Islet Pericytes Are Required for β-Cell Maturity

β-Cell function and maturity are regulated by multiple interactions with cells in their microenvironment (1). In addition to endocrine cells, neuronal, immune, and endothelial cells were shown to support β-cell gene expression and proliferation (1,2). Islets are highly vascularized by a dense capillary network that is composed of endothelial cells and pericytes (3,4). However, although the role of endothelial cells in β-cell homeostasis has been vastly investigated, the role of pericytes remains largely unknown (4–6).

Pericyte abnormalities, including their selective loss, play a key role in diabetic retinopathy (7). In islets, pericytes display phenotypic alterations in response to an increased metabolic demand. Hypertrophy of islet pericytes, which accompanies vessel dilation, has been reported in obesity (8,9). Furthermore, abnormalities in pericytes were suggested to contribute to islet fibrosis in rodent models of obesity and type 2 diabetes (10,11). However, the contribution of diabetes-associated changes in islet pericytes to disease progression remains unknown. This stems, in part, from our limited understanding of the roles of pericytes in glucose homeostasis.

Here, we analyze the role of islet pericytes in β-cell function. To this end, we used iDTR (inducible diphtheria toxin [DT] receptor) (12) and Nkx3.2-Cre (13,14) mouse lines to target and deplete islet pericytes. Shortly after in vivo pericyte depletion, we observed impaired glucose-stimulated insulin secretion (GSIS) in mice and isolated islets. We further observed a reduced expression of genes associated with the mature β-cell phenotype, including insulin and components of the GSIS machinery. Depleting pericytes in isolated islets resulted in a similar impairment, implicating a direct effect on β-cells. In conclusion, our results suggest that by supporting the mature β-cell phenotype, islet pericytes are vital for β-cell function and glucose homeostasis.

Mice were maintained according to protocols approved by the Committee on Animal Research at Tel Aviv University. Nkx3.2-Cre (Nkx3–2^tm1(cre)Wez) (13) mice were a generous gift from Warren Zimmer (Texas A&M University, College Station, TX). R26R-YFP (Gt(ROSA)26Sor^tm1(EYFP)Cos) and iDTR (Gt(ROSA)26Sor^{tm1(HBEGF)Awai}) (12) mice were obtained from The Jackson Laboratory. Mice were intraperitoneally injected with 4 ng/g DT (List), 2 mg/g dextrose (Sigma-Aldrich), or 0.001 unit/g insulin (Lilly) diluted in PBS.

Pancreatic tissue samples were fixed in 4% paraformaldehyde, cryopreserved, and cut into 11-μm-thick sections. The tissue samples were then stained using antibodies against desmin (catalog #M0760; Dako), F4/80 (catalog #MCA497; AbD Serotec), glial fibrillary acidic protein (GFAP) (catalog #Z0334; Dako), glucagon (catalog #AB932; Millipore), Glut2 (catalog #AB1342; Chemicon), insulin (catalog #A0564; Dako), neural/glial antigen 2 (NG2) (catalog #AB5320; Millipore), platelet-derived growth factor receptor β (PDGFRβ) (catalog #14-1402-81; eBioscience), platelet endothelial cell adhesion molecule 1 (PECAM1) (catalog #553370; BD), Pdx1 (catalog #07–696; Millipore), α-smooth muscle actin (αSMA) (catalog #Ab5694; Abcam), somatostatin (catalog #MAB354; Millipore), and yellow fluorescent protein (YFP)/green fluorescent protein (catalog #Ab13970; Abcam), followed by Alexa Fluor secondary antibodies (Invitrogen). For TUNEL, an In Situ Cell Death Detection Kit (catalog #11684809910; Roche) was used. Images were acquired using an SP8 Confocal Microscope (Leica). For morphometric analysis, islets were imaged using a BZ-9000 BioRevo Microscope (Keyence) and analyzed using ImageJ software (National Institutes of Health).

Islets were isolated according to standard protocols (15). For insulin secretion, isolated islets were incubated in Krebs-Ringer bicarbonate buffer containing indicated glucose levels. For imaging, islets were incubated with Hoechst 33342 (Sigma-Aldrich) and analyzed using an SP5 Microscope (Leica). For cell depletion, islets were cultured in CMRL medium (ThermoFisher Scientific) supplemented with 10% FCS and 1 μg/mL DT (Sigma-Aldrich).

Isolated islets were dispersed to single cells using trypsin (Sigma-Aldrich), and stained with biotinylated anti-PECAM1 antibody (catalog #553371; BD), followed by allophycocyanin-conjugated streptavidin (eBioscience). DAPI (Sigma-Aldrich) was used to exclude dead cells. Analysis was performed using Gallios flow-cytometer (Beckman Coulter) and Kaluza software (Beckman Coulter).

Islet and pancreatic insulin was extracted by overnight incubation in 0.18 mol/L HCl and 70% ethanol mixture. Levels were determined using mouse ELISA (Mercodia and Alpco).

The expression of Ins1 (GGGTCGAGGTGGGCC, CTGCTGGCCTCGCTTGC), Ins2 (GGCTGCGTAGTGGTGGGTCTA, CCTGCTCGCCCTGCTCTT), and MafA (GCTGGTATCCATGTCCGTGC, TGTTTCAGTCGGATGACCTCC) was analyzed using SYBR green assay (Applied Biosystems) and normalized to Cyclophilin (TGCCGCCAGTGCCATT, TCACAGAATTATTCCAGGATTC). The expression of additional genes was analyzed using TaqMan assays (Applied Biosystems) and normalized to Cyclophilin.

Paired data were evaluated using a Student two-tailed t test.

Pericytes are found in healthy adult islets (8,9). To study the role of islet pericytes, we established a mouse tool allowing for their manipulation, Nkx3.2-Cre, which we previously showed to target mesenchymal cells (but no other cell types) in the embryonic and neonatal pancreas (14). To determine the Nkx3.2-Cre expression pattern in the adult pancreas, we analyzed Nkx3.2-Cre;R26R-YFP mice. Our analysis revealed pancreatic YFP-labeled cells with periendothelial location and extended cytoplasmic processes, both of which are pericyte characteristics (16) (Fig. 1A and B). Immunofluorescence analysis further indicated that these cells were positive for NG2, desmin, PDGFRβ, and αSMA, portraying their pericytic identity (Fig. 1C–F) (8,9,16).

Islet-associated YFP⁺ cells were negative for GFAP, indicating that they are neither pancreatic stellate nor Schwann cells (Fig. 1G) (9,17). Additionally, both immunofluorescent and flow-cytometric analyses indicated that YFP⁺ cells do not express PECAM1 (Fig. 1B and H), implicating that they are not endothelial cells. To conclude, our analysis revealed that Nkx3.2-Cre targets pericytes, but not other islet cell types.

To test whether islet pericytes play a role in endocrine function, we set about to deplete this cell population using the DTR system. This system was shown to be highly efficient in ablating islet endocrine cells (as α- and PYY-expressing cells) with minimal effect on β-cell function (18–20). To deplete pericytes, Nkx3.2-Cre;iDTR (expressing DTR in a Cre-dependent manner) (12,14), as well as nontransgenic (i.e., Cre-negative) control mice, were intraperitoneally injected with DT. Nkx3.2-Cre has both pancreatic (in pericytes and vascular smooth muscle cells [vSMCs]) (Fig. 1 and Supplementary Fig. 1) and nonpancreatic expression (in the joints and gastrointestinal mesenchyme) (13). Therefore, determining primary, rather than secondary, effects requires studying short-term events. To this end, mice were analyzed 36 h after DT administration. At this time point, we observed no abnormalities in mice activity, weight, or insulin sensitivity (Supplementary Fig. 2).

Immunofluorescent analysis revealed that DT treatment of Nkx3.2-Cre;iDTR mice resulted in a loss of islet pericytes (Fig. 2A and B and Supplementary Fig. 3), whereas the endothelial area remained unchanged (Fig. 2A and C). Of note, we did not observe macrophage infiltration into islets of treated mice (Supplementary Fig. 3). To conclude, the Nkx3.2-Cre;iDTR mouse line allows efficient and rapid depletion of islet pericytes.

To elucidate the role of islet pericytes, we analyzed for potential changes in β-cell function in DT-treated Nkx3.2-Cre;iDTR mice (“in vivo DT”) (Fig. 3A). Our analysis indicated elevated fasted blood glucose levels and impaired glucose tolerance in DT-treated transgenic mice (Fig. 3B and C). To test whether pericyte depletion affected GSIS independent of blood flow, we analyzed isolated islets. As shown in Fig. 3D, islets isolated from DT-treated transgenic mice secreted significantly less insulin in response to high glucose levels compared with controls.

Our immunofluorescent analysis revealed normal islet morphology in DT-treated Nkx3.2-Cre;iDTR mice (Fig. 3E). In agreement, we could not detect β-cell death upon pericyte depletion (Supplementary Fig. 3). However, DT-injected Nkx3.2-Cre;iDTR mice displayed reduced pancreatic and islet insulin content (Fig. 3F and G). Analyzing gene expression of isolated islets revealed a significant reduction in transcript levels of both Ins1 and Pcsk1, encoding for insulin and Proprotein Convertase 1/3, respectively (Fig. 3H). The reduction in Ins2 transcripts did not reach statistical significance (Fig. 3H). Our results therefore point to an abrogated insulin production in transgenic islets.

As the decrease in insulin secretion in transgenic islets (2.3-fold) (Fig. 3D) was more profound than the decrease in insulin content (1.7-fold) (Fig. 3G), we analyzed for potential changes in components of the GSIS machinery. Our analysis revealed that the expression of Glut2, Sur1, and Kir6.2 was significantly reduced in Nkx3.2-Cre;iDTR islets (Fig. 3I and J) (36 and 72 h, respectively, after DT treatment). Therefore, pericyte depletion affected the ability of β-cells to respond properly to glucose.

β-Cell maturity has been shown to depend on the expression of transcription factors, including MafA and Pdx1 (21). We observed a reduced expression of both of these factors in islets from DT-treated mice (Fig. 3K and L) (36 and 72 h after DT treatment, respectively). We further observed the expression of Hes1, a transcription factor associated with β-cell dedifferentiation, in transgenic islets (Fig. 3K) (21). To conclude, our results indicate that pericyte depletion may interfere with β-cell maturity.

The adult β-cell phenotype was recently shown to be independent of blood circulation (22). Nevertheless, because the Nkx3.2-Cre mouse line also targets pancreatic vSMCs (Supplementary Fig. 1), we set to deplete pericytes in isolated islets to test their role independent of the potential effects on blood flow (Fig. 4A) (“ex vivo DT”). Furthermore, as the Nkx3.2-Cre mouse line targets pericytes, but no other islet cell types (Fig. 1), this setting allows us to specifically deplete them without affecting other cell types targeted by the Cre (13).

The pericyte network is maintained upon islet isolation (Fig. 4B), which allows for their DT-mediated ex vivo depletion in islets isolated from untreated Nkx3.2-Cre;iDTR mice (Fig. 4C). To test for the resultant effects of pericyte depletion on the β-cell phenotype, islets were isolated from untreated Nkx3.2-Cre;iDTR and nontransgenic mice, and were cultured in the presence or absence of DT. After 24 h, a significant reduction in the expression level of β-cell genes was observed in transgenic islets treated with DT ex vivo, including Ins1, Glut2, MafA, and Pdx1 (Fig. 4D). To conclude, our results indicate that pericytes in the islet niche support β-cell gene expression and maturity.

The β-cell phenotype has been shown to depend on the microenvironment (1). Here, we focus on the contribution of pericytes to β-cell function. To this end, we depleted these cells by DT, and analyzed the resultant effect on β-cells. Soon after pericyte depletion, we observed impaired GSIS and insulin content in isolated islets, accompanied by a reduced expression of genes associated with the mature β-cell phenotype. Ex vivo depletion of islet pericytes resulted in similar impairment in β-cell gene expression, implicating an intraislet role. Therefore, our findings suggest that pericytes are pivotal components of the islet niche, as they are required for β-cell maturity and functionality.

Pericytes were suggested to regulate islet vascular permeability and blood flow by affecting neighboring endothelial cells (8). Hence, the observed dysfunction of β-cells upon pericyte depletion may potentially be secondary to abrogated vascular function. However, it was recently shown that adult β-cell function is independent of blood flow, as it is unaffected by an ∼50% reduction in the islet endothelium (22). Furthermore, the impaired β-cell gene expression upon ex vivo pericyte depletion in isolated islets (Fig. 4) implicates a direct intraislet role for these cells in maintaining β-cell phenotype, independent of blood flow regulation.

The vascular basement membrane (BM) has been shown to promote β-cell function (6). Although endothelial cells contribute to the BM of islets, an additional source has been suggested (23). Heterotypic interactions of pericytes and endothelial cells are required for vascular BM assembly in many tissues (16). We recently showed that the pancreatic mesenchyme, which includes pericytes and vSMCs (Fig. 1 and Supplementary Fig. 1), but not endothelial cells, produces α2 laminins that support β-cell maturity in culture (24). Therefore, pericyte depletion may interfere with β-cell function by disrupting the islet BM. However, the long half-life of BM components does not support the observed rapid changes in β-cells (Figs. 3 and 4). This implicates the involvement of as yet unidentified short-lived factors and/or direct cell-cell interactions in pericyte-mediated β-cell function.

Recent evidence points to β-cell dedifferentiation as a key in diabetes progression (25). In this process, triggered by misregulation of signaling pathways and/or metabolic stress, β-cells lose functionality through the repression of canonical β-cell genes (15,21,25). Our results suggest that pericytes are required to maintain the mature, differentiated state of β-cells. Pericytes have been shown to undergo phenotypic changes in response to increased metabolic demand—a phenomenon that has been implicated in islet fibrosis during diabetes (8,10,11). This raises the possibility that diabetes-associated changes in islet pericytes may interfere with their ability to properly support β-cells, contributing to dedifferentiation of the latter. Therefore, delineating the pericyte/β-cell axis would allow for better understanding of the regulation of β-cell function in health and its loss in diabetes.

Acknowledgments. The authors thank Helen Guez (Tel Aviv University) for technical assistance and critical reading of the manuscript.

Funding. This work was supported by European Research Council starting grant no. 336204 (to L.L.) and State of Israel Ministry of Health research grant no. 3-0000-10212.

Duality of Interest. No potential conflicts of interest relevant to this article were reported.

Author Contributions. A.S., E.R., L.S., and D.B. researched and analyzed the data. M.L. and A.E. researched the data. L.L. designed the experiments, analyzed the data, and wrote the manuscript. L.L. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Prior Presentation. This study was presented at the Keystone Symposium on Islet Biology: From Cell Birth to Death, Keystone, CO, 13–17 March 2016.