The absence of insulin results in oscillating hyperglycemia and ketoacidosis in type 1 diabetes. Remarkably, mice genetically deficient in the glucagon receptor (Gcgr) are refractory to the pathophysiological symptoms of insulin deficiency, and therefore, studies interrogating this unique model may uncover metabolic regulatory mechanisms that are independent of insulin. A significant feature of Gcgr-null mice is the high circulating concentrations of GLP-1. Hence, the objective of this report was to investigate potential noninsulinotropic roles of GLP-1 in mice where GCGR signaling is inactivated. For these studies, pancreatic β-cells were chemically destroyed by streptozotocin (STZ) in Gcgr−/−:Glp-1r−/− mice and in Glp-1r−/− animals that were subsequently treated with a high-affinity GCGR antagonist antibody that recapitulates the physiological state of Gcgr ablation. Loss of GLP-1 action substantially worsened nonfasting glucose concentrations and glucose tolerance in mice deficient in, and undergoing pharmacological inhibition of, the GCGR. Further, lack of the Glp-1r in STZ-treated Gcgr−/− mice elevated rates of endogenous glucose production, likely accounting for the differences in glucose homeostasis. These results support the emerging hypothesis that non–β-cell actions of GLP-1 analogs may improve metabolic control in patients with insulinopenic diabetes.

Type 1 diabetes is a life-threatening syndrome resulting from unbridled hepatic glycogenolysis, gluconeogenesis, and ketogenesis that perpetuate a state of chronic fuel utilization (1). Manifestation of this condition occurs due to loss of the anabolic effects of insulin on glucose and lipid metabolism (1). A significant contributor to the dysregulated physiological state is the absence of the inhibitory effect insulin imposes on glucagon secretion (27). The effect of excess glucagon is significant because of the broad stimulatory actions glucagon has on catabolic processes in the liver and the hyperglucagonemia that is present in poorly controlled diabetes (8,9). Thus, due to its role in exacerbating the metabolic consequences of insulinopenia, glucagon was proposed several years ago to be an essential component in the pathogenesis of type 1 diabetes (10,11). Therefore, to improve glucose homeostasis in the absence of insulin, therapies that suppress glucagon secretion or block its action may improve overall glycemia by reducing the effect of a primary stimulus of endogenous glucose production (EGP).

Bolstering the now long-standing hypothesis that suppressing glucagon action would have antihyperglycemic effects are studies revealing the remarkable metabolic phenotype of glucagon receptor (Gcgr) knockout mice. Although these animals have extraordinarily high circulating concentrations of glucagon and pancreatic α-cell hyperplasia, Gcgr-deficient mice display lower blood glucose levels, improved glucose tolerance, and have reduced adiposity (12,13). Gcgr−/− animals also have slower gastric emptying and are resistant to diet-induced obesity (13,14). Compelling evidence exists supporting the concept that glucagon inhibition would improve glycemic control in the state of insulin deficiency.

Studies have demonstrated that Gcgr−/− mice administered the diabetogenic chemical agent streptozotocin (STZ), a cytotoxic glucose analog that induces necrotic destruction of pancreatic β-cells (15), are resistant to STZ-induced hyperglycemia (14). This discovery is provocative and has many potential implications; however, the STZ treatment failed to abolish plasma insulin concentrations and staining for insulin-positive cells in the pancreata of STZ-treated Gcgr−/− animals (14). To cause maximal β-cell loss, Unger and colleagues (16) established a high-dose STZ treatment regimen that resulted in nearly complete β-cell destruction in Gcgr−/− mice. Importantly, these studies show the metabolic maladies that result from insulinopenia, especially profound hyperglycemia and hyperketonemia, do not develop in animals lacking the GCGR (16). Together, data from these experiments support a substantial role of glucagon signaling in the metabolic phenotype of insulin deficiency.

Although experiments using the high-dose STZ protocol to induce β-cell destruction in Gcgr-null mice were well designed, protection from insulinopenic hyperglycemia in this model may result from a combination of factors and not solely as a consequence of the direct loss of GCGR function. The initial characterization of Gcgr−/− mice demonstrated that these animals have high circulating concentrations of the antidiabetogenic peptide GLP-1, likely generated by proteolytic processing of the high levels of proglucagon within the hyperplastic α-cells (12). Consistent with this compensatory α-cell hyperplasia in Gcgr−/− animals, concomitant elevation of plasma GLP-1 also occurs with progressive hyperglucagonemia in studies where GCGR antagonism is pharmacologically achieved (17,18). Omar et al. (19) recently provided data supporting a contributing role for GLP-1 in glucose homeostasis of STZ-treated Gcgr−/− mice by showing animals administered the GLP-1 receptor (GLP-1R) peptide antagonist, exendin-4(9-39), display poorer glucose tolerance compared with animals that had not received the antagonist. This report also indicated circulating levels of fibroblast growth factor 21 (FGF21) are increased in Gcgr−/− mice, a finding paradoxical to other studies showing activation of the GCGR increases hepatic and circulating FGF21 levels (20,21). The combination of exendin-4(9-39) and FGF21 antisera worsened the glucose excursion for animals undergoing an oral glucose tolerance test (OGTT) (19). These experiments exemplify the potential importance of fundamentally understanding the mechanisms whereby Gcgr−/− mice are refractory to insulin deficiency and may enable new proposals of alternate treatment regimens for type 1 diabetes.

The significance of glucagon action during insulinopenia is further demonstrated in elegant studies showing that replenishment of hepatic GCGR using an adenovirus system causes severe hyperglycemia in euglycemic, insulin-deficient Gcgr−/− mice and that once expression of GCGR wanes, euglycemia reappears (22). Although these studies support the hypothesis of glucagon-induced hyperglycemia as the main driver of diabetes, it remains clear that there are multiple metabolic responses to Gcgr deficiency, some of which may contribute to ameliorating hyperglycemia in this model. Therefore, this unique phenotype should be fully interrogated to investigate the importance of factors that appear dysregulated as a result of the loss of Gcgr. Owing to the role of GLP-1 in glucose metabolism (23) and its high circulating levels in Gcgr−/− mice (12) as well as in animals administered GCGR antagonists (17,18), we investigated the physiological consequences of Glp-1r ablation in insulin-deficient Gcgr−/− mice and in insulinopenic wild-type and Glp-1r−/− animals treated with a high-affinity GCGR antagonist antibody. Results from these studies suggest that interventions to improve glucose control in the absence of insulin may benefit greatly from adjunctive therapies that block glucagon action and activate GLP-1R signaling.

Animals

All mouse models were generated by Eli Lilly and Company in collaboration with Taconic (Hudson, NY). Glp-1r−/− mice were previously described (24) and bred with Gcgr+/− mice licensed from Deltagen (San Mateo, CA) to produce double heterozygous Gcgr+/−:Glp-1r+/− breeders that produced littermates with the following genotypes: Gcgr+/+:Glp-1r+/+ (wild-type); Gcgr+/+:Glp-1r−/− (Glp-1r−/−); Gcgr−/−:Glp-1r+/+ (Gcgr−/−); and Gcgr−/−:Glp-1r−/− double knockout (DKO) mice. PCR genotyping for the Gcgr allele was performed with the following primers (5′-3′): wild-type allele –T648S GTTGAGGAAACAGTAGAGAACAGCC and T648W ACCCTCATCCCTCTGCTGGGGGTCC; mutant allele –T648S and NEO3195 GGGCCAGCTCATTCCTCCCACTCAT. Genotyping for the Glp-1r allele has been described (24).

All mice were singly housed and fed a standard chow diet (Teklad 2014; Harlan Laboratories, Indianapolis, IN) with bottled water ad libitum in a 12 h light/12 h dark cycle (lights off at 1800). Animals were maintained in accordance with the Eli Lilly and Company Institutional Animal Care and Use Committee and the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

GCGR Models: Genetic Deletion and Pharmacological Blockade

Animals in the Gcgr ablation models were fasted for 4 h in the morning and injected intraperitoneally with 130 mg/kg STZ (Sigma-Aldrich, St. Louis, MO). This dose caused severe hyperglycemia in wild-type and Glp-1r−/− mice, whereas the Gcgr−/− and DKO animals remained healthy. Because the pharmacological GCGR blockade cohort of wild-type and Glp-1−/− mice was a chronic study, a three-dose paradigm of lower STZ was used with a once-weekly STZ dose of 110–115 mg/kg (or 10 mL/kg citrate vehicle) over 3 weeks. Diabetic animals (blood glucose ≥400 mg/dL) were randomized into groups for weekly anti-GCGR human IgG4 antibody (Ab-4) (25) or IgG4 isotype control subcutaneous injections of 10 mg/kg. The treatment dose was selected based on previous studies in hyperglycemic ZDF rats (25). The concentration of Ab-4 (molecular weight = 143,965 g/mol) was determined in solution by measuring ultraviolet light absorbance (280 nm) and calculated using the molar extinction coefficient of the antibody amino acid sequence. Antibody activity was measured by homogeneous time-resolved fluorescence cAMP assays (Cisbio Assays, Bedford, MA) using HEK293 cells expressing the mouse GCGR or GLP-1R. These assays demonstrated the ability of Ab-4 to block glucagon action.

In Vivo Physiology and Immunohistochemistry

OGTTs were performed in mice fasted overnight for 16 h and orally gavaged with 2 g/kg glucose (24). For pancreatic hormone extraction, the entire pancreas was removed and homogenized in acid ethanol. After centrifugation, supernatants were analyzed for hormone content. Plasma, serum, and pancreatic insulin, glucagon, and GLP-1 were measured using electrochemiluminescence assays (Meso Scale Discovery, Rockville, MD). For pancreas immunohistochemistry, the whole pancreas was removed and fixed in 10% neutral buffered formalin, followed by paraffin embedding. Pancreata were sectioned at 5 µm, and slides were serially stained for insulin and glucagon with hematoxylin counterstain. Gastric emptying tests were performed using mice that were fasted for 16 h and then administered a semiliquid diet containing acetaminophen via oral gavage. The animals were then bled at 0, 30, 60, and 120 min via tail vein, and plasma acetaminophen concentrations were measured using mass spectrometry.

Measurement of EGP

One week before EGP measurements, Gcgr−/− and DKO mice were treated with 130 mg/kg STZ. Four days before EGP was assessed, catheters were placed in the left carotid artery and advanced to the aortic arch and in the right jugular vein and advanced to the right atrium. Animals were fasted overnight and allowed to acclimate to study cages for 2 h. All studies lasted 2 h. A bolus/continuous infusion of 3-3H-glucose (6 μCi bolus and 0.1 μCi/min; PerkinElmer, Waltham, MA) was initiated and maintained throughout the test period. Arterial blood was obtained every 15 min to determine glucose concentrations. Blood was collected at the beginning and end of the 3-3H-glucose infusion to monitor hematocrit and plasma insulin and to determine basal EGP.

Statistical Analyses

Graphing and statistical analyses were performed using GraphPad Prism software. Data are presented as mean ± SEM and were compared using ANOVA, followed by the Dunnett test. Repeated-measures ANOVA was used to assess significance between time courses. The statistical significance threshold was set at P ≤ 0.05.

The Glp-1r Is Required for Euglycemia in Insulinopenic Gcgr−/− Mice

Previous studies show that Gcgr−/− mice are resistant to STZ-induced hyperglycemia (14,17). Blockade of GCGR, whether by genetic deletion or pharmacological antagonism, leads to expansion of pancreatic α-cells due to the loss of an uncharacterized glucagon-mediated negative feedback mechanism. As a result, plasma concentrations of α-cell–derived glucagon and GLP-1 rise dramatically (Table 1) (17,26). Because GLP-1R activation helps regulate glucose homeostasis (2629), we investigated whether GLP-1R expression plays a role in maintaining euglycemia in insulin-deficient Gcgr−/− mice. For these studies, Glp-1r−/− mice were crossed with Gcgr+/− mice to produce double heterozygous breeders that enabled the generation of animals lacking both genes. To induce insulin deficiency, wild-type, Glp-1r−/−, Gcgr−/−, and DKO animals were administered high-dose STZ (130 mg/kg) and evaluated over the next 7 days. Nonfasted glucose concentrations became pathologically high in wild-type and Glp-1r−/− mice, and therefore, these animals were removed from the study (Fig. 1A). As expected, Gcgr−/− mice displayed unchanged glucose concentrations after STZ administration (Fig. 1A), even with a dramatic decrease in pancreatic insulin content (Fig. 1D). Although glucose concentrations in DKO mice after STZ treatment were lower than in wild-type and Glp-1r−/− animals, these mice showed significantly higher glucose concentrations compared with Gcgr−/− mice, indicating the GLP-1R is needed for post-STZ euglycemia in the Gcgr−/− animal (Fig. 1A).

Table 1

Plasma concentrations of GLP-1 and glucagon in wild-type and loss-of-function models

Wild-typeGlp-1r−/−Gcgr−/−DKO
Total GLP-1 (pg/mL) 32.2 ± 4.8 30.9 ± 7.7 95.9 ± 13.1* 144.6 ± 5.8* 
Glucagon (pg/mL) 62.1 ± 35.0 (6/8 <LLOQ50.4 ± 10.4 (6/8 <LLOQ11,604 ± 1,947 3,451 ± 513 
Wild-typeGlp-1r−/−Gcgr−/−DKO
Total GLP-1 (pg/mL) 32.2 ± 4.8 30.9 ± 7.7 95.9 ± 13.1* 144.6 ± 5.8* 
Glucagon (pg/mL) 62.1 ± 35.0 (6/8 <LLOQ50.4 ± 10.4 (6/8 <LLOQ11,604 ± 1,947 3,451 ± 513 

*P ≤ 0.05 one-way ANOVA with Tukey post hoc test.

†Six of eight animals had glucagon levels lower than the lower limit of quantitation (LLOQ) of 14 pg/mL; only the measurable values are reported. Statistical analysis was not performed because the data set was incomplete.

Figure 1

GLP-1R is required for post-STZ euglycemia in Gcgr−/− mice. A: Nonfasted blood glucose concentrations pre-STZ and 7 days after STZ administration (n = 9–10 per group). WT, wild-type. ****P ≤ 0.0001 by two-way ANOVA, Gcgr−/− vs. DKO 7 days post-STZ. B: Blood glucose concentrations during an OGTT (n = 6–10 per group). *P ≤ 0.05 by two-way ANOVA, DKO pre-STZ vs. DKO 7 days post-STZ. C: GSIS during an OGTT (dotted line indicates assay lower limit of quantitation). D: Pancreata harvested from Gcgr−/− and DKO mice before and 7 days after STZ administration (blue, glucagon; brown, insulin; original magnification ×20).

Figure 1

GLP-1R is required for post-STZ euglycemia in Gcgr−/− mice. A: Nonfasted blood glucose concentrations pre-STZ and 7 days after STZ administration (n = 9–10 per group). WT, wild-type. ****P ≤ 0.0001 by two-way ANOVA, Gcgr−/− vs. DKO 7 days post-STZ. B: Blood glucose concentrations during an OGTT (n = 6–10 per group). *P ≤ 0.05 by two-way ANOVA, DKO pre-STZ vs. DKO 7 days post-STZ. C: GSIS during an OGTT (dotted line indicates assay lower limit of quantitation). D: Pancreata harvested from Gcgr−/− and DKO mice before and 7 days after STZ administration (blue, glucagon; brown, insulin; original magnification ×20).

Before STZ treatment, Gcgr−/− and DKO mice displayed similar oral glucose tolerance and glucose-stimulated insulin secretion (GSIS) during OGTTs (Fig. 1B). Lack of the Glp-1r did not affect oral glucose tolerance in nondiabetic DKO animals, likely due to the compensatory upregulation of other incretin pathways upon Glp-1r ablation (30). In an OGTT 1 week after STZ administration, Gcgr−/− mice continued to show rapid glucose clearance; however, STZ-treated DKO animals displayed marked glucose intolerance (area under the curve [AUC] = 1,571 mg/dL/min) compared with Gcgr−/− mice (AUC = 647 mg/dL/min) and compared with their pre-STZ treatment profile (AUC = 919 mg/dL/min; Fig. 1B). These results are similar to those showing acute blockade of the GLP-1R using exendin-4(9-39) worsens glucose tolerance in STZ-treated Gcgr-null mice (19). An assessment of gastric emptying between the two STZ-treated genotypes failed to show any difference (plasma acetaminophen AUC(0–2h): Gcgr−/− 23.0 ± 1.7, and DKO 25.4 ± 1.8 μg ⋅ h/mL). Importantly, there was no GSIS in the Gcgr−/− or DKO animals, further indicating both groups became insulin-deficient (Fig. 1C).

To show near-maximum β-cell loss occurred in both genotypes, immunohistochemistry staining for insulin and glucagon was performed on pancreata from nondiabetic mice and 1-week after STZ administration (Fig. 1D). As previously shown, Gcgr ablation caused marked α-cell hyperplasia. STZ-treated animals exhibited profound β-cell loss after STZ treatment, regardless of genotype (Fig. 1D). Body composition was also measured to investigate evidence of differential insulin-mediated lipogenesis between the groups, and there were no differences in adipose or lean mass between Gcgr−/− and DKO animals before or after STZ administration (data not shown). Furthermore, plasma concentrations of FGF21 were not different between these groups (data not shown). Finally, pancreatic insulin, GLP-1 (total), and glucagon levels were similar in Gcgr−/− and DKO animals after STZ treatment (Table 2).

Table 2

Pancreatic hormone levels in genetic and pharmacological Gcgr loss-of-function models

STZ-treated
Wild-type
Glp-1r−/−
Gcgr−/−DKOCitrate+IgG4STZ+IgG4STZ+Ab-4STZ+Ab-4
Insulin (ng) 347 ± 88* 278 ± 37* 1,954 ± 737 30 ± 8* 169 ± 28* 58 ± 18* 
Total GLP-1 (pg) 15,155 ± 895* 18,284 ± 8,585* 332 ± 62 333 ± 64 2,224 ± 215 4,879 ± 583 
Glucagon (pg) 259,516 ± 21,933* 371,341 ± 12,702* 5,639 ± 1,116 5,180 ± 1,549 200,375 ± 34,648* 243,613 ± 28,626* 
STZ-treated
Wild-type
Glp-1r−/−
Gcgr−/−DKOCitrate+IgG4STZ+IgG4STZ+Ab-4STZ+Ab-4
Insulin (ng) 347 ± 88* 278 ± 37* 1,954 ± 737 30 ± 8* 169 ± 28* 58 ± 18* 
Total GLP-1 (pg) 15,155 ± 895* 18,284 ± 8,585* 332 ± 62 333 ± 64 2,224 ± 215 4,879 ± 583 
Glucagon (pg) 259,516 ± 21,933* 371,341 ± 12,702* 5,639 ± 1,116 5,180 ± 1,549 200,375 ± 34,648* 243,613 ± 28,626* 

†Values are shown as the amount per grams of pancreas/grams of body weight.

*P ≤ 0.05 by one-way ANOVA with Tukey post hoc test.

GCGR Antagonist-Mediated Glucose Normalization in STZ-Induced Diabetes Requires the Glp-1r

The genetic results provide compelling evidence that a functional GLP-1R in Gcgr-null mice is needed to protect against hyperglycemia in the insulin-deficient state. To further evaluate the mechanism by which blockade of glucagon action improves glucose control, a high-affinity GCGR monoclonal antibody antagonist, Ab-4 (25), was used to investigate whether therapeutic intervention would reverse diabetes. Ab-4 shows potent antagonism of glucagon-induced cAMP accumulation in HEK293 cells expressing the mouse GCGR (Kb = 0.76 nmol/L) (Fig. 2A); these data are consistent with previously reported results for Ab-4 in mouse GCGR-containing membrane-binding assays (Ki = 0.83 nmol/L) (25). Ab-4 showed no antagonism of the mouse GLP-1R (Fig. 2B). For the in vivo studies, STZ-induced diabetes was established in wild-type and Glp-1r−/− mice, and animals were administered Ab-4 once weekly for 7 weeks. To avoid the lethal hyperglycemia observed for these genotypes (Fig. 1A), the STZ treatment paradigm used here resulted in more restrained hyperglycemia, thereby allowing the vehicle/control IgG4-treated mice to survive the study period. Using this approach, in addition to investigating the therapeutic potential of Ab-4 to improve hyperglycemia in diabetic wild-type animals, we pharmacologically recapitulated Gcgr ablation in a Glp-1r–null background. STZ-treated wild-type and Glp-1r−/− animals were randomized according to their nonfasted blood glucose concentrations into three treatment groups: wild-type (STZ+IgG4), wild-type (STZ+Ab-4), and Glp-1r−/− (STZ+Ab-4). Also included was a nondiabetic wild-type control group that received only citrate injection initially, followed by weekly administration of the isotype control IgG4 (Fig. 3A). Hyperglycemia was quickly established in STZ-treated animals. Untreated, diabetic wild-type (STZ+IgG4) mice remained hyperglycemic throughout the study (Fig. 3A), whereas Ab-4–treated insulinopenic wild-type (STZ+Ab-4) animals showed normalization of nonfasted blood glucose concentrations after the first antibody dose and remained similar to nondiabetic wild-type controls (Fig. 3A). The Glp-1r−/− (STZ+Ab-4) group, with pharmacologically blocked GCGR and genetically ablated Glp-1r, experienced marked glucose lowering compared with the wild-type animals (STZ+IgG4); however, their blood glucose levels remained significantly elevated compared with the wild-type (STZ+Ab-4) mice similarly treated with the antibody (Fig. 3A).

Figure 2

The GCGR monoclonal antibody Ab-4 blocks glucagon activity at the mouse GCGR. A: Glucagon-induced cAMP accumulation in HEK293 cells expressing the mouse GGCR is inhibited by Ab-4 (Kb = 0.76 nmol/L). B: Ab-4 does not inhibit GLP-1-induced cAMP accumulation in HEK293 cells expressing the mouse GLP-1R.

Figure 2

The GCGR monoclonal antibody Ab-4 blocks glucagon activity at the mouse GCGR. A: Glucagon-induced cAMP accumulation in HEK293 cells expressing the mouse GGCR is inhibited by Ab-4 (Kb = 0.76 nmol/L). B: Ab-4 does not inhibit GLP-1-induced cAMP accumulation in HEK293 cells expressing the mouse GLP-1R.

Figure 3

GCGR blockade improves glucose tolerance in diabetic wild-type (WT) but not Glp-1r−/− mice. A: Weekly nonfasted blood glucose levels over a 7-week treatment period of the GCGR antibody Ab-4 (n = 11–18 per group). *P ≤ 0.001 by two-way ANOVA vs. WT citrate+IgG4; #P ≤ 0.05 by two-way ANOVA vs. WT STZ+Ab-4. B: OGTT performed on the sixth week of antibody treatment (n = 4–5 per group). *P ≤ 0.05 for WT STZ+IgG4 vs. WT citrate+IgG4; #P ≤ 0.05–0.0001for Glp-1r−/−+STZ+Ab-4 vs. WT citrate+IgG4. C: GSIS during an OGTT performed on the sixth week of antibody treatment (n = 4–5 per group). *P ≤ 0.0001 for WT citrate+IgG4 vs. STZ-treated groups; #P ≤ 0.01 for WT citrate+IgG4 vs. WT STZ+IgG4 and Glp-1r−/− STZ+Ab-4. D: Plasma total GLP-1 and glucagon levels in response to GCGR blockade at the end of the 7-week treatment period (n = 4–9 per group). **P ≤ 0.001; ***P ≤ 0.001; ****P ≤ 0.0001 by two-way ANOVA.

Figure 3

GCGR blockade improves glucose tolerance in diabetic wild-type (WT) but not Glp-1r−/− mice. A: Weekly nonfasted blood glucose levels over a 7-week treatment period of the GCGR antibody Ab-4 (n = 11–18 per group). *P ≤ 0.001 by two-way ANOVA vs. WT citrate+IgG4; #P ≤ 0.05 by two-way ANOVA vs. WT STZ+Ab-4. B: OGTT performed on the sixth week of antibody treatment (n = 4–5 per group). *P ≤ 0.05 for WT STZ+IgG4 vs. WT citrate+IgG4; #P ≤ 0.05–0.0001for Glp-1r−/−+STZ+Ab-4 vs. WT citrate+IgG4. C: GSIS during an OGTT performed on the sixth week of antibody treatment (n = 4–5 per group). *P ≤ 0.0001 for WT citrate+IgG4 vs. STZ-treated groups; #P ≤ 0.01 for WT citrate+IgG4 vs. WT STZ+IgG4 and Glp-1r−/− STZ+Ab-4. D: Plasma total GLP-1 and glucagon levels in response to GCGR blockade at the end of the 7-week treatment period (n = 4–9 per group). **P ≤ 0.001; ***P ≤ 0.001; ****P ≤ 0.0001 by two-way ANOVA.

After 6 weeks of treatment with Ab-4, the wild-type (STZ+Ab-4) group showed superior glucose tolerance (AUC = 1,618 mg/dL/min) in an OGTT, similar to that of nondiabetic wild-type controls (AUC = 1,096 mg/dL/min) (Fig. 3B). However, despite improvement in nonfasted blood glucose levels in Glp-1r−/− (STZ+Ab-4) mice after six treatments (Fig. 3A), these animals showed profound glucose intolerance (AUC = 3,180 mg/dL/min) similar to the untreated diabetic controls (AUC = 3,032 mg/dL/min) during an OGTT (Fig. 3B). In addition, wild-type (STZ+Ab-4) animals displayed significantly impaired GSIS compared with nondiabetic controls, similar to the diabetic wild-type and hyperglycemic Ab-4–treated Glp-1r−/− mice (Fig. 3C). It appears that 6 weeks of Ab-4–mediated GCGR inactivation had little effect on GSIS from any residual β-cells (Fig. 3C). These results are supported by the fact that pancreatic insulin content was less than 10% of nondiabetic controls in all of the STZ-treated groups (Table 2).

As with Gcgr−/− mice, circulating GLP-1 concentrations were elevated in both Ab-4–treated groups compared with wild-type (citrate+IgG4) and wild-type (STZ+IgG4) animals (Fig. 3D). Fasting insulin levels in all STZ-treated animals were similarly depleted regardless of antibody treatment, indicating β-cell recovery was unlikely to be occurring despite the high levels of GLP-1 (Fig. 3C). Finally, pancreatic GLP-1 and glucagon content were elevated in the Ab-4–treated groups compared with nondiabetic and diabetic wild-type controls (Table 2). Therefore, the elevated ambient glucose concentrations and impaired oral glucose tolerance in Glp-1r−/− (STZ+Ab-4) compared with the wild-type (STZ+Ab-4) animals cannot be explained by differences in insulin, glucagon, or GLP-1 levels. Because GLP-1R action inhibits gastric transit and food intake, we performed semiliquid gastric emptying tests in all groups and found no differences (plasma acetaminophen AUC[0–2h]: wild-type [citrate+IgG4] 18.5 ± 1.7; wild-type [STZ+IgG4] 26.0 ± 2.8; wild-type [STZ+Ab-4] 25.0 ± 2.0; Glp-1r−/− [STZ+Ab-4] 21.0 ± 5.6 μg ⋅ h/mL). Food intake in the normoglycemic groups was not different; but as expected, the two hyperglycemic groups ate more, which is consistent with a catabolic state (average food intake: wild-type [citrate+IgG4] 126.5 ± 6.3; wild-type [STZ+IgG4] 263.6 ± 28.6; wild-type [STZ+Ab-4] 142.6 ± 9.4; Glp-1r−/− [STZ+Ab-4] 225.8 ± 25.3 mg food/g body weight/day).

Glp-1r Ablation Increases EGP in Insulinopenic Gcgr-Null Mice

Although there is little meaningful evidence indicating expression of the GLP-1R in the liver (24,31), there are several reports of GLP-1–mediated regulation of hepatic glucose production in a manner separate from its ability to suppress glucagon release and, intriguingly, independent of insulin (3235). We therefore measured EGP rates to investigate whether a GLP-1R–dependent mechanism accounts for regulating glycemia in Gcgr−/− animals. Although the Gcgr−/− and DKO mice experienced similar degrees of insulin deficiency in response to high-dose STZ administration (Fig. 4A), the insulinopenic DKO animals showed significant fasting hyperglycemia (241 ± 29 vs. 100 ± 6 mg/dL in Gcgr−/−). The elevated fasting glucose in the DKO correlated to a 46% higher EGP rate compared with insulin-deficient Gcgr−/− mice (Fig. 4B). EGP in the Gcgr-null animals was similar to normal mice (non-STZ, satellite animals; EGP = 12.8 ± 0.7 mg/kg/min). Basal glycolytic rates and FFA levels were similar in both groups (Fig. 4C and D). Although modeling suggests that the differences in basal EGP cannot account for all of the difference in fasting hyperglycemia (data not shown), these results confirm an insulin-independent and GLP-1R–dependent increase of EGP in the DKO mice compared with Gcgr−/− animals after STZ-induced β-cell destruction.

Figure 4

DKO mice have increased EGP compared with Gcgr−/− mice after STZ treatment. A: Fasted C-peptide levels in STZ-treated Gcgr−/− and DKO mice before EGP measurement. B: EGP in STZ-treated Gcgr−/− and DKO mice under noninsulin stimulated conditions (n = 6–7 per group). ****P ≤ 0.0001 by two-tailed t test. C: Basal whole-body glycolytic rates. D: Plasma free fatty acids (FFA) levels in both groups during basal EGP measurements.

Figure 4

DKO mice have increased EGP compared with Gcgr−/− mice after STZ treatment. A: Fasted C-peptide levels in STZ-treated Gcgr−/− and DKO mice before EGP measurement. B: EGP in STZ-treated Gcgr−/− and DKO mice under noninsulin stimulated conditions (n = 6–7 per group). ****P ≤ 0.0001 by two-tailed t test. C: Basal whole-body glycolytic rates. D: Plasma free fatty acids (FFA) levels in both groups during basal EGP measurements.

Gcgr−/− mice have reduced plasma glucose concentrations in the fed and fasted states as well as improved glucose tolerance compared with wild-type littermates (12,13). These data provide proof-of-concept that eliminating glucagon action improves glycemic control. The rodent loss-of-function data are consistent with seminal studies performed in humans showing inhibition of glucagon secretion by somatostatin infusion reduces plasma glucose (36). Similarly, models of experimental diabetes in which insulin deficiency is achieved by STZ demonstrated the pathogenic potential of unbridled glucagon secretion (37). These reports, together with more recent findings that Gcgr−/− mice remain euglycemic in the state of insulin deficiency (16,22), emphasize the importance of glucagon and support the notion that suppression of glucagon action may be sufficient to reduce many of the debilitating symptoms of type 1 diabetes (38).

Intriguingly, however, the profound physiology of Gcgr−/− mice has not been observed in other experimental models and has therefore inspired investigations exploring the unique consequences of Gcgr deficiency. This model has been used to study glucagon and α-cell homeostasis, especially in relation to glucose metabolism in the liver. For example, the discovery that selective deletion of hepatic Gcgr also results in animals with reduced blood glucose levels, improved glucose tolerance, hyperglucagonemia, and α-cell hyperplasia suggests that some control of α-cell function occurs via an unknown circulating factor (39). This concept is supported by experiments indicating α-cell area in wild-type islets increased when transplanted under the kidney capsule of Gcgr−/− mice (39).

The goal of our studies using the Gcgr knockout model was to determine whether the GLP-1R plays a significant role in maintaining normal glycemia when these animals are made insulin deficient. Use of the Gcgr−/−, Glp-1r−/−, and Gcgr−/−:Glp-1r−/− genetic models here builds on previous work in Gcgr−/− mice showing that administration of the GLP-1R peptide antagonist, exendin-4(9-39), worsens glucose tolerance in these animals (19). Further, use of the high-affinity monoclonal GCGR antagonist antibody enabled complimentary studies that pharmacologically recapitulated the genetically driven loss of Gcgr in insulinopenic wild-type and Glp-1r−/− animals. In total, the data presented in this report indicate that Gcgr ablation per se is not sufficient to confer protection from STZ-induced defects on glucose metabolism and that GLP-1R expression is needed for euglycemia in insulin-deficient Gcgr loss-of-function models.

Compared with reports characterizing single deletion of the Glp-1r on the C57BL/6 genetic background using various recombination approaches (24,40,41), our studies reveal the physiological consequences of Glp-1r ablation are more pronounced in an insulinopenic state when combined on a background of Gcgr deficiency or in a setting in which GCGR function is pharmacologically inhibited. In the short-term studies presented here, the STZ treatment paradigm caused wild-type and Glp-1r−/− mice to reach blood glucose levels above 700 mg/dL within 1 week, preventing further experiments with these animals. Similar to previous studies (16), STZ treatment of Gcgr−/− mice reduced the plasma and pancreatic insulin level due to near-maximal β-cell destruction, yet insulin deficiency had no effect on ambient glucose concentrations or glucose tolerance in the OGTT experiments. However, loss of Glp-1r in these animals resulted in significantly elevated glucose levels and impaired glucose tolerance. Importantly, comparison of GSIS during the OGTTs showed no differences in the single Gcgr−/− mice versus DKO animals. These studies indicate that in the absence of insulin, a GLP-1R–mediated mechanism helps regulate glucose homeostasis in Gcgr−/− mice.

Pharmacologically inhibiting the GCGR can result in effects resembling those of Gcgr ablation (17,18), although studies with such agents in insulinopenic models have not been reported. In the 6-week studies reported here, STZ-induced diabetic wild-type or Glp-1r−/− mice were administered once-weekly doses of an anti-GCGR antibody to determine whether the GLP-1R helps regulate glycemia upon GCGR inhibition by a therapeutic agent. Strikingly, 1 week after the first dose of antibody, the diabetic wild-type mice exhibited complete normalization of ambient glucose levels, which continued for the duration of the treatment period; this is the first report of a GCGR antagonist ameliorating hyperglycemia in insulinopenic diabetes. STZ-treated Glp-1r−/− mice showed some improvement but remained significantly hyperglycemic during the study period. After six treatment cycles, OGTT experiments demonstrated that the antibody-treated Glp-1r−/− mice exhibited markedly impaired glucose clearance, similar to untreated, diabetic control animals. In contrast, previously diabetic wild-type animals administered the GCGR antibody showed glucose excursions comparable to nondiabetic wild-type mice. These results are consistent with our DKO experiments and further highlight the importance of the GLP-1R in glucose metabolism when the GCGR is inhibited.

Owing to nearly maximal β-cell loss in STZ-treated Gcgr−/− mice, the glucoregulatory effects mediated by the GLP-1R that help maintain euglycemia in these animals likely occurs via a mechanism independent of enhancing GSIS. Experiments measuring EGP in STZ-treated Gcgr−/− and DKO mice showed DKO animals have a higher rate of EGP compared with Gcgr−/− mice (basal glycolytic rates were similar between the groups). These results agree with data showing GLP-1 infusion in fasted humans decreases EGP (42) and with studies in Glp-1r−/− mice displaying impaired suppression of EGP and liver glycogen accumulation during hyperinsulinemic-euglycemic clamp experiments (32). On the basis of data from our experiments shown here, we propose the loss of GLP-1R–dependent EGP suppression in insulin-deficient DKO mice likely accounts for differences in glycemic control observed in the DKO animals versus the Gcgr single-knockout mice. Further work to determine the key GLP-1R–expressing tissue(s) that regulates whole body EGP is warranted. Other studies have demonstrated that activation of the GLP-1R in the central nervous system reduces hepatic glucose output (43). Whether GLP-1R–expressing vagal afferents from the enteric system initiate central nervous system–driven effects on EGP remains unclear. Conditional deletion of the Glp-1r in the peripheral nervous system and in regions such as the hypothalamic arcuate nucleus should be explored to better understand the suppressive role of the GLP-1R on EGP.

Our studies using the Gcgr−/− model demonstrate a noninsulin-dependent role of the GLP-1R in controlling EGP. These results suggest that, in addition to the established ability of GLP-1 analogs to suppress glucagon secretion, GLP-1R activation in the state of insulin deficiency may improve overall glucose homeostasis. Early proof-of-concept trials show adjunctive treatment with the GLP-1 mimetics, liraglutide and exenatide, confers some efficacy in type 1 diabetic patients (4446). Although it is unclear whether a high-affinity GCGR antagonist antibody will emerge as a therapeutic option, small-molecule GCGR antagonists that block glucagon action, but do not lead to profound compensatory hyperglucagonemia, may offer a viable path forward (47,48). Directly blocking glucagon action while further reducing EGP by GLP-1R activation may improve the metabolic symptoms of insulinopenia.

See accompanying article, p. 715.

Duality of Interest. At the time of this work, all authors were employees of Eli Lilly and Company and may own company stock or possess stock options. No other potential conflicts of interest relevant to this article were reported.

Author Contributions. L.S.J. designed the study, performed experiments and data analysis, and wrote the manuscript. R.L.M. performed data analysis and contributed to the writing of the manuscript. E.D.H., D.L.K., A.D.S., and M.E.C. designed the study, performed data analyses, and contributed to the writing of the manuscript. M.D.M. and K.W.S. designed the study, performed data analysis, and wrote the manuscript. K.W.S. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Prior Presentation. Portions of this study were presented during an oral presentation at the 74th Scientific Sessions of the American Diabetes Association, San Francisco, CA, 13-17 June 2014.

1.
Ennis ED, Kreisberg RA. Diabetic ketoacidosis and the hyperglycemic hyperosmolar syndrome. In Diabetes Mellitus: a Fundamental and Clinical Text. LeRoith D, Taylor SI, Olefsky JM, Eds. Philadelphia, Lippincott Williams & Wilkins, 2000, p. 336–347
2.
Maruyama
H
,
Hisatomi
A
,
Orci
L
,
Grodsky
GM
,
Unger
RH
.
Insulin within islets is a physiologic glucagon release inhibitor
.
J Clin Invest
1984
;
74
:
2296
2299
[PubMed]
3.
Greenbaum
CJ
,
Havel
PJ
,
Taborsky
GJ
 Jr
,
Klaff
LJ
.
Intra-islet insulin permits glucose to directly suppress pancreatic A cell function
.
J Clin Invest
1991
;
88
:
767
773
[PubMed]
4.
Hope
KM
,
Tran
PO
,
Zhou
H
,
Oseid
E
,
Leroy
E
,
Robertson
RP
.
Regulation of alpha-cell function by the beta-cell in isolated human and rat islets deprived of glucose: the “switch-off” hypothesis
.
Diabetes
2004
;
53
:
1488
1495
[PubMed]
5.
Banarer
S
,
McGregor
VP
,
Cryer
PE
.
Intraislet hyperinsulinemia prevents the glucagon response to hypoglycemia despite an intact autonomic response
.
Diabetes
2002
;
51
:
958
965
[PubMed]
6.
Xu
E
,
Kumar
M
,
Zhang
Y
, et al
.
Intra-islet insulin suppresses glucagon release via GABA-GABAA receptor system
.
Cell Metab
2006
;
3
:
47
58
[PubMed]
7.
Meier
JJ
,
Kjems
LL
,
Veldhuis
JD
,
Lefèbvre
P
,
Butler
PC
.
Postprandial suppression of glucagon secretion depends on intact pulsatile insulin secretion: further evidence for the intraislet insulin hypothesis
.
Diabetes
2006
;
55
:
1051
1056
[PubMed]
8.
Raskin
P
,
Unger
RH
.
Hyperglucagonemia and its suppression—importance in the metabolic control of diabetes
.
N Engl J Med
1978
;
299
:
433
436
[PubMed]
9.
Dinneen
S
,
Alzaid
A
,
Turk
D
,
Rizza
R
.
Failure of glucagon suppression contributes to postprandial hyperglycaemia in IDDM
.
Diabetologia
1995
;
38
:
337
343
[PubMed]
10.
Unger
RH
.
The Banting Memorial Lecture 1975. Diabetes and the alpha cell
.
Diabetes
1976
;
25
:
136
151
[PubMed]
11.
Unger
RH
,
Orci
L
.
The essential role of glucagon in the pathogenesis of diabetes mellitus
.
Lancet
1975
;
1
:
14
16
[PubMed]
12.
Gelling
RW
,
Du
XQ
,
Dichmann
DS
, et al
.
Lower blood glucose, hyperglucagonemia, and pancreatic alpha cell hyperplasia in glucagon receptor knockout mice
.
Proc Natl Acad Sci U S A
2003
;
100
:
1438
1443
[PubMed]
13.
Parker
JC
,
Andrews
KM
,
Allen
MR
,
Stock
JL
,
McNeish
JD
.
Glycemic control in mice with targeted disruption of the glucagon receptor gene
.
Biochem Biophys Res Commun
2002
;
290
:
839
843
[PubMed]
14.
Conarello
SL
,
Jiang
G
,
Mu
J
, et al
.
Glucagon receptor knockout mice are resistant to diet-induced obesity and streptozotocin-mediated beta cell loss and hyperglycaemia
.
Diabetologia
2007
;
50
:
142
150
[PubMed]
15.
Eleazu
CO
,
Eleazu
KC
,
Chukwuma
S
,
Essien
UN
.
Review of the mechanism of cell death resulting from streptozotocin challenge in experimental animals, its practical use and potential risk to humans
.
J Diabetes Metab Disord
2013
;
12
:
60
[PubMed]
16.
Lee
Y
,
Wang
MY
,
Du
XQ
,
Charron
MJ
,
Unger
RH
.
Glucagon receptor knockout prevents insulin-deficient type 1 diabetes in mice
.
Diabetes
2011
;
60
:
391
397
[PubMed]
17.
Sloop
KW
,
Cao
JX
,
Siesky
AM
, et al
.
Hepatic and glucagon-like peptide-1-mediated reversal of diabetes by glucagon receptor antisense oligonucleotide inhibitors
.
J Clin Invest
2004
;
113
:
1571
1581
[PubMed]
18.
Gu
W
,
Yan
H
,
Winters
KA
, et al
.
Long-term inhibition of the glucagon receptor with a monoclonal antibody in mice causes sustained improvement in glycemic control, with reversible alpha-cell hyperplasia and hyperglucagonemia
.
J Pharmacol Exp Ther
2009
;
331
:
871
881
[PubMed]
19.
Omar
BA
,
Andersen
B
,
Hald
J
,
Raun
K
,
Nishimura
E
,
Ahrén
B
.
Fibroblast growth factor 21 (FGF21) and glucagon-like peptide 1 contribute to diabetes resistance in glucagon receptor-deficient mice
.
Diabetes
2014
;
63
:
101
110
[PubMed]
20.
Habegger
KM
,
Stemmer
K
,
Cheng
C
, et al
.
Fibroblast growth factor 21 mediates specific glucagon actions
.
Diabetes
2013
;
62
:
1453
1463
[PubMed]
21.
Arafat
AM
,
Kaczmarek
P
,
Skrzypski
M
, et al
.
Glucagon increases circulating fibroblast growth factor 21 independently of endogenous insulin levels: a novel mechanism of glucagon-stimulated lipolysis?
Diabetologia
2013
;
56
:
588
597
[PubMed]
22.
Lee
Y
,
Berglund
ED
,
Wang
MY
, et al
.
Metabolic manifestations of insulin deficiency do not occur without glucagon action
.
Proc Natl Acad Sci U S A
2012
;
109
:
14972
14976
[PubMed]
23.
Campbell
JE
,
Drucker
DJ
.
Pharmacology, physiology, and mechanisms of incretin hormone action
.
Cell Metab
2013
;
17
:
819
837
[PubMed]
24.
Jun
LS
,
Showalter
AD
,
Ali
N
, et al
.
A novel humanized GLP-1 receptor model enables both affinity purification and Cre-LoxP deletion of the receptor
.
PLoS ONE
2014
;
9
:
e93746
[PubMed]
25.
Korytko AI, Millican RL. Glucagon receptor antagonists. U.S. patent US7968686 B2. Eli Lilly and Company, 28 June 2011
26.
Perfetti
R
,
Hui
H
.
The role of GLP-1 in the life and death of pancreatic beta cells
.
Horm Metab Res
2004
;
36
:
804
810
[PubMed]
27.
Doyle
ME
,
Egan
JM
.
Mechanisms of action of glucagon-like peptide 1 in the pancreas
.
Pharmacol Ther
2007
;
113
:
546
593
[PubMed]
28.
Li
Y
,
Hansotia
T
,
Yusta
B
,
Ris
F
,
Halban
PA
,
Drucker
DJ
.
Glucagon-like peptide-1 receptor signaling modulates beta cell apoptosis
.
J Biol Chem
2003
;
278
:
471
478
[PubMed]
29.
Rondas
D
,
Bugliani
M
,
D’Hertog
W
, et al
.
Glucagon-like peptide-1 protects human islets against cytokine-mediated β-cell dysfunction and death: a proteomic study of the pathways involved
.
J Proteome Res
2013
;
12
:
4193
4206
[PubMed]
30.
Pederson
RA
,
Satkunarajah
M
,
McIntosh
CH
, et al
.
Enhanced glucose-dependent insulinotropic polypeptide secretion and insulinotropic action in glucagon-like peptide 1 receptor -/- mice
.
Diabetes
1998
;
47
:
1046
1052
[PubMed]
31.
Richards
P
,
Parker
HE
,
Adriaenssens
AE
, et al
.
Identification and characterization of GLP-1 receptor-expressing cells using a new transgenic mouse model
.
Diabetes
2014
;
63
:
1224
1233
[PubMed]
32.
Ayala
JE
,
Bracy
DP
,
James
FD
,
Julien
BM
,
Wasserman
DH
,
Drucker
DJ
.
The glucagon-like peptide-1 receptor regulates endogenous glucose production and muscle glucose uptake independent of its incretin action
.
Endocrinology
2009
;
150
:
1155
1164
[PubMed]
33.
D’Alessio
D
,
Vahl
T
,
Prigeon
R
.
Effects of glucagon-like peptide 1 on the hepatic glucose metabolism
.
Horm Metab Res
2004
;
36
:
837
841
[PubMed]
34.
Dardevet
D
,
Moore
MC
,
DiCostanzo
CA
, et al
.
Insulin secretion-independent effects of GLP-1 on canine liver glucose metabolism do not involve portal vein GLP-1 receptors
.
Am J Physiol Gastrointest Liver Physiol
2005
;
289
:
G806
G814
[PubMed]
35.
Dhanesha
N
,
Joharapurkar
A
,
Shah
G
, et al
.
Exendin-4 reduces glycemia by increasing liver glucokinase activity: an insulin independent effect
.
Pharmacol Rep
2012
;
64
:
140
149
[PubMed]
36.
Gerich
JE
,
Lorenzi
M
,
Bier
DM
, et al
.
Prevention of human diabetic ketoacidosis by somatostatin. Evidence for an essential role of glucagon
.
N Engl J Med
1975
;
292
:
985
989
[PubMed]
37.
Cherrington
AD
,
Lacy
WW
,
Chiasson
JL
.
Effect of glucagon on glucose production during insulin deficiency in the dog
.
J Clin Invest
1978
;
62
:
664
677
[PubMed]
38.
Unger
RH
,
Cherrington
AD
.
Glucagonocentric restructuring of diabetes: a pathophysiologic and therapeutic makeover
.
J Clin Invest
2012
;
122
:
4
12
[PubMed]
39.
Longuet
C
,
Robledo
AM
,
Dean
ED
, et al
.
Liver-specific disruption of the murine glucagon receptor produces α-cell hyperplasia: evidence for a circulating α-cell growth factor
.
Diabetes
2013
;
62
:
1196
1205
[PubMed]
40.
Wilson-Pérez
HE
,
Chambers
AP
,
Ryan
KK
, et al
.
Vertical sleeve gastrectomy is effective in two genetic mouse models of glucagon-like Peptide 1 receptor deficiency
.
Diabetes
2013
;
62
:
2380
2385
[PubMed]
41.
Hansotia
T
,
Baggio
LL
,
Delmeire
D
, et al
.
Double incretin receptor knockout (DIRKO) mice reveal an essential role for the enteroinsular axis in transducing the glucoregulatory actions of DPP-IV inhibitors
.
Diabetes
2004
;
53
:
1326
1335
[PubMed]
42.
Prigeon
RL
,
Quddusi
S
,
Paty
B
,
D’Alessio
DA
.
Suppression of glucose production by GLP-1 independent of islet hormones: a novel extrapancreatic effect
.
Am J Physiol Endocrinol Metab
2003
;
285
:
E701
E707
[PubMed]
43.
Burmeister
MA
,
Ferre
T
,
Ayala
JE
,
King
EM
,
Holt
RM
,
Ayala
JE
.
Acute activation of central GLP-1 receptors enhances hepatic insulin action and insulin secretion in high-fat-fed, insulin resistant mice
.
Am J Physiol Endocrinol Metab
2012
;
302
:
E334
E343
[PubMed]
44.
Kielgast
U
,
Krarup
T
,
Holst
JJ
,
Madsbad
S
.
Four weeks of treatment with liraglutide reduces insulin dose without loss of glycemic control in type 1 diabetic patients with and without residual beta-cell function
.
Diabetes Care
2011
;
34
:
1463
1468
[PubMed]
45.
Varanasi
A
,
Bellini
N
,
Rawal
D
, et al
.
Liraglutide as additional treatment for type 1 diabetes
.
Eur J Endocrinol
2011
;
165
:
77
84
[PubMed]
46.
Ghazi
T
,
Rink
L
,
Sherr
JL
,
Herold
KC
.
Acute metabolic effects of exenatide in patients with type 1 diabetes with and without residual insulin to oral and intravenous glucose challenges
.
Diabetes Care
2014
;
37
:
210
216
[PubMed]
47.
Engel SS, Xu L, Andryuk PJ, et al. Efficacy and tolerability of MK-0893, a glucagon receptor antagonist (GRA), in patients with type 2 diabetes (T2DM) [abstract 0309-OR]. Presented at the 71st Scientific Sessions of the American Diabetes Association, 24–28 June 2011, San Diego, CA
48.
Kazda C, Headlee S, Ding Y, et al. The glucagon receptor antagonist LY2409021 significantly lowers HbA1c and is well tolerated in patients with T2DM—a 24-week phase 2 study [abstract 112-OR/0112]. Presented at the 73rd Scientific Sessions of the American Diabetes Association, 21-25 June 2013, Chicago, IL