptor and is phosphorylated at S2448 and mTORC2 that is associated with Rictor and is phosphorylated at S2481, with these two phosphorylation sites reflecting mTOR activity (35). In L6 cells, isoproterenol increased phosphorylation only at S2481 in a time-dependent manner (Supplementary Fig. 3A), whereas insulin phosphorylated mTOR at both S2448 and S2481. While S2448 was phosphorylated within 5 min of insulin stimulation, isoproterenol did not affect phosphorylation at this site at any time point examined (Supplementary Fig. 3A). mTOR phosphorylation in response to isoproterenol or insulin was blocked by KU (Fig. 4A). A downstream target of mTORC1 (p70S6K) was phosphorylated slightly after isoproterenol, although to a lesser extent than insulin (Supplementary Fig. 3B). Akt inhibitor X decreased insulin-induced phosphorylation of mTOR at S2448, but not isoproterenol- or insulin-induced phosphorylation of mTOR at S2481 (Supplementary Fig. 3C), indicating that Akt is not upstream of mTOR S2481. 8-Br-cAMP (1 mmol/L) or the cAMP-dependent protein kinase (PKA)-selective cAMP analog 6-Benz-cAMP (1 mmol/L) also caused phosphorylation of mTOR at S2481 (Fig. 4A and B), mimicking the effect of isoproterenol and indicating that this site is regulated by the cAMP-PKA pathway. The PKA inhibitor (PKI) 14–22 partially blocked the isoproterenol effect and completely blocked the effect of 8-Br-cAMP on S2481, while not affecting insulin-mediated S2481 phosphorylation (Fig. 4C). Because mTOR is a key factor in the β2-adrenoceptor pathway, we examined the complex involved. mTORC1 contains the regulatory-associated protein of mTOR (Raptor), whereas mTORC2 contains the rapamycin-insensitive companion of mTOR (Rictor). Short-term (30 min) treatment with the mTORC1 inhibitor rapamycin had no effect on isoproterenol and 8-Br-cAMP–stimulated glucose uptake (Fig. 4D), but long-term exposure (24 h), which inhibits the mTORC2 assembly, inhibited isoproterenol-stimulated glucose uptake, suggesting the involvement of mTORC2 (Fig. 4E). Rictor siRNA treatment markedly depleted Rictor (Fig. 4F) and abolished isoproterenol-stimulated glucose uptake (Fig. 4G), whereas Raptor siRNA or control siRNAs had no effect. This clearly demonstrated that mTORC2 is a key factor involved in β2-adrenoceptor–mediated glucose uptake in skeletal muscle.

Figure 4

Role of mTORC1 and mTORC2 in isoproterenol-mediated glucose uptake. A: Western blots of mTOR phosphorylation at S2448 and S2481 in response to insulin (1 µmol/L, 2 h), isoproterenol (1 µmol/L, 2 h), or 8-Br-cAMP (1 mmol/L, 2 h) in the presence or absence of KU (100 nmol/L). Insulin caused mTOR phosphorylation at S2448 and S2481, whereas isoproterenol and 8-Br-cAMP caused phosphorylation solely at S2481. Phosphorylation at both sites is blocked by the mTOR inhibitor KU (100 nmol/L, n = 4). B: mTOR phosphorylation in response to the PKA-selective cAMP analog N6-benzoyladenosine-3′,5′-cyclic monophosphate (6-Benz-cAMP, 1 mmol/L, 2 h). C: Quantification of Western blots detecting mTOR phosphorylation at S2481 in response to insulin (1 µmol/L, 2 h), isoproterenol (1 µmol/L, 2 h), or 8-Br-cAMP (1 mmol/L) in the presence or absence of the PKI fragment 14–22 (5 μmol/L, 30 min preincubation). PKI partly significantly reduced mTOR phosphorylation in response to isoproterenol and 8-Br-cAMP. D: Acute (30 min) treatment of L6 myotubes with rapamycin inhibited mTORC1 and had no significant effect on glucose uptake in response to isoproterenol (1 µmol/L, 2 h), 8-Br-cAMP (1 mmol/L, 2 h), or insulin (1 µmol/L, 2 h) (n = 4). E: Long-term pretreatment with rapamycin (1 nmol/L, 24 h) downregulated mTORC2 and inhibited glucose uptake to isoproterenol (1 µmol/L) and insulin (1 µmol/L) (n = 4). F: Western blots from cells treated with Rictor siRNA, Raptor siRNA, or a scrambled siRNA showing selective knockdown of Rictor and Raptor (n = 4). G: Glucose uptake in L6 myotubes transfected with scrambled, Rictor, or Raptor siRNA (n = 4–5). Only transfection with Rictor siRNA inhibited glucose uptake in response to isoproterenol (1 µmol/L, 2 h) or insulin (1 µmol/L, 2 h). p, phosphorylated. *P < 0.05; **P < 0.01; ***P < 0.001.

Figure 4

Role of mTORC1 and mTORC2 in isoproterenol-mediated glucose uptake. A: Western blots of mTOR phosphorylation at S2448 and S2481 in response to insulin (1 µmol/L, 2 h), isoproterenol (1 µmol/L, 2 h), or 8-Br-cAMP (1 mmol/L, 2 h) in the presence or absence of KU (100 nmol/L). Insulin caused mTOR phosphorylation at S2448 and S2481, whereas isoproterenol and 8-Br-cAMP caused phosphorylation solely at S2481. Phosphorylation at both sites is blocked by the mTOR inhibitor KU (100 nmol/L, n = 4). B: mTOR phosphorylation in response to the PKA-selective cAMP analog N6-benzoyladenosine-3′,5′-cyclic monophosphate (6-Benz-cAMP, 1 mmol/L, 2 h). C: Quantification of Western blots detecting mTOR phosphorylation at S2481 in response to insulin (1 µmol/L, 2 h), isoproterenol (1 µmol/L, 2 h), or 8-Br-cAMP (1 mmol/L) in the presence or absence of the PKI fragment 14–22 (5 μmol/L, 30 min preincubation). PKI partly significantly reduced mTOR phosphorylation in response to isoproterenol and 8-Br-cAMP. D: Acute (30 min) treatment of L6 myotubes with rapamycin inhibited mTORC1 and had no significant effect on glucose uptake in response to isoproterenol (1 µmol/L, 2 h), 8-Br-cAMP (1 mmol/L, 2 h), or insulin (1 µmol/L, 2 h) (n = 4). E: Long-term pretreatment with rapamycin (1 nmol/L, 24 h) downregulated mTORC2 and inhibited glucose uptake to isoproterenol (1 µmol/L) and insulin (1 µmol/L) (n = 4). F: Western blots from cells treated with Rictor siRNA, Raptor siRNA, or a scrambled siRNA showing selective knockdown of Rictor and Raptor (n = 4). G: Glucose uptake in L6 myotubes transfected with scrambled, Rictor, or Raptor siRNA (n = 4–5). Only transfection with Rictor siRNA inhibited glucose uptake in response to isoproterenol (1 µmol/L, 2 h) or insulin (1 µmol/L, 2 h). p, phosphorylated. *P < 0.05; **P < 0.01; ***P < 0.001.

β2-Adrenoceptor Activation Increases Glucose Uptake Independently of Transcription and Translation

Glucose uptake can be increased by de novo synthesis of GLUTs associated with increases in transcription and/or translation. The general transcription inhibitor actinomycin D (2 μg/mL) did not significantly affect basal glucose uptake or cell viability (not shown), or insulin- or isoproterenol-mediated glucose uptake at 2 h (Fig. 5A), indicating that changes in transcription are not involved. Accordingly, GLUT1 and GLUT4 mRNA levels were not changed by isoproterenol (1 μmol/L) (Fig. 5B and C). The general translational inhibitor cycloheximide (50 μmol/L) did not affect basal glucose uptake or cell viability or either insulin- or isoproterenol-mediated glucose uptake at 2 h (Fig. 5D). Neither GLUT1 nor GLUT4 protein levels were altered by isoproterenol (Fig. 5E and F), suggesting that β2-adrenoceptor–stimulated glucose uptake is not dependent upon de novo GLUT1 and GLUT4 synthesis at time points up to 2 h.

Figure 5

Isoproterenol-stimulated glucose uptake is not dependent on transcription or translation. A: Actinomycin D (2 µg/mL) treatment had no effect on insulin-mediated (1 µmol/L) and isoproterenol-mediated (1 µmol/L) glucose uptake (2 h) in L6 myotubes (n = 4). B: Quantification of GLUT1 mRNA levels by quantitative PCR after 2 h stimulation with either insulin (1 μmol/L) or isoproterenol (1 μmol/L) (n = 6). Basal levels at 0 h were set as 100% (ct 27.4). C: GLUT4 mRNA levels (quantitative PCR) were not changed after 2 h of stimulation with either insulin (1 µmol/L) or isoproterenol (1 µmol/L). Basal levels at 0 h were set as 100% (GLUT1 ct 26.2, GLUT4 ct 27.4). D: Cycloheximide (50 µmol/L) treatment had no significant effect on insulin-mediated (1 µmol/L) or isoproterenol-mediated (1 µmol/L) glucose uptake (2 h) (n = 4). E: Western blot and quantification of GLUT1 protein levels in L6 mytoubes treated with insulin (1 μmol/L, 2 h) or isoproterenol (1 μmol/L, 2 h). The levels in unstimulated cells were set as 100% (n = 3). F: GLUT4 protein levels were unchanged by treatment (2 h) with insulin (1 µmol/L) or isoproterenol (1 µmol/L). The levels in unstimulated cells were set at 100% (n = 3). G: Eadie-Hofstee plot of glucose uptake. Vmax (y-axis intercept) and Km (slope) values, respectively, were 7,947 ± 536 pmol/min/μg and 2.5 ± 0.3 mmol/L in isoproterenol-treated myotubes; 4,045 ± 702 pmol/min/μg and 1.5 ± 0.6 mmol/L in control; and 8,280 ± 504 pmol/min/μg and 3.2 ± 0.4 mmol/L in insulin-treated L6 myotubes (n = 5). H: At right, Western blot analysis of GLUT4 and Akt after GLUT4 siRNA or scrambled siRNA treatment (n = 5). I: Glucose uptake in response to isoproterenol or insulin (1 µmol/L, 2 h) in the absence or presence of the action inhibitor latrunculin B (10 µmol/L, 30 min preincubation). ct, cycle threshold. *P < 0.05; **P < 0.01; ***P < 0.001.

Figure 5

Isoproterenol-stimulated glucose uptake is not dependent on transcription or translation. A: Actinomycin D (2 µg/mL) treatment had no effect on insulin-mediated (1 µmol/L) and isoproterenol-mediated (1 µmol/L) glucose uptake (2 h) in L6 myotubes (n = 4). B: Quantification of GLUT1 mRNA levels by quantitative PCR after 2 h stimulation with either insulin (1 μmol/L) or isoproterenol (1 μmol/L) (n = 6). Basal levels at 0 h were set as 100% (ct 27.4). C: GLUT4 mRNA levels (quantitative PCR) were not changed after 2 h of stimulation with either insulin (1 µmol/L) or isoproterenol (1 µmol/L). Basal levels at 0 h were set as 100% (GLUT1 ct 26.2, GLUT4 ct 27.4). D: Cycloheximide (50 µmol/L) treatment had no significant effect on insulin-mediated (1 µmol/L) or isoproterenol-mediated (1 µmol/L) glucose uptake (2 h) (n = 4). E: Western blot and quantification of GLUT1 protein levels in L6 mytoubes treated with insulin (1 μmol/L, 2 h) or isoproterenol (1 μmol/L, 2 h). The levels in unstimulated cells were set as 100% (n = 3). F: GLUT4 protein levels were unchanged by treatment (2 h) with insulin (1 µmol/L) or isoproterenol (1 µmol/L). The levels in unstimulated cells were set at 100% (n = 3). G: Eadie-Hofstee plot of glucose uptake. Vmax (y-axis intercept) and Km (slope) values, respectively, were 7,947 ± 536 pmol/min/μg and 2.5 ± 0.3 mmol/L in isoproterenol-treated myotubes; 4,045 ± 702 pmol/min/μg and 1.5 ± 0.6 mmol/L in control; and 8,280 ± 504 pmol/min/μg and 3.2 ± 0.4 mmol/L in insulin-treated L6 myotubes (n = 5). H: At right, Western blot analysis of GLUT4 and Akt after GLUT4 siRNA or scrambled siRNA treatment (n = 5). I: Glucose uptake in response to isoproterenol or insulin (1 µmol/L, 2 h) in the absence or presence of the action inhibitor latrunculin B (10 µmol/L, 30 min preincubation). ct, cycle threshold. *P < 0.05; **P < 0.01; ***P < 0.001.

β2-Adrenoceptor–Stimulated Glucose Uptake Depends on GLUT4

We next examined whether β2-adrenoceptor–stimulated glucose uptake involved GLUTs. Both of the GLUT inhibitors cytochalasin B (10 μmol/L) and phloretin (100 μmol/L) (36) reduced basal glucose uptake (Supplementary Fig. 4A) and inhibited glucose uptake to isoproterenol and insulin (Supplementary Fig. 4B and C), suggesting that GLUTs were involved. The selective GLUT4 inhibitor indinavir (100 μmol/L) blocked basal glucose uptake by ∼40% (Supplementary Fig. 4A), which is consistent with other studies in L6 myotubes (37), and markedly reduced both β2-adrenoceptor–stimulated and insulin-stimulated glucose uptake, after both 45 and 120 min of stimulation (Supplementary Fig. 4D and E), suggesting a role for GLUT4.

To confirm that β2-adrenoceptor–stimulated glucose uptake was carrier mediated, kinetic studies were performed with increasing concentrations of 2-deoxyglucose (38). Insulin increased glucose uptake (Fig. 5G) with Km values (Eadie-Hofstee plot) in agreement with previously reported values (10,39). β2-Adrenoceptor stimulation increased glucose uptake Vmax following classical saturable Michaelis-Menten kinetics with a Km value (2.5 ± 0.3 mmol/L) similar to that of insulin (Supplementary Fig. 4F), suggesting that β2-adrenoceptor–stimulated glucose uptake involves transporter proteins (40). To confirm the involvement of GLUT4, siRNA directed against GLUT4 was used and markedly reduced β2-adrenoceptor–mediated glucose uptake compared with a scrambled siRNA (Fig. 5H). Thus, GLUT4 is the transporter responsible for β2-adrenoceptor–mediated glucose uptake. Because GLUT4 is involved, we investigated the role of actin and cytoskeletal rearrangement using latrunculin B (Fig. 5I), which inhibited both insulin- and isoproterenol-mediated glucose uptake, indicating that actin polymerization was involved and suggesting a role for GLUT4 translocation.

Direct Demonstration of GLUT4 Translocation After β2-Adrenoceptor–Stimulated Glucose Uptake

Direct visualization of GLUT4 translocation to the plasma membrane was examined by immunohistochemistry in nonpermeabilized L6 cells and was observed after β2-adrenoceptor stimulation in native L6 myoblasts, and in L6 myoblasts transiently transfected with GLUT4-myc-GFP or stably transfected with GLUT4-myc (Fig. 6A and B and Supplementary Fig. 5A). This was confirmed in L6 myotubes and in stably transfected GLUT4-myc L6 myotubes (Supplementary Fig. 5B and C). β-Adrenoceptor stimulation also increased GLUT4 translocation in human native primary SKMCs (Fig. 6C) and in SKMCs transiently transfected with GLUT4-myc-GFP (Fig. 6D). GLUT4 translocation to isoproterenol was abolished by mTOR inhibition (Fig. 6E). β-Adrenoceptor–stimulated glucose uptake is therefore dependent on mTORC2 and on GLUT4 translocation.

Figure 6

Isoproterenol stimulates GLUT4 translocation. A: L6 myoblasts treated with isoproterenol (1 µmol/L) or insulin (1 µmol/L) for 2 h show translocation of GLUT4 to the plasma membrane. Nonpermeabilized L6 myoblasts were probed with GLUT4 antibody (green) targeting exofacial epitopes and were visualized by confocal microscopy; plasma membrane GLUT4 is expressed as the percent of control (n = 36). B: L6 myoblasts transiently transfected with GLUT4-myc-GFP and stimulated with isoproterenol (1 µmol/L) or insulin (1 µmol/L) for 2 h also show translocation of GLUT4 to the plasma membrane (GFP fluorescence was similar in the cells examined). GLUT4 was detected with myc-tag antibody (red); plasma membrane GLUT4 is expressed as the percent of control (n = 36). C and D: Confocal micrographs of human SKMCs (n = 36) and SKMCs transiently transfected with GLUT4-myc-GFP (n = 36) probed with either GLUT4 (green) or myc-tag (red) antibody, respectively, after isoproterenol (1 µmol/L) or insulin (1 µmol/L) treatment for 2 h. Quantification of the images was performed with untreated plasma membrane GLUT4 as the percent of control. E: KU (100 nmol/L) blocked GLUT4 translocation in L6 myotubes. Cell surface GLUT4 was visualized with GLUT4 antibody (green) and detected with confocal microscopy. Histograms show that KU significantly inhibited the plasma membrane translocation of GLUT4 in response to isoproterenol (1 µmol/L, 2 h), insulin (1 µmol/L, 2 h), or 8-Br-cAMP (1 mmol/L, 2 h). IF, immunofluorescence. *P < 0.05; **P < 0.01; ***P < 0.001.

Figure 6

Isoproterenol stimulates GLUT4 translocation. A: L6 myoblasts treated with isoproterenol (1 µmol/L) or insulin (1 µmol/L) for 2 h show translocation of GLUT4 to the plasma membrane. Nonpermeabilized L6 myoblasts were probed with GLUT4 antibody (green) targeting exofacial epitopes and were visualized by confocal microscopy; plasma membrane GLUT4 is expressed as the percent of control (n = 36). B: L6 myoblasts transiently transfected with GLUT4-myc-GFP and stimulated with isoproterenol (1 µmol/L) or insulin (1 µmol/L) for 2 h also show translocation of GLUT4 to the plasma membrane (GFP fluorescence was similar in the cells examined). GLUT4 was detected with myc-tag antibody (red); plasma membrane GLUT4 is expressed as the percent of control (n = 36). C and D: Confocal micrographs of human SKMCs (n = 36) and SKMCs transiently transfected with GLUT4-myc-GFP (n = 36) probed with either GLUT4 (green) or myc-tag (red) antibody, respectively, after isoproterenol (1 µmol/L) or insulin (1 µmol/L) treatment for 2 h. Quantification of the images was performed with untreated plasma membrane GLUT4 as the percent of control. E: KU (100 nmol/L) blocked GLUT4 translocation in L6 myotubes. Cell surface GLUT4 was visualized with GLUT4 antibody (green) and detected with confocal microscopy. Histograms show that KU significantly inhibited the plasma membrane translocation of GLUT4 in response to isoproterenol (1 µmol/L, 2 h), insulin (1 µmol/L, 2 h), or 8-Br-cAMP (1 mmol/L, 2 h). IF, immunofluorescence. *P < 0.05; **P < 0.01; ***P < 0.001.

There is increasing recognition that glucose homeostasis can be regulated independently of insulin receptors by the activation of GPCRs. Typical GPCRs such as adrenoceptors facilitate glucose uptake in skeletal muscle, and we have demonstrated that activation of α1- and β2-adrenoceptors in skeletal muscle increases glucose uptake, although the mechanisms are not fully understood (6,7). This has led us to determine the signaling pathways used by β2-adrenoceptors in skeletal muscle to increase glucose uptake because their activation improves glucose tolerance in diabetic GK rats and obese C57BL/6J mice (Fig. 1). Although this could result from a variety of mechanisms in different tissues, our combined results suggest that the major part of the improvement emanates from β2-adrenoceptor activation of glucose uptake in skeletal muscle (with β-adrenoceptors not increasing glucose uptake in mature white adipocytes). We suggest that sympathetic stimulation shunts glucose from liver to skeletal muscle to provide energy for muscular action rather than for storage in white fat. We believe that this event has high physiological and pathophysiological importance, given the major role of skeletal muscle in glucose uptake.

We ruled out a role for β1- or β3-adrenoceptors, because the in vivo effect of β-adrenergic agonists on glucose uptake in skeletal muscle is absent in β12 KO mice and the selective β2-adrenoceptor agonist clenbuterol displayed the same efficacy as isoproterenol in L6 muscle cells. Previous studies show that β2-adrenoceptors are the primary target for catecholamines in skeletal muscle (6,41), and studies in L6 cells demonstrate that β-adrenoceptor agonist effects are mediated by β2-adrenoceptors (6), clearly suggesting that the effects of β-adrenergic agonists on glucose uptake are mediated primarily by β2-adrenoceptors.

We show here that β2-adrenoceptor agonists acutely stimulate glucose uptake with similar efficacy, potency, and time course to insulin in L6 myotubes (Supplementary Fig. 1B and C). Initially, our assumption was that β-adrenoceptors increase glucose uptake by pathways similar to those used by insulin, because responses were blocked by PI3K inhibitors. However, unlike insulin, β2-adrenoceptor stimulation failed to phosphorylate Akt at either S473 or T308 at all time points examined, selective Akt inhibitors failed to inhibit β2-adrenoceptor–mediated glucose uptake, and β2-adrenoceptor stimulation failed to increase PIP3 levels in L6 cells, suggesting that PI3K was not involved in the β-adrenoceptor pathway. Examination of the selectivity of these inhibitors shows that they also inhibit other PIKK family kinases (33,34), including mTOR, which also plays an important role in insulin signaling (Fig. 7). Specific inhibition of mTOR by KU confirmed its role in insulin signaling but also revealed that it was necessary for β-adrenoceptor–stimulated glucose uptake. However, the pattern of mTOR phosphorylation in response to β-adrenoceptor stimulation differed from that of insulin, with phosphorylation only at S2481, whereas insulin caused phosphorylation at both S2448 and S2481. Phosphorylation at S2481 is associated with mTORC2, whereas phosphorylation at S2448 is associated with mTORC1 (35), suggesting that insulin regulates both mTOR complexes, whereas β-adrenoceptor activation regulates only mTORC2. Treatment with rapamycin and siRNA knockdown of Raptor or Rictor reveal the involvement of mTORC1 and mTORC2, and we show that knockdown of Rictor, but not Raptor, markedly inhibits both insulin-mediated and β-adrenoceptor–mediated glucose uptake, confirming mTORC2 as a key regulator of glucose uptake in skeletal muscle. Thus, although the β-adrenoceptor pathway differs from the insulin pathway at the level of Akt and PIP3, both pathways involve mTORC2. The involvement of mTOR was confirmed ex vivo and in vivo where KU inhibited both insulin-stimulated and β-adrenoceptor–stimulated glucose uptake. Recent studies indicate a role for mTORC2 (Rictor) in glucose homeostasis, because either skeletal muscle or adipose-specific ablation of Rictor depresses insulin-stimulated glucose uptake in skeletal muscle (42) or adipose tissue (43), respectively, and in both mouse models impairs glucose tolerance in vivo.

Figure 7

Proposed mechanisms of glucose uptake in response to the activation of β2-adrenoceptors or insulin. The β2-adrenoceptor pathway, when activated, couples to Gs to stimulate adenylate cyclase (AC), resulting in the production of cAMP, which in turn activates PKA that phosphorylates mTORC2 at S2481. The phosphorylated mTORC2 stimulates actin reorganization and GLUT4 translocation to the plasma membrane to increase glucose uptake. Insulin binds to the insulin receptor (IR), resulting in interaction between insulin receptor substrate (IRS)-1 and PI3K. PI3K activation leads to increased PIP3 levels and plasma membrane recruitment of Akt and PDK1, where Akt is phosphorylated at T308 by PDK1. PI3K also phosphorylates mTORC2 at S2481, and mTORC2 phosphorylates Akt at S473. mTORC2 stimulates actin reorganization and GLUT4 translocation to the plasma membrane, and activated Akt dissociates from the membrane and phosphorylates mTORC1 at S2448 and AS160 at T642, which also promotes translocation of GLUT4 to the plasma membrane.

Figure 7

Proposed mechanisms of glucose uptake in response to the activation of β2-adrenoceptors or insulin. The β2-adrenoceptor pathway, when activated, couples to Gs to stimulate adenylate cyclase (AC), resulting in the production of cAMP, which in turn activates PKA that phosphorylates mTORC2 at S2481. The phosphorylated mTORC2 stimulates actin reorganization and GLUT4 translocation to the plasma membrane to increase glucose uptake. Insulin binds to the insulin receptor (IR), resulting in interaction between insulin receptor substrate (IRS)-1 and PI3K. PI3K activation leads to increased PIP3 levels and plasma membrane recruitment of Akt and PDK1, where Akt is phosphorylated at T308 by PDK1. PI3K also phosphorylates mTORC2 at S2481, and mTORC2 phosphorylates Akt at S473. mTORC2 stimulates actin reorganization and GLUT4 translocation to the plasma membrane, and activated Akt dissociates from the membrane and phosphorylates mTORC1 at S2448 and AS160 at T642, which also promotes translocation of GLUT4 to the plasma membrane.

The regulation and cross-talk among insulin, mTORC1 (Raptor), mTORC2 (Rictor), and Akt is complex (Fig. 7). Insulin mediates increases in PI3K activity, PIP3 recruits inactive Akt, and phosphoinositide-dependent kinase-1 (PDK1) to the plasma membrane via their NH2-terminal PH domain, allowing Akt phosphorylation at T308 by PDK1, and in parallel PI3K phosphorylates mTORC2 at S2481. The subsequent conformational change in Akt allows mTORC2 to phosphorylate Akt at S473, thereby fully activating Akt, resulting in mTORC1 phosphorylation at S2448 and subsequent AS160 and GLUT4 translocation. In contrast, β2-adrenoceptors activate mTORC2 in a PI3K-Akt–independent manner. Because β2-adrenoceptors fail to activate PI3K (observed as no increases in PIP3 levels), PDK1 and Akt cannot, as discussed for insulin above, be recruited to the plasma membrane. This prevents phosphorylation of Akt at T308, which is absolutely required for mTORC2-mediated phosphorylation of Akt at S473, and subsequent phosphorylation of AS160. Our results demonstrate that β2-adrenoceptor activation leads to phosphorylation of mTOR at S2481 via a PKA-mediated mechanism that is independent of PI3K-Akt (Fig. 7).

This is the first demonstration that GPCRs can specifically stimulate mTORC2 in mammalian cells. The only other evidence that GPCRs can activate mTORC2 is found in the soil-living amoeba Dictyostelium discoideum, where chemotactic activation of GPCRs and mTORC2 (4446) occurs, suggesting that GPCR stimulation of mTORC2 could be of ancient origin.

There is, however, some evidence that other GPCRs can activate mTORC1 independently of Akt/PI3K, including the Gαq/11-coupled α1-adrenoceptors in cardiomyocytes (47), the Gαq/11-coupled prostaglandin F2α receptor, and the Gαs-coupled luteinizing hormone receptor in the corpus luteum (48). There has been great attention focused on the regulation and downstream targets of mTORC1 that can be pharmacologically inhibited by rapamycin. mTORC1 regulates protein translation and synthesis by activating proteins such as p70S6K. Although our study shows, both pharmacologically and by gene knockdown, that β2-adrenoceptors do not use mTORC1 for glucose uptake, they may activate mTORC1 to some degree (as measured as the phosphorylation of p70S6K). The activation of mTORC1 might reflect the long-term hypertrophic effects of β2-adrenergic agonists on skeletal muscle, which was not a focus of this study.

Compared with mTORC1, little is known of the downstream targets of mTORC2, but they do include pathways involved in actin cytoskeleton organization. There is evidence for a Rac-dependent (Akt-independent) arm in skeletal muscle that regulates cytoskeletal rearrangement involved in insulin signaling to glucose uptake (49,50). Such pathways should be investigated further in connection with mTORC2 and adrenergic signaling. Both β2-adrenoceptor (51) and mTORC2 activation cause acute actin cytoskeleton reorganization (52), and the inhibition of this process by latrunculin B blocks β2-adrenoceptor–stimulated glucose uptake. Taken together, our findings identify a pathway involving the activation of mTORC2 by a mammalian GPCR, independently of PI3K/Akt, and show that mTORC2 is an important master regulator of adrenergic-mediated glucose uptake, likely through cytoskeletal rearrangement.

Glucose uptake in skeletal muscle is the rate-limiting step for whole-body glucose metabolism (17). Glucose uptake in response to β-adrenoceptor stimulation has an efficacy similar to insulin, is saturable, and is blocked by GLUT inhibitors and by pretreatment with GLUT4 siRNA. These results show for the first time that GLUT4 is required for β-adrenoceptor–stimulated glucose uptake, occurs independently of changes in transcription or translation (again suggesting that mTORC1 is not involved), and involves translocation of GLUT4 to the plasma membrane, a process generally considered to be predominantly insulin regulated. Thus, the adrenergic pathway uses two crucial components of the insulin pathway: mTORC2 and GLUT4. However, in contrast to insulin signaling, β2-adrenoceptor activation does not lead to activation of mTORC1, Akt, or the downstream phosphorylation of the Rab-GTPase–activating protein AS160.

Glucose uptake in type 2 diabetes is associated with defects in PI3K activity, insulin receptor tyrosine, insulin receptor substrate, and Akt phosphorylation, causing impairment of GLUT4 trafficking and glucose uptake. Thus, there is normally no defect per se with GLUT4 trafficking, rather defects in the insulin signaling mechanisms regulating GLUT4 trafficking (53) and these defects are bypassed by the β2-adrenoceptor-mTORC2 pathway. This was illustrated in two different diabetic muscle models in vivo, where β2-adrenoceptor agonists improved glucose tolerance. However, current β2-adrenoceptor agonists normally display a number of side effects (including myocardial hypertrophy) (54), making them unsuitable for the treatment of type 2 diabetes. Insights obtained from the β2-adrenoceptor–mediated pathway to mTORC2 and glucose uptake opens up new avenues in the search for novel approaches and drugs to treat type 2 diabetes.

In conclusion, we describe a novel physiological pathway involving β2-adrenoceptors, PKA, mTORC2, and GLUT4 that promotes glucose uptake in both healthy and type 2 diabetic skeletal muscle. This study reveals new and exciting approaches for our understanding of the role of adrenergic mechanisms in metabolic health and disease.

Acknowledgments. The authors thank Ashwini Kodavali and Anna-Stina Höglund (Stockholm University, Stockholm, Sweden) for technical help. The authors also thank Professor Jan Nedergaard and Professor Barbara Cannon (Stockholm University) and Dr. Bronwyn Evans (Monash University, Parkville, VIC, Australia) for valuable discussions and help. In addition, the authors thank Professor Jeffrey E. Pessin at the Albert Einstein College of Medicine (New York, NY) for GLUT4 constructs, and Professor Amira Klip at the Hospital for Sick Children (Toronto, ON, Canada) for providing L6-GLUT4-myc cells. Torin1 was kindly provided by D.M. Sabatini (Whitehead Institute for Biomedical Research, Cambridge, MA). The authors thank Professor Gustav Dallner (Stockholm University) for providing them with the GK rats and Dr. Natasa Petrovic (Stockholm University) for providing them with high-fat diet–induced diabetic mice.

Funding. M.S. is supported by the Wenner-Gren Foundation, Australian Research Council Linkage International Fellowship LX0989791, and National Health and Medical Research Council (NHMRC) CJ Martin Overseas Biomedical Fellowship 606763. N.D. is supported by the Swedish Society for Medical Research. A.I.Ö. is supported by the Henning and Johan Throne-Holst Foundation. R.J.S. is supported by NHMRC Program Grant 519461. D.S.H. is supported by NHMRC Career Development Fellowship 545952. T.B. is supported by the Ventenskapsrådet-Medicin (VR-M) from the Swedish Research Council, Novo Nordisk Fonden, Stiftelsen Svenska Diabetesförbundets Forskningsfond, the Magnus Bergvall Foundation, and the Carl Tryggers Foundation.

Duality of Interest. No potential conflicts of interest relevant to this article were reported.

Author Contributions. M.S., N.D., and A.I.Ö. wrote the manuscript and researched data. O.S.D., A.L.S., J.M.O., and R.I.C. researched the data. R.J.S. and T.B. reviewed and edited the manuscript. D.S.H. reviewed and edited the manuscript and researched the data. T.B. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

1.
Zimmet
P
,
Alberti
KG
,
Shaw
J
.
Global and societal implications of the diabetes epidemic
.
Nature
2001
;
414
:
782
787
[PubMed]
2.
Abe
H
,
Minokoshi
Y
,
Shimazu
T
.
Effect of a β3-adrenergic agonist, BRL35135A, on glucose uptake in rat skeletal muscle in vivo and in vitro
.
J Endocrinol
1993
;
139
:
479
486
[PubMed]
3.
Hutchinson
DS
,
Bengtsson
T
.
AMP-activated protein kinase activation by adrenoceptors in L6 skeletal muscle cells: mediation by α1-adrenoceptors causing glucose uptake
.
Diabetes
2006
;
55
:
682
690
[PubMed]
4.
Hutchinson
DS
,
Bengtsson
T
.
α1A-adrenoceptors activate glucose uptake in L6 muscle cells through a phospholipase C-, phosphatidylinositol-3 kinase-, and atypical protein kinase C-dependent pathway
.
Endocrinology
2005
;
146
:
901
912
[PubMed]
5.
Liu
YL
,
Stock
MJ
.
Acute effects of the β3-adrenoceptor agonist, BRL 35135, on tissue glucose utilisation
.
Br J Pharmacol
1995
;
114
:
888
894
[PubMed]
6.
Nevzorova
J
,
Bengtsson
T
,
Evans
BA
,
Summers
RJ
.
Characterization of the β-adrenoceptor subtype involved in mediation of glucose transport in L6 cells
.
Br J Pharmacol
2002
;
137
:
9
18
[PubMed]
7.
Nevzorova
J
,
Evans
BA
,
Bengtsson
T
,
Summers
RJ
.
Multiple signalling pathways involved in β2-adrenoceptor-mediated glucose uptake in rat skeletal muscle cells
.
Br J Pharmacol
2006
;
147
:
446
454
[PubMed]
8.
Ngala
RA
,
O’Dowd
J
,
Wang
SJ
, et al
.
Metabolic responses to BRL37344 and clenbuterol in soleus muscle and C2C12 cells via different atypical pharmacologies and β2-adrenoceptor mechanisms
.
Br J Pharmacol
2008
;
155
:
395
406
[PubMed]
9.
Ngala
RA
,
O’Dowd
J
,
Wang
SJ
,
Stocker
C
,
Cawthorne
MA
,
Arch
JR
.
β2-adrenoceptors and non-β-adrenoceptors mediate effects of BRL37344 and clenbuterol on glucose uptake in soleus muscle: studies using knockout mice
.
Br J Pharmacol
2009
;
158
:
1676
1682
[PubMed]
10.
Tanishita
T
,
Shimizu
Y
,
Minokoshi
Y
,
Shimazu
T
.
The β3-adrenergic agonist BRL37344 increases glucose transport into L6 myocytes through a mechanism different from that of insulin
.
J Biochem
1997
;
122
:
90
95
[PubMed]
11.
Emery
PW
,
Rothwell
NJ
,
Stock
MJ
,
Winter
PD
.
Chronic effects of β2-adrenergic agonists on body composition and protein synthesis in the rat
.
Biosci Rep
1984
;
4
:
83
91
[PubMed]
12.
Castle
A
,
Yaspelkis
BB
 3rd
,
Kuo
CH
,
Ivy
JL
.
Attenuation of insulin resistance by chronic β2-adrenergic agonist treatment possible muscle specific contributions
.
Life Sci
2001
;
69
:
599
611
[PubMed]
13.
Pan
SJ
,
Hancock
J
,
Ding
Z
,
Fogt
D
,
Lee
M
,
Ivy
JL
.
Effects of clenbuterol on insulin resistance in conscious obese Zucker rats
.
Am J Physiol Endocrinol Metab
2001
;
280
:
E554
E561
[PubMed]
14.
Elayan
H
,
Milic
M
,
Sun
P
,
Gharaibeh
M
,
Ziegler
MG
.
Chronic β2 adrenergic agonist, but not exercise, improves glucose handling in older type 2 diabetic mice
.
Cell Mol Neurobiol
2012
;
32
:
871
877
[PubMed]
15.
Lee
P
,
Day
RO
,
Greenfield
JR
,
Ho
KK
.
Formoterol, a highly β2-selective agonist, increases energy expenditure and fat utilisation in men
.
Int J Obes (Lond)
2013
;
37
:
593
597
[PubMed]
16.
Gupta
AK
,
Dahlof
B
,
Dobson
J
,
Sever
PS
,
Wedel
H
,
Poulter
NR
Anglo-Scandinavian Cardiac Outcomes Trial Investigators
.
Determinants of new-onset diabetes among 19,257 hypertensive patients randomized in the Anglo-Scandinavian Cardiac Outcomes Trial—Blood Pressure Lowering Arm and the relative influence of antihypertensive medication
.
Diabetes Care
2008
;
31
:
982
988
[PubMed]
17.
Ren
JM
,
Marshall
BA
,
Gulve
EA
, et al
.
Evidence from transgenic mice that glucose transport is rate-limiting for glycogen deposition and glycolysis in skeletal muscle
.
J Biol Chem
1993
;
268
:
16113
16115
[PubMed]
18.
Minokoshi
Y
,
Okano
Y
,
Shimazu
T
.
Regulatory mechanism of the ventromedial hypothalamus in enhancing glucose uptake in skeletal muscles
.
Brain Res
1994
;
649
:
343
347
[PubMed]
19.
Tiihonen
K
,
Nikinmaa
M
,
Lappivaara
J
.
Glucose transport in carp erythrocytes: individual variation and effects of osmotic swelling, extracellular pH and catecholamines
.
J Exp Biol
1995
;
198
:
577
583
[PubMed]
20.
Dallner
OS
,
Chernogubova
E
,
Brolinson
KA
,
Bengtsson
T
.
β3-adrenergic receptors stimulate glucose uptake in brown adipocytes by two mechanisms independently of glucose transporter 4 translocation
.
Endocrinology
2006
;
147
:
5730
5739
[PubMed]
21.
Yamamoto
DL
,
Hutchinson
DS
,
Bengtsson
T
.
β(2)-Adrenergic activation increases glycogen synthesis in L6 skeletal muscle cells through a signalling pathway independent of cyclic AMP
.
Diabetologia
2007
;
50
:
158
167
[PubMed]
22.
Lynch
GS
,
Ryall
JG
.
Role of β-adrenoceptor signaling in skeletal muscle: implications for muscle wasting and disease
.
Physiol Rev
2008
;
88
:
729
767
[PubMed]
23.
Rohrer
DK
,
Chruscinski
A
,
Schauble
EH
,
Bernstein
D
,
Kobilka
BK
.
Cardiovascular and metabolic alterations in mice lacking both β1- and β2-adrenergic receptors
.
J Biol Chem
1999
;
274
:
16701
16708
[PubMed]
24.
Ayala
JE
,
Samuel
VT
,
Morton
GJ
, et al
NIH Mouse Metabolic Phenotyping Center Consortium
.
Standard operating procedures for describing and performing metabolic tests of glucose homeostasis in mice
.
Dis Model Mech
2010
;
3
:
525
534
[PubMed]
25.
Marshall
S
,
Garvey
WT
,
Geller
M
.
Primary culture of isolated adipocytes. A new model to study insulin receptor regulation and insulin action
.
J Biol Chem
1984
;
259
:
6376
6384
[PubMed]
26.
Yu
ZW
,
Jansson
PA
,
Posner
BI
,
Smith
U
,
Eriksson
JW
.
Peroxovanadate and insulin action in adipocytes from NIDDM patients. Evidence against a primary defect in tyrosine phosphorylation
.
Diabetologia
1997
;
40
:
1197
1203
[PubMed]
27.
Lindquist
JM
,
Fredriksson
JM
,
Rehnmark
S
,
Cannon
B
,
Nedergaard
J
.
β3- and α1-adrenergic Erk1/2 activation is Src- but not Gi-mediated in Brown adipocytes
.
J Biol Chem
2000
;
275
:
22670
22677
[PubMed]
28.
Dehvari
N
,
Hutchinson
DS
,
Nevzorova
J
, et al
.
β(2)-adrenoceptors increase translocation of GLUT4 via G protein-coupled receptor kinase sites in the receptor C-terminal tail
.
Br J Pharmacol
2012
;
165
:
1442
1456
29.
Rowland
AF
,
Fazakerley
DJ
,
James
DE
.
Mapping insulin/GLUT4 circuitry
.
Traffic
2011
;
12
:
672
681
[PubMed]
30.
Kozikowski
AP
,
Sun
H
,
Brognard
J
,
Dennis
PA
.
Novel PI analogues selectively block activation of the pro-survival serine/threonine kinase Akt
.
J Am Chem Soc
2003
;
125
:
1144
1145
[PubMed]
31.
Castillo
SS
,
Brognard
J
,
Petukhov
PA
, et al
.
Preferential inhibition of Akt and killing of Akt-dependent cancer cells by rationally designed phosphatidylinositol ether lipid analogues
.
Cancer Res
2004
;
64
:
2782
2792
[PubMed]
32.
Vlahos
CJ
,
Matter
WF
,
Hui
KY
,
Brown
RF
.
A specific inhibitor of phosphatidylinositol3-kinase, 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002)
.
J Biol Chem
1994
;
5241
5248
[PubMed]
33.
Gharbi
SI
,
Zvelebil
MJ
,
Shuttleworth
SJ
, et al
.
Exploring the specificity of the PI3K family inhibitor LY294002
.
Biochem J
2007
;
404
:
15
21
[PubMed]
34.
Knight
ZA
,
Gonzalez
B
,
Feldman
ME
, et al
.
A pharmacological map of the PI3-K family defines a role for p110α in insulin signaling
.
Cell
2006
;
125
:
733
747
[PubMed]
35.
Copp
J
,
Manning
G
,
Hunter
T
.
TORC-specific phosphorylation of mammalian target of rapamycin (mTOR): phospho-Ser2481 is a marker for intact mTOR signaling complex 2
.
Cancer Res
2009
;
69
:
1821
1827
[PubMed]
36.
Taverna
RD
,
Langdon
RG
.
Reversible association of cytochalasin B with the human erythrocyte membrane. Inhibition of glucose transport and the stoichiometry of cytochalasin binding
.
Biochim Biophys Acta
1973
;
323
:
207
219
[PubMed]
37.
Rudich
A
,
Konrad
D
,
Török
D
, et al
.
Indinavir uncovers different contributions of GLUT4 and GLUT1 towards glucose uptake in muscle and fat cells and tissues
.
Diabetologia
2003
;
46
:
649
658
[PubMed]
38.
Sobel
ME
,
Wolfson
EB
,
Krulwich
TA
.
Abolition of crypticity of Arthrobacter pyridinolis toward glucose and alpha-glucosides by tricarboxylic acid cycle intermediates
.
J Bacteriol
1973
;
116
:
271
278
[PubMed]
39.
Sarabia
V
,
Ramlal
T
,
Klip
A
.
Glucose uptake in human and animal muscle cells in culture
.
Biochem Cell Biol
1990
;
68
:
536
542
[PubMed]
40.
Ploug
T
,
Galbo
H
,
Vinten
J
,
Jørgensen
M
,
Richter
EA
.
Kinetics of glucose transport in rat muscle: effects of insulin and contractions
.
Am J Physiol
1987
;
253
:
E12
E20
[PubMed]
41.
Rattigan
S
,
Appleby
GJ
,
Edwards
SJ
, et al
.
α-adrenergic receptors in rat skeletal muscle
.
Biochem Biophys Res Commun
1986
;
136
:
1071
1077
[PubMed]
42.
Kumar
A
,
Harris
TE
,
Keller
SR
,
Choi
KM
,
Magnuson
MA
,
Lawrence
JC
 Jr
.
Muscle-specific deletion of rictor impairs insulin-stimulated glucose transport and enhances Basal glycogen synthase activity
.
Mol Cell Biol
2008
;
28
:
61
70
[PubMed]
43.
Kumar
A
,
Lawrence
JC
 Jr
,
Jung
DY
, et al
.
Fat cell-specific ablation of rictor in mice impairs insulin-regulated fat cell and whole-body glucose and lipid metabolism
.
Diabetes
2010
;
59
:
1397
1406
[PubMed]
44.
Lee
S
,
Comer
FI
,
Sasaki
A
, et al
.
TOR complex 2 integrates cell movement during chemotaxis and signal relay in Dictyostelium
.
Mol Biol Cell
2005
;
16
:
4572
4583
[PubMed]
45.
Cai
H
,
Das
S
,
Kamimura
Y
,
Long
Y
,
Parent
CA
,
Devreotes
PN
.
Ras-mediated activation of the TORC2-PKB pathway is critical for chemotaxis
.
J Cell Biol
2010
;
190
:
233
245
[PubMed]
46.
Kamimura
Y
,
Xiong
Y
,
Iglesias
PA
,
Hoeller
O
,
Bolourani
P
,
Devreotes
PN
.
PIP3-independent activation of TorC2 and PKB at the cell’s leading edge mediates chemotaxis
.
Curr Biol
2008
;
18
:
1034
1043
[PubMed]
47.
Wang
L
,
Gout
I
,
Proud
CG
.
Cross-talk between the ERK and p70 S6 kinase (S6K) signaling pathways. MEK-dependent activation of S6K2 in cardiomyocytes
.
J Biol Chem
2001
;
276
:
32670
32677
[PubMed]
48.
Hou
X
,
Arvisais
EW
,
Davis
JS
.
Luteinizing hormone stimulates mammalian target of rapamycin signaling in bovine luteal cells via pathways independent of AKT and mitogen-activated protein kinase: modulation of glycogen synthase kinase 3 and AMP-activated protein kinase
.
Endocrinology
2010
;
151
:
2846
2857
[PubMed]
49.
Sylow
L
,
Jensen
TE
,
Kleinert
M
, et al
.
Rac1 signaling is required for insulin-stimulated glucose uptake and is dysregulated in insulin-resistant murine and human skeletal muscle
.
Diabetes
2013
;
62
:
1865
1875
[PubMed]
50.
Sylow
L
,
Jensen
TE
,
Kleinert
M
, et al
.
Rac1 is a novel regulator of contraction-stimulated glucose uptake in skeletal muscle
.
Diabetes
2013
;
62
:
1139
1151
[PubMed]
51.
Öberg
AI
,
Dehvari
N
,
Bengtsson
T
.
β-Adrenergic inhibition of contractility in L6 skeletal muscle cells
.
PLoS ONE
2011
;
6
:
e22304
[PubMed]
52.
Cybulski
N
,
Hall
MN
.
TOR complex 2: a signaling pathway of its own
.
Trends Biochem Sci
2009
;
34
:
620
627
[PubMed]
53.
Fröjdö
S
,
Vidal
H
,
Pirola
L
.
Alterations of insulin signaling in type 2 diabetes: a review of the current evidence from humans
.
Biochim Biophys Acta
2009
;
1792
:
83
92
[PubMed]
54.
Zhang
W
,
Yano
N
,
Deng
M
,
Mao
Q
,
Shaw
SK
,
Tseng
YT
.
β-Adrenergic receptor-PI3K signaling crosstalk in mouse heart: elucidation of immediate downstream signaling cascades
.
PLoS One
2011
;
6
:
e26581
[PubMed]

Supplementary data