Vascular endothelial growth factor (VEGF) B belongs to the VEGF family, but in contrast to VEGF-A, VEGF-B does not regulate blood vessel growth. Instead, VEGF-B controls endothelial fatty acid (FA) uptake and was identified as a target for the treatment of type 2 diabetes. The regulatory mechanisms controlling Vegfb expression have remained unidentified. We show that peroxisome proliferator–activated receptor γ coactivator 1α (PGC-1α) together with estrogen-related receptor α (ERR-α) regulates expression of Vegfb. Mice overexpressing PGC-1α under the muscle creatine kinase promoter (MPGC-1αTG mice) displayed increased Vegfb expression, and this was accompanied by increased muscular lipid accumulation. Ablation of Vegfb in MPGC-1αTG mice fed a high-fat diet (HFD) normalized glucose intolerance, insulin resistance, and dyslipidemia. We suggest that VEGF-B is the missing link between PGC-1α overexpression and the development of the diabetes-like phenotype in HFD-fed MPGC-1αTG mice. The findings identify Vegfb as a novel gene regulated by the PGC-1α/ERR-α signaling pathway. Furthermore, the study highlights the role of PGC-1α as a master metabolic sensor that by regulating the expression levels of Vegfa and Vegfb coordinates blood vessel growth and FA uptake with mitochondrial FA oxidation.

Vascular endothelial growth factor B (VEGF-B) has been shown to control endothelial fatty acid (FA) transcytosis and tissue accumulation of lipids through regulation of the FA transport proteins (FATPs) FATP3 and FATP4 (1). Reduction of VEGF-B levels improves the development of type 2 diabetes in diabetic rodent models by decreasing muscular lipid accumulation (2). However, the regulation of Vegfb expression is not well understood. Vegfb expression is high in mitochondria-dense tissues (3), and bioinformatic analysis showed that Vegfb is coexpressed with a set of nuclear-encoded mitochondrial genes, the so-called OXPHOS genes (1). Peroxisome proliferator–activated receptor γ coactivator 1α (Ppargc1a/PGC-1α) is a major regulator of mitochondrial energy metabolism, and in response to extrinsic factors, PGC-1α binds to and coactivates several transcription factors, including estrogen-related receptor α (Esrra/ERR-α), peroxisome proliferator–activated receptor γ (PPARγ), and nuclear respiratory factor 1 (NRF1) (4).

A common pathology in type 2 diabetes is dysfunctional and insufficient muscular mitochondria content (5), and therefore, elevated PGC-1α expression was expected to be beneficial by inducing mitochondrial biogenesis. Of note, mice overexpressing PGC-1α in skeletal muscle (muscle creatine kinase PGC-1α transgenic [MPGC-1αTG] mice) displayed reduced insulin sensitivity upon high-fat diet (HFD) feeding despite increased mitochondrial density and higher respiratory capacity (6,7). Given the coexpression of Vegfb with OXPHOS genes and the role of VEGF-B in ectopic lipid accumulation and insulin resistance, we stipulated that Vegfb expression may be regulated by PGC-1α as well. In the current study, we show that PGC-1α and ERR-α control the expression of Vegfb. This previously undescribed regulatory pathway allows PGC-1α to coordinate FA uptake with mitochondrial FA oxidation through regulation of VEGF-B levels.

Animal Handling

MPGC-1αTG mice (6) were crossed with Vegfb-deficient mice (3) to ultimately create MPGC-1αTG//Vegfb−/− mice, and only male age-matched mice from the F3 generation were used. For HFD studies, wild-type (WT), MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice where fed 60% HFD (Research Diets) for 12 weeks starting from 5 weeks of age. The study was repeated twice. All animals had ad libitum access to food and water and were housed in standard cages in an environment with 12-h light/dark cycles. All mouse work was conducted in accordance to the Swedish Animal Welfare Board at Karolinska Institutet, Stockholm, Sweden.

Cell Culture

Cell lines were maintained in DMEM supplemented with 10% FBS at 37°C in 5% CO2. C2C12 was maintained as described (8). For nutrient deprivation studies, cells were starved in DMEM.

Bioinformatic Analysis

Putative consensus binding sites for ERR-α (ERR1_Q2) within the first kilobase (kb) promoter and first intron of Vegfb were analyzed using Evolutionary Conserved Region (ECR) Browser, Mulan, and multiTF databases (9) (http://ecrbrowser.dcode.org). The sequences within the ECRs were fed to Mulan and then continued with multiTF analysis with a predefined factor of 0.80.

Cloning and Mutagenesis

The plasmids pCMX-ERR-α, pcDNA3.1/myc-HisA-PGC-1α-FLAG, pTK-LUC, and pCMX-β-Gal and corresponding empty vectors were used in the experiments. PCR fragments of the first kb Vegfb promoter and first Vegfb intron were generated with overhangs of Hind III and Sbf I restriction cleavage sites and 12 more random base pairs (bps). The fragments were digested with Hind III and Sbf I and then subcloned into pTK-LUC. Putative ERR-α binding sites were mutated into Nco I restriction cleavage site (CCATGG) by site-directed mutagenesis.

Transient Transfection and Luciferase Assay

COS-1 cells were transfected in 24-well plates using Lipofectamine LTX according to the manufacturer’s instructions. pCMX-β-Gal was cotransfected to allow normalization of transfection efficiency, and 24 or 48 h posttransfection, the cells were harvested and lysed. OD405 for β-galactosidase activity and chemiluminescence signal for luciferase activity were read by using a POLARstar Omega plate reader.

RNA Extraction and Real-Time Quantitative PCR

PGC-1α overexpression in the MPGC-1αTG mice is highest in glycolytic type II fibers (6); therefore, quadriceps femoris was used for all downstream analyses. Total RNA was extracted by using the RNeasy Mini Kit (QIAGEN); thereafter, cDNA was synthesized using iScript cDNA Synthesis Kit according to the manufacturer’s instructions. Real-time quantitative PCR (qPCR) was performed as previously described (2). Primer sequences are listed in Table 1.

Table 1

Primer sequencesa

Fwd primerRev primer
Vegfb TCTGAGCATGGAACTCATGG TCTGCATTCACATTGGCTGT 
Ndufa5 ATCACCTTCGAGAAGCTGGA ACTTCACCACCCTGAAGCAA 
Cycs CCAAATCTCCACGGTCTGTT CCAGGTGATGCCTTTGTTCT 
Vegfa CAGGCTGCTGTAACGATGAA TATGTGCTGGCTTTGGTGAT 
L19 GGTGACCTGGATGAGAAGGA TTCAGCTTGTGGATGTGCTC 
B2m CTGACCGGCCTGTATGCTAT CCGTTCTTCAGCATTTGGAT 
Slc2a4 ACTCTTGCCACACAGGCTCT CCTTGCCCTGTCAGGTATGT 
Fatp1 TCAATGTACCAGGAATTACAGAAGG GAGTGAGAAGTCGCCTGCAC 
Fatp3 CGCAGGCTCTGAACCTGG TCGAAGGTCTCCAGACAGGAG 
Fatp4 GCAAGTCCCATCAGCAACTG GGGGGAAATCACAGCTTCTC 
Cd36 GATGAGCATAGGACATACTTAGATGTG CACCACTCCAATCCCAAGTAAG 
Tfam CCTGAGGAAAAGCAGGCATA ATGTCTCCGGATCGTTTCAC 
Esrra TGGCCTCTGGCTACCACTAC CGCTTGGTGATCTCACACTC 
Ppargc1a GACATGTGCAGCCAAGACTC TCAGGAAGATCTGGGCAAAG 
Ndufb10 TGGAGCAGTTCACCAAAGTG TTCCAGCATTCTCTGCTTCT 
Slc2a1 GCTGTGCTTATGGGCTTCTC CACATACATGGGCACAAAGC 
Acox1 CACTGCCACATATGACCCCAA AGAGGCTTGTGGGTCCAA 
Acadm TGCCTGTGATTCTTGCTGGAA CTTTCCCCCGTTGGTTATCCA 
Acadvl CGACACTTTGCAGGGACTCA GGCCTTTGTGCCATAGAGCA 
Hk2 CTTGCTGAAGGAAGCCATTCG CCGTCCACCAGTTCCACATTA 
Pdk4 GGCTTGCCAATTTCTCGTCTC CACCAGTCATCAGCTTCGGA 
Cs AGCCCTCAACAGTGAAAGCA TCAATGGCTCCGATACTGCTG 
Plpp1 CAGTCCTTGACTGACATCGCTAA GAGAATGAAGAGTGTCCCGAGT 
Sptlc1 ATCAGCGGCTCTCCGGTCAA AAGCGCCGGAGAAAGGGACT 
Cers2 GGGCGCTAGAAGTGGGAAA GCTTTGGCATAGACACGTCC 
Atgl GCCAACGCCACTCACATCTA CGGATGGTCTTCACCAGGTT 
Fwd primerRev primer
Vegfb TCTGAGCATGGAACTCATGG TCTGCATTCACATTGGCTGT 
Ndufa5 ATCACCTTCGAGAAGCTGGA ACTTCACCACCCTGAAGCAA 
Cycs CCAAATCTCCACGGTCTGTT CCAGGTGATGCCTTTGTTCT 
Vegfa CAGGCTGCTGTAACGATGAA TATGTGCTGGCTTTGGTGAT 
L19 GGTGACCTGGATGAGAAGGA TTCAGCTTGTGGATGTGCTC 
B2m CTGACCGGCCTGTATGCTAT CCGTTCTTCAGCATTTGGAT 
Slc2a4 ACTCTTGCCACACAGGCTCT CCTTGCCCTGTCAGGTATGT 
Fatp1 TCAATGTACCAGGAATTACAGAAGG GAGTGAGAAGTCGCCTGCAC 
Fatp3 CGCAGGCTCTGAACCTGG TCGAAGGTCTCCAGACAGGAG 
Fatp4 GCAAGTCCCATCAGCAACTG GGGGGAAATCACAGCTTCTC 
Cd36 GATGAGCATAGGACATACTTAGATGTG CACCACTCCAATCCCAAGTAAG 
Tfam CCTGAGGAAAAGCAGGCATA ATGTCTCCGGATCGTTTCAC 
Esrra TGGCCTCTGGCTACCACTAC CGCTTGGTGATCTCACACTC 
Ppargc1a GACATGTGCAGCCAAGACTC TCAGGAAGATCTGGGCAAAG 
Ndufb10 TGGAGCAGTTCACCAAAGTG TTCCAGCATTCTCTGCTTCT 
Slc2a1 GCTGTGCTTATGGGCTTCTC CACATACATGGGCACAAAGC 
Acox1 CACTGCCACATATGACCCCAA AGAGGCTTGTGGGTCCAA 
Acadm TGCCTGTGATTCTTGCTGGAA CTTTCCCCCGTTGGTTATCCA 
Acadvl CGACACTTTGCAGGGACTCA GGCCTTTGTGCCATAGAGCA 
Hk2 CTTGCTGAAGGAAGCCATTCG CCGTCCACCAGTTCCACATTA 
Pdk4 GGCTTGCCAATTTCTCGTCTC CACCAGTCATCAGCTTCGGA 
Cs AGCCCTCAACAGTGAAAGCA TCAATGGCTCCGATACTGCTG 
Plpp1 CAGTCCTTGACTGACATCGCTAA GAGAATGAAGAGTGTCCCGAGT 
Sptlc1 ATCAGCGGCTCTCCGGTCAA AAGCGCCGGAGAAAGGGACT 
Cers2 GGGCGCTAGAAGTGGGAAA GCTTTGGCATAGACACGTCC 
Atgl GCCAACGCCACTCACATCTA CGGATGGTCTTCACCAGGTT 

Acadm, acyl-CoA dehydrogenase, medium chain; Acadvl, acyl-CoA dehydrogenase, very long chain; Acox1, acyl-CoA oxidase 1; B2m, β-2-microglobulin; Cers2, ceramide synthase 2; Cs, citrate synthase; Hk2, hexokinase 2; Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1; Slc2a4, solute carrier family 2 (facilitated glucose transporter), member 4; Sptlc1, serine palmitoyltransferase, long chain base subunit 1.

aAll sequences are written 5′→ 3′.

Oil Red O Staining

Muscles were dissected, sectioned, and stained with Oil Red O (ORO), and the staining was quantified as previously reported (10).

Glucose Measurements and Metabolic Tests

Body weights and postprandial blood glucose levels were measured by intraperitoneal glucose tolerance tests (IPGTTs) and intraperitoneal insulin tolerance tests (IPITTs) performed in mice as previously described (2). Pooled data from at least two independent experiments, totaling 10–14 animals per genotype, were included in the analysis. Metabolic analyses of mouse plasma were performed as previously described (2). HOMA of insulin resistance (HOMA-IR) was calculated as (fasting glucose [mmol/L] × fasting insulin [mU/L])/22.5.

Immunohistological Analyses of Muscle Sections

Muscles were flash frozen in liquid nitrogen, cryosectioned into 12-μm sections, and stained using standard procedures. The primary antibodies were goat anti-FATP3 (Santa Cruz Biotechnology, Santa Cruz, TX), rat anti-CD31 (BD Biosciences, San Jose, CA), rabbit anti-FATP4 (Santa Cruz Biotechnology), and goat anti-CD31 (R&D Systems, Minneapolis, MN). At least 10 frames per animal within each section were photographed with an AxioVision microscope (Carl Zeiss, Oberkochen, Germany) at ×40 magnification. For quantification of the stainings, the number of pixels per square micrometer was calculated using the AxioVision quantification program.

Ex Vivo β-Oxidation Assay

β-Oxidation activity was measured in isolated skeletal muscle preparations as previously described (1).

Liquid Chromatography–Mass Spectrometry–Based Lipidomic Analysis

Ten milligrams of muscle tissue were analyzed by ultra-fast liquid chromatography–mass spectrometry (LC-MS)–based lipidomic analysis by the Swedish Metabolomics Centre at the Swedish University of Agricultural Sciences. The analyses were carried out as previously described (11).

Statistics

In all figures, data are presented as mean ± SEM, with n referring to the number of independent data points. P values were calculated with two-tailed Student t test, and P < 0.05 was considered significant.

PGC-1α and ERR-α Regulate Vegfb Promoter Activity

To investigate whether Vegfb can be induced by starvation, we monitored the expression levels of Ppargc1a and Vegfb in serum-deprived C2C12 myotubes (Supplementary Fig. 1). Eight hours of nutrient deprivation induced the expression of both Ppargc1a and Vegfb by 2.5- and 1.5-fold, respectively, and the induction was increased to 3.5- and 1.8-fold after 16 h of starvation (Supplementary Fig. 1A). The induced expression of Ppargc1a and Vegfb upon nutrient deprivation was confirmed in fibroblast (COS-1) and pericyte precursor (10T1/2) cell lines (Supplementary Fig. 1B and C).

We characterized the Vegfb promoter by cloning the first kb of the 5′-untranslated region and the first exon and intron of the Vegfb gene in front of a luciferase reporter construct. Plasmids encoding PGC-1α and/or the transcription factors ERR-α, NRF1, or PPARγ were then cotransfected with the luciferase reporter construct in COS-1 cells (Fig. 1A). The results show that only coexpression of PGC-1α and ERR-α induced significant transactivation of the reporter construct. To identify putative ERR-α binding sites in the Vegfb promoter, the murine genomic sequence was analyzed by the ECR Browser, Mulan, and multiTF algorithms (9,12). The analyses identified two ERR-α consensus DNA binding sites (13) located in the 5′promoter region (−315 to −310) and in the first intron of the Vegfb gene (+340 to +345) and one putative binding site (−571 to −566) (Fig. 1B). To identify the ERR-α binding sites responsible for the transactivation of the Vegfb promoter, new reporter constructs were generated where each ERR-α binding site was mutated by a single bp substitution. No luciferase activity was detected in the absence of PGC-1α and ERR-α, showing that the Vegfb construct per se did not induce luciferase activity (Fig. 1B, upper bar). Cotransfection of PGC-1α and ERR-α with WT or modified luciferase constructs revealed that mutating the −571 to −566 binding site significantly decreased luciferase activity compared with control reporter constructs (Fig. 1B). Mutations in the two other ERR-α DNA binding sites did not decrease luciferase activity. However, additional cryptic ERR-α binding sites most likely exist between −0.5 and 0 kb in the Vegfb promoter and in the first intron of the Vegfb gene because reporter constructs of both these genomic regions alone also displayed high luciferase activity (Fig. 1B).

Figure 1

PGC-1α activates the Vegfb promoter through coactivation of ERR-α. A: Relative luciferase activity in cells transfected with the first kb of a Vegfb promoter/intron reporter construct, plus vectors expressing PGC-1α, ERR-α, NRF1, or PPARG (n = 4/construct). B: Relative luciferase activity in COS-1 cells transfected with the Vegfb promoter/intron reporter construct, with deletion constructs or with constructs where the indicated putative Esrra binding sites were mutated plus vectors expressing PGC-1α and ERR-α. CE: Relative muscular mRNA expression of Ppargc1a, Vegfb, and Esrra (C); Vegfa, Tfam, Ndufa5, Ndufb10, and Cycs (D); and Cd36, Fatp1, Fatp3, and Fatp4 (E) in chow-fed WT, MPGC-1αTG, and MPGC-1αTG//Vegfb−/− mice (n = 6–7 for each genotype). Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG or MPGC-1αTG//Vegfb−/− compared with WT; ##P < 0.01, ###P < 0.001, MPGC-1αTG//Vegfb−/− compared with MPGC-1αTG; †††P < 0.001, control construct compared with PGC-1α + ERR-α reporter construct or mutated construct. a.u., arbitrary unit; Δ, mutated bp; Luc, transcription start site of the luciferase reporter gene.

Figure 1

PGC-1α activates the Vegfb promoter through coactivation of ERR-α. A: Relative luciferase activity in cells transfected with the first kb of a Vegfb promoter/intron reporter construct, plus vectors expressing PGC-1α, ERR-α, NRF1, or PPARG (n = 4/construct). B: Relative luciferase activity in COS-1 cells transfected with the Vegfb promoter/intron reporter construct, with deletion constructs or with constructs where the indicated putative Esrra binding sites were mutated plus vectors expressing PGC-1α and ERR-α. CE: Relative muscular mRNA expression of Ppargc1a, Vegfb, and Esrra (C); Vegfa, Tfam, Ndufa5, Ndufb10, and Cycs (D); and Cd36, Fatp1, Fatp3, and Fatp4 (E) in chow-fed WT, MPGC-1αTG, and MPGC-1αTG//Vegfb−/− mice (n = 6–7 for each genotype). Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG or MPGC-1αTG//Vegfb−/− compared with WT; ##P < 0.01, ###P < 0.001, MPGC-1αTG//Vegfb−/− compared with MPGC-1αTG; †††P < 0.001, control construct compared with PGC-1α + ERR-α reporter construct or mutated construct. a.u., arbitrary unit; Δ, mutated bp; Luc, transcription start site of the luciferase reporter gene.

We crossed MPGC-1αTG mice (6) with Vegfb-deficient animals (3) to ultimately create MPGC-1αTG//Vegfb−/− mice. qPCR analysis demonstrated a sevenfold increase in muscular expression of Ppargc1a transcripts in MPGC-1αTG mice compared with WT controls (Fig. 1C). Similar analyses showed six- and threefold upregulation of the expression of Vegfb and Esrra, respectively (Fig. 1C). MPGC-1αTG mice also showed an approximate twofold upregulation of the previously reported PGC-1α target genes Vegfa; transcription factor A, mitochondrial (Tfam); NADH dehydrogenase (ubiquione) 1 α subcomplex 5 (Ndufa5); NADH dehydrogenase (ubiquione) 1 β subcomplex 10 (Ndufb10); and cytochrome C, somatic (Cycs) (Fig. 1C and D). Ablation of Vegfb in MPGC-1αTG mice did not affect the expression of any of these genes.

We analyzed muscular expression of FATPs and several other FA handling proteins previously reported to be regulated by PGC-1α (14). The expression of fatty acid translocase (Cd36), Fatp1, and Fatp4 was upregulated in MPGC-1αTG mice compared with WT mice (Fig. 1E). Fatp3, the vascular-specific target of VEGF-B signaling, was downregulated in the MPGC-1αTG//Vegfb−/− mice compared with the WT and MPGC-1αTG animals (Fig. 1E). Taken together, PGC-1α and ERR-α regulate Vegfb expression, which requires at least one intact ERR-α binding site located in the promoter region of Vegfb. In vivo, PGC-1α controls Vegfb expression in parallel with the expression of OXPHOS genes and Vegfa. The expression of the OXPHOS genes was not altered by Vegfb deletion, whereas Fatp3 was downregulated only in the MPGC-1αTG//Vegfb−/− mice.

Muscular Lipid Accumulation Is Reduced in MPGC-1αTG//Vegfb−/− Mice

Muscle sections from WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice were stained with ORO to visualize accumulation of neutral lipids. Quantifications showed a fivefold increase in lipid accumulation in MPGC-1αTG compared with WT mice (Fig. 2A). In contrast, MPGC-1αTG//Vegfb−/− mice had almost normalized levels of lipid accumulation (Fig. 2A). The lowest level of lipid accumulation was detected in Vegfb−/− mice, in line with previous results (1).

Figure 2

Muscular lipid accumulation is decreased in MPGC-1αTG mice lacking Vegfb expression. Analysis of chow-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/− (n = 6–10 for each genotype), and Vegfb−/− mice (n = 3–7). A: Representative images showing ORO staining of muscle sections. B: Relative muscular mRNA expression of Acox1, Acadm, Acadvl, and Fasn.C: Postprandial blood glucose levels. D: IPGTT. E and F: Relative mRNA expression of Glut1 (gene name Slc2a1) and insulin-sensitive glucose transporter Glut4 (gene name Slc2a4) (E) and Hk2, Pdk4, and Cs (F). Data are mean ± SEM. Scale bar = 100 μm. Inset magnification ×6. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG or MPGC-1αTG//Vegfb−/− compared with WT; #P < 0.05, ##P < 0.01, MPGC-1αTG//Vegfb−/− compared with MPGC-1αTG. Acadm, acyl-CoA dehydrogenase, medium chain; Acadvl, acyl-CoA dehydrogenase, very long chain; Acox1, acyl-CoA oxidase 1; a.u., arbitrary unit; Fasn; fatty acid synthase; Hk2, hexokinase 2; ns, not significant; Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1; Slc2a4, solute carrier family 2 (facilitated glucose transporter), member 4.

Figure 2

Muscular lipid accumulation is decreased in MPGC-1αTG mice lacking Vegfb expression. Analysis of chow-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/− (n = 6–10 for each genotype), and Vegfb−/− mice (n = 3–7). A: Representative images showing ORO staining of muscle sections. B: Relative muscular mRNA expression of Acox1, Acadm, Acadvl, and Fasn.C: Postprandial blood glucose levels. D: IPGTT. E and F: Relative mRNA expression of Glut1 (gene name Slc2a1) and insulin-sensitive glucose transporter Glut4 (gene name Slc2a4) (E) and Hk2, Pdk4, and Cs (F). Data are mean ± SEM. Scale bar = 100 μm. Inset magnification ×6. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG or MPGC-1αTG//Vegfb−/− compared with WT; #P < 0.05, ##P < 0.01, MPGC-1αTG//Vegfb−/− compared with MPGC-1αTG. Acadm, acyl-CoA dehydrogenase, medium chain; Acadvl, acyl-CoA dehydrogenase, very long chain; Acox1, acyl-CoA oxidase 1; a.u., arbitrary unit; Fasn; fatty acid synthase; Hk2, hexokinase 2; ns, not significant; Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1; Slc2a4, solute carrier family 2 (facilitated glucose transporter), member 4.

Intracellular lipids can accumulate either through increased FA uptake, decreased β-oxidation, or increased de novo FA synthesis. Therefore, muscular expression of genes encoding critical enzymes in β-oxidation and de novo FA synthesis were measured by qPCR analysis (Fig. 2B). The transcript levels of regulatory genes in β-oxidation and de novo FA synthesis were upregulated in MPGC-1αTG compared with WT mice (Fig. 2B), which is in line with previous reports (7). No further increase in the expression of any of the genes was detected in MPGC-1αTG//Vegfb−/− mice (Fig. 2B), and in line with previous studies, no difference in expression levels of these genes was detected between WT and Vegfb−/− mice (1).

Vegfb−/− mice have a shift in nutrient utilization toward increased use of glucose and decreased use of FAs compared with WT animals (1). However, on chow diet, no differences in postprandial blood glucose levels or glucose tolerance were detected among WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice (Fig. 2C and D). A minor increase in the muscular expression of Glut4 (gene name Slc2a4) but not of Glut1 (gene name Slc2a1) was detected in MPGC-1αTG//Vegfb−/− mice compared with MPGC-1αTG mice (Fig. 2E). PGC-1α/ERR-α has been reported to regulate glucose utilization by controlling the expression of several intracellular glucose handling enzymes (15,16); therefore, we assessed muscular expression of these transcripts in WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice (Fig. 2F). Muscular pyruvate dehydrogenase kinase 4 (Pdk4) expression was downregulated, with ∼60% in MPGC-1αTG//Vegfb−/− and Vegfb−/− mice compared with MPGC-1αTG mice. A minor increase in citrate synthase (Cs) levels (25%) were detected in MPGC-1αTG//Vegfb−/− compared with MPGC-1αTG mice. In summary, no major differences in glucose tolerance, blood glucose levels, or expression of glucose transporters were found between WT and MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice on chow diet.

VEGF-B Is Regulated by PGC-1α in HFD Mice and Controls Muscular Lipid Accumulation Through FATPs

To characterize the impact of VEGF-B–driven muscular lipid accumulation of the diabetic phenotype in HFD-fed MPGC-1αTG mice, transcriptional profiling of Vegfb and genes involved in lipid uptake and oxidation were analyzed in chow- and HFD-fed animals. Vegfb expression was induced fourfold by HFD feeding in WT mice compared with chow-fed mice and twofold in HFD-fed MPGC-1αTG mice compared with chow-fed MPGC-1αTG mice (Fig. 3A). HFD feeding did not increase Esrra levels in any of the mouse strains compared with the respective genotype fed the chow diet (Fig. 3A). However, HFD feeding increased muscular expression of genes encoding FA handling proteins in both WT and MPGC-1αTG mice (Fig. 3A). Deletion of Vegfb in the HFD-fed MPGC-1αTG mice significantly prevented the upregulation of Fatp4 (Fig. 3A). On the contrary, the expression of mitochondrial genes was reduced upon HFD feeding in WT, as previously reported (2), and also in MPGC-1αTG mice (Fig. 3B). Deletion of Vegfb in the HFD-fed MPGC-1αTG preserved the expression of several OXPHOS genes compared with MPGC-1αTG mice (Fig. 3B). Thus, transcriptional analysis suggested that HFD feeding induced an imbalance between lipid uptake and lipid oxidation, and reducing VEGF-B levels may prevent this, leading to metabolic normalization. To analyze whether ablation of Vegfb reduced muscular FA uptake during HFD, muscular tissue sections from the various genotypes were stained with ORO. Muscular lipid accumulation was increased eightfold in HFD-fed MPGC-1αTG mice compared with WT HFD-fed mice but only fourfold in MPGC-1αTG//Vegfb−/− mice (Fig. 4A). Hence, deletion of Vegfb alone in MPGC-1αTG mice lowered muscular lipid accumulation by 80%. In accordance with our previous findings (2), the lowest levels of lipid accumulation was seen in the HFD-fed Vegfb−/− mice. The decreased muscular lipid accumulation in HFD-fed MPGC-1αTG//Vegfb−/− mice was not due to a compensatory increase in β-oxidation or decrease in de novo FA synthesis because transcript levels of the regulatory genes in these pathways were not altered (Fig. 4B). We also assessed whether genetic ablation of Vegfb in HFD-fed MPGC-1αTG mice directly affected the capacity of β-oxidation by incubating isolated skeletal muscle preparations with 14C-oleic acid and measured formed 14CO2 (Fig. 4C). However, no differences in the levels of released 14CO2 were observed between genotypes.

Figure 3

HFD feeding induces the expression of Vegfb and genes for FA handling proteins, whereas expression of mitochondrial OXPHOS genes are decreased. A and B: Relative muscular mRNA expression of Vegfb, Esrra, Fatp1, Cd36, Fatp3, and Fatp4 (A) and Ndufa5, Ndufb10, Tfam, and Cycs (B) in chow-fed and HFD-fed WT, MPGC-1αTG, and MPGC-1αTG//Vegfb−/− mice (n = 4–7 for each genotype). Data are mean ± SEM. For clarity, only significance between chow-fed and HFD-fed animals within genotypes and HFD-fed MPGC-1αTG compared with MPGC-1αTG//Vegfb−/− mice are indicated. †P < 0.05, ††P < 0.01, †††P < 0.001, HFD compared with chow; #P < 0.05, ##P < 0.01, ###P < 0.001, HFD-fed MPGC-1αTG//Vegfb−/− compared with HFD-fed MPGC-1αTG. ns., not significant.

Figure 3

HFD feeding induces the expression of Vegfb and genes for FA handling proteins, whereas expression of mitochondrial OXPHOS genes are decreased. A and B: Relative muscular mRNA expression of Vegfb, Esrra, Fatp1, Cd36, Fatp3, and Fatp4 (A) and Ndufa5, Ndufb10, Tfam, and Cycs (B) in chow-fed and HFD-fed WT, MPGC-1αTG, and MPGC-1αTG//Vegfb−/− mice (n = 4–7 for each genotype). Data are mean ± SEM. For clarity, only significance between chow-fed and HFD-fed animals within genotypes and HFD-fed MPGC-1αTG compared with MPGC-1αTG//Vegfb−/− mice are indicated. †P < 0.05, ††P < 0.01, †††P < 0.001, HFD compared with chow; #P < 0.05, ##P < 0.01, ###P < 0.001, HFD-fed MPGC-1αTG//Vegfb−/− compared with HFD-fed MPGC-1αTG. ns., not significant.

Figure 4

Muscular lipid accumulation and expression of FATPs are reduced in HFD-fed MPGC-1αTG mice lacking Vegfb. Analysis of HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/− mice (n = 6–10 for each genotype), and Vegfb−/− mice (n = 3–7). A: Representative images showing ORO staining of muscle sections; quantification of the ORO staining is shown on the right. B: Relative muscular mRNA expression of Acox1, Acadm, Acadvl, and Fasn.C: Ex vivo β-oxidation measured as levels of formed 14CO2 in skeletal muscles from HFD-fed MPGC-1αTG mice and MPGC-1αTG//Vegfb−/− mice. Etomoxir was used to inhibit mitochondrial β-oxidation and served as an internal control (n = 2–3). D: Representative images of muscle sections stained with anti-FATP3 or anti-FATP4 antibodies together with CD31 antibodies. Quantifications are shown on the right (n = 3–6). Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG or MPGC-1αTG//Vegfb−/− compared with WT; ##P < 0.01, ###P < 0.001, MPGC-1αTG//Vegfb−/− compared with MPGC-1αTG. In A, scale bar = 100 μm and inset magnification ×6, whereas in D, scale bars = 50 μm and 100 μm in top vs. bottom panels. Acadm, acyl-CoA dehydrogenase, medium chain; Acadvl, acyl-CoA dehydrogenase, very long chain; Acox1, acyl-CoA oxidase 1; a.u., arbitrary unit; Cd31, platelet endothelial cell adhesion molecule; Fasn; fatty acid synthase.

Figure 4

Muscular lipid accumulation and expression of FATPs are reduced in HFD-fed MPGC-1αTG mice lacking Vegfb. Analysis of HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/− mice (n = 6–10 for each genotype), and Vegfb−/− mice (n = 3–7). A: Representative images showing ORO staining of muscle sections; quantification of the ORO staining is shown on the right. B: Relative muscular mRNA expression of Acox1, Acadm, Acadvl, and Fasn.C: Ex vivo β-oxidation measured as levels of formed 14CO2 in skeletal muscles from HFD-fed MPGC-1αTG mice and MPGC-1αTG//Vegfb−/− mice. Etomoxir was used to inhibit mitochondrial β-oxidation and served as an internal control (n = 2–3). D: Representative images of muscle sections stained with anti-FATP3 or anti-FATP4 antibodies together with CD31 antibodies. Quantifications are shown on the right (n = 3–6). Data are mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG or MPGC-1αTG//Vegfb−/− compared with WT; ##P < 0.01, ###P < 0.001, MPGC-1αTG//Vegfb−/− compared with MPGC-1αTG. In A, scale bar = 100 μm and inset magnification ×6, whereas in D, scale bars = 50 μm and 100 μm in top vs. bottom panels. Acadm, acyl-CoA dehydrogenase, medium chain; Acadvl, acyl-CoA dehydrogenase, very long chain; Acox1, acyl-CoA oxidase 1; a.u., arbitrary unit; Cd31, platelet endothelial cell adhesion molecule; Fasn; fatty acid synthase.

The transcriptional alterations of the FATPs were modest in relation to the drastic reduction in lipid accumulation in the HFD-fed MPGC-1αTG//Vegfb−/− mice, and we used immunohistochemistry to analyze protein expression of FATP3 and FATP4 in chow-fed WT, HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice (Fig. 4D). CD31, a vessel-specific marker protein, was used to identify vascular localization of the FATPs. The expression of both FATP3 and FATP4 was strongly upregulated in HFD-fed MPGC-1αTG mice compared with HFD-fed WT mice. Strikingly, the protein expression of both FATP3 and FATP4 were downregulated by ∼70% and 90% in HFD-fed MPGC-1αTG//Vegfb−/− and HFD-fed MPGC-1αTG mice, respectively. In summary, HFD feeding induced the expression of Vegfb and FA handling protein transcripts in both WT and MPGC-1αTG mice, and muscular lipid deposition was increased accordingly. Of note, muscular lipid accumulation was dramatically reduced in the MPGC-1αTG//Vegfb−/− mice, which was caused by lowered FA uptake through decreased expression of FATP3 and FATP4.

Ablation of Vegfb in HFD-Fed Mice Targets Muscular Lipid Accumulation by Reducing Triglycerides, Diacylglycerols, and Ceramides

High intramyocellular lipid content in both humans and experimental animal models have been shown to be associated with insulin resistance (17,18). Specifically, both diacylglycerols (DAGs) derived from lipid droplets and ceramides have been shown to affect insulin signaling and/or insulin-mediated muscular glucose uptake (19). Therefore, we used ultrafast LC-MS–based lipidomics to quantify the levels of triglycerides (TGs), DAGs, and ceramides in muscle biopsy specimens from chow-fed WT mice and HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice (Fig. 5). Area under the curve (AUC) analysis of all lipid species showed that MPGC-1αTG//Vegfb−/− and Vegfb−/− mice had ∼35% and 60% lower muscular TG content, respectively, compared with MPGC-1αTG mice (Fig. 5A and B). Similar analysis showed that muscular levels of DAGs and ceramides were reduced by ∼35% and 25% in MPGC-1αTG//Vegfb−/− mice and by ∼70% and 35% in Vegfb−/− mice compared with MPGC-1αTG mice (Fig. 5C–F). To analyze whether VEGF-B controls the degradation of TGs to DAGs or de novo DAG synthesis, we measured muscular expression levels of adipose triglyceride lipase (Atgl) and phospholipid phosphatase 1 (Plpp1) (Fig. 5G). Expression of Atgl was downregulated in both HFD-fed MPGC-1αTG//Vegfb−/− and Vegfb−/− mice, suggesting that lower amounts of TGs are available for degradation. No differences were found between genotypes in expression of Plpp1 or in the expression of transcripts coding for key enzymes for ceramide formation (Fig. 5G and H).

Figure 5

Ablation of Vegfb in HFD-fed mice reduced muscular levels of TGs, DAGs, and ceramides. LC-MS analysis of muscle biopsy specimens from chow-fed WT and HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice. A: Total ion chromatogram (TIC) of TGs and quantification of total TG content by AUC. B: Quantification of the most abundant TG species as fold change compared with chow-fed WT. C: TIC of DAGs and quantification of total DAG content by AUC. D: Quantification of the most abundant DAG species as fold change compared with chow-fed WT. E: TIC of ceramides and quantification of the total ceramide content by AUC. F: Quantification of the most abundant ceramide species as fold change compared with chow-fed WT. G and H: Relative muscular mRNA expression of Atgl and Plpp1 (G) and Cers2 and Sptlc1 (H). Data are mean ± SEM. Statistical analyses between chow-fed and HFD-fed WT are omitted for clarity. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG or MPGC-1αTG//Vegfb−/− compared with WT; #P < 0.05, ##P < 0.01, MPGC-1αTG//Vegfb−/− compared with MPGC-1αTG (n = 3–6). a.u., arbitrary unit; Cers2, ceramide synthase 2; Sptlc1, serine palmitoyltransferase, long chain base subunit 1.

Figure 5

Ablation of Vegfb in HFD-fed mice reduced muscular levels of TGs, DAGs, and ceramides. LC-MS analysis of muscle biopsy specimens from chow-fed WT and HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice. A: Total ion chromatogram (TIC) of TGs and quantification of total TG content by AUC. B: Quantification of the most abundant TG species as fold change compared with chow-fed WT. C: TIC of DAGs and quantification of total DAG content by AUC. D: Quantification of the most abundant DAG species as fold change compared with chow-fed WT. E: TIC of ceramides and quantification of the total ceramide content by AUC. F: Quantification of the most abundant ceramide species as fold change compared with chow-fed WT. G and H: Relative muscular mRNA expression of Atgl and Plpp1 (G) and Cers2 and Sptlc1 (H). Data are mean ± SEM. Statistical analyses between chow-fed and HFD-fed WT are omitted for clarity. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG or MPGC-1αTG//Vegfb−/− compared with WT; #P < 0.05, ##P < 0.01, MPGC-1αTG//Vegfb−/− compared with MPGC-1αTG (n = 3–6). a.u., arbitrary unit; Cers2, ceramide synthase 2; Sptlc1, serine palmitoyltransferase, long chain base subunit 1.

MPGC-1αTG//Vegfb−/− Mice Fed an HFD Are Protected Against the Development of Type 2 Diabetes

We analyzed whether deletion of Vegfb could reverse insulin resistance in HFD-fed MPGC-1αTG mice (Fig. 6). Postprandial blood glucose levels were normalized in HFD-fed MPGC-1αTG//Vegfb−/− and Vegfb−/− animals (Fig. 6A). As previously reported, Vegfb−/− mice had an increased body weight compared with WT littermates upon HFD feeding (Fig. 6A) (2). However, no differences in body weights were detected among WT, MPGC-1αTG, and MPGC-1αTG//Vegfb−/− mice (Fig. 6A). HFD-fed WT and MPGC-1αTG mice but not MPGC-1αTG//Vegfb−/− mice developed hyperinsulinemia, whereas HFD-fed Vegfb−/− mice displayed moderately increased plasma insulin levels (Fig. 6B). The HOMA-IR index mirrored the plasma insulin levels (Fig. 6B). qPCR analysis showed that MPGC-1αTG//Vegfb−/− mice had higher Glut4 expression (Fig. 6C), lower Pdk4 expression (Fig. 6D), and higher Cs expression (Fig. 6D) compared with MPGC-1αTG mice, suggesting higher glucose utilization (20). In line with reduced muscular lipid accumulation and increased expression of glucose handling enzymes, the HFD-fed MPGC-1αTG//Vegfb−/− and Vegfb−/− mice showed improved glucose tolerance and insulin sensitivity compared with HFD-fed WT and MPGC-1αTG mice (Fig. 6E and F).

Figure 6

Genetic deletion of Vegfb in HFD-fed MPGC-1αTG mice reduces insulin resistance and type 2 diabetes. Analysis of chow-fed WT (n = 4–5) and HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice (n = 7–12 for each genotype). A: Postprandial blood glucose levels and body weights. B: Insulin levels and HOMA-IR. C and D: Relative mRNA expression of Glut1 (gene name Slc2a1) and insulin sensitive glucose transporter Glut4 (gene name Slc2a4) (C) and Hk2, Pdk4, and Cs (D). E and F: IPGTT (E) and IPITT (F) and AUC analyses. Data are mean ± SEM. Statistical analyses between chow-fed and HFD-fed WT are omitted for clarity. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG//Vegfb−/− or Vegfb−/− compared with WT; #P < 0.05, ##P < 0.01, ###P < 0.001, MPGC-1αTG//Vegfb−/− or Vegfb−/− compared with MPGC-1αTG. a.u., arbitrary unit; Hk2, hexokinase 2; Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1; Slc2a4, solute carrier family 2 (facilitated glucose transporter), member 4.

Figure 6

Genetic deletion of Vegfb in HFD-fed MPGC-1αTG mice reduces insulin resistance and type 2 diabetes. Analysis of chow-fed WT (n = 4–5) and HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice (n = 7–12 for each genotype). A: Postprandial blood glucose levels and body weights. B: Insulin levels and HOMA-IR. C and D: Relative mRNA expression of Glut1 (gene name Slc2a1) and insulin sensitive glucose transporter Glut4 (gene name Slc2a4) (C) and Hk2, Pdk4, and Cs (D). E and F: IPGTT (E) and IPITT (F) and AUC analyses. Data are mean ± SEM. Statistical analyses between chow-fed and HFD-fed WT are omitted for clarity. *P < 0.05, **P < 0.01, ***P < 0.001, MPGC-1αTG//Vegfb−/− or Vegfb−/− compared with WT; #P < 0.05, ##P < 0.01, ###P < 0.001, MPGC-1αTG//Vegfb−/− or Vegfb−/− compared with MPGC-1αTG. a.u., arbitrary unit; Hk2, hexokinase 2; Slc2a1, solute carrier family 2 (facilitated glucose transporter), member 1; Slc2a4, solute carrier family 2 (facilitated glucose transporter), member 4.

To visualize how insulin resistance correlated to VEGF-B signaling and muscular lipid accumulation, we plotted muscular lipid content and measurements of insulin resistance in individual HFD-fed mice (Fig. 7A). HFD-fed MPGC-1αTG were characterized by high muscular lipid content and insulin resistance. Reducing Vegfb−/− levels in HFD-fed MPGC-1αTG mice strongly affected lipid accumulation and increased insulin sensitivity. In summary, deletion of Vegfb can completely prevent insulin resistance in HFD-fed MPGC-1αTG mice.

Figure 7

Reducing VEGF-B levels in HFD-fed mice targets intramyocellular lipid storage, insulin resistance, and dyslipidemia. A and B: Analysis of chow-fed WT (n = 4–5) and HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice (n = 7–12 for each genotype). A: Neutral lipid accumulation quantified by ORO analysis plotted against the levels of insulin resistance as measured by AUC analysis of IPITTs. B and C: Plasma levels of TGs, HDL cholesterol, and LDL/VLDL cholesterol (B) and NEFAs, and ketones (C). D: Schematic illustration of PGC-1α–dependent regulation of VEGF-B and VEGF-A and how β-oxidation is correlated to FA uptake and angiogenesis. In the normal state, PGC-1α coordinates mitochondrial biogenesis and β-oxidation with FA uptake and angiogenesis by coexpression of mitochondrial OXPHOS genes Vegfb and Vegfa. During nutrient deprivation and/or exercise, the expression of PGC-1α induces mitochondrial biogenesis that subsequently upregulates expression of VEGF-B and induces FA uptake in the tissue cells and induces expression of VEGF-A with subsequent angiogenesis. This type of regulation ensures that increased blood vessel growth and nutrient supply are correlated with the higher oxidative capacity in the tissue to preserve the metabolic homeostasis. Data in B and C are mean ± SEM. Statistical analyses between chow-fed and HFD-fed WT are omitted for clarity. *P < 0.05, **P < 0.01, HFD-fed MPGC-1αTG//Vegfb−/− or Vegfb−/− compared with HFD-fed WT; #P < 0.05, ##P < 0.01, HFD-fed MPGC-1αTG//Vegfb−/− or Vegfb−/− compared with HFD-fed MPGC-1αTG. a.u., arbitrary unit.

Figure 7

Reducing VEGF-B levels in HFD-fed mice targets intramyocellular lipid storage, insulin resistance, and dyslipidemia. A and B: Analysis of chow-fed WT (n = 4–5) and HFD-fed WT, MPGC-1αTG, MPGC-1αTG//Vegfb−/−, and Vegfb−/− mice (n = 7–12 for each genotype). A: Neutral lipid accumulation quantified by ORO analysis plotted against the levels of insulin resistance as measured by AUC analysis of IPITTs. B and C: Plasma levels of TGs, HDL cholesterol, and LDL/VLDL cholesterol (B) and NEFAs, and ketones (C). D: Schematic illustration of PGC-1α–dependent regulation of VEGF-B and VEGF-A and how β-oxidation is correlated to FA uptake and angiogenesis. In the normal state, PGC-1α coordinates mitochondrial biogenesis and β-oxidation with FA uptake and angiogenesis by coexpression of mitochondrial OXPHOS genes Vegfb and Vegfa. During nutrient deprivation and/or exercise, the expression of PGC-1α induces mitochondrial biogenesis that subsequently upregulates expression of VEGF-B and induces FA uptake in the tissue cells and induces expression of VEGF-A with subsequent angiogenesis. This type of regulation ensures that increased blood vessel growth and nutrient supply are correlated with the higher oxidative capacity in the tissue to preserve the metabolic homeostasis. Data in B and C are mean ± SEM. Statistical analyses between chow-fed and HFD-fed WT are omitted for clarity. *P < 0.05, **P < 0.01, HFD-fed MPGC-1αTG//Vegfb−/− or Vegfb−/− compared with HFD-fed WT; #P < 0.05, ##P < 0.01, HFD-fed MPGC-1αTG//Vegfb−/− or Vegfb−/− compared with HFD-fed MPGC-1αTG. a.u., arbitrary unit.

In addition to insulin resistance, dyslipidemia is a key feature of type 2 diabetes. Hence, the levels of several plasma lipid species were analyzed in HFD-fed mice (Fig. 7B and C). The results showed that HFD feeding leads to increased levels of plasma TGs in WT and MPGC-1αTG mice. In contrast, TG levels were decreased in HFD-fed MPGC-1αTG//Vegfb−/− and Vegfb−/− mice compared with both WT and MPGC-1αTG animals (Fig. 7B). LDL and VLDL cholesterol were also decreased in MPGC-1αTG//Vegfb−/− mice compared with MPGC-1αTG mice, whereas no difference in HDL cholesterol was detected (Fig. 7B). Similar levels of nonesterified fatty acids (NEFAs) and ketone bodies (KBs) were also detected in MPGC-1αTG and MPGC-1αTG//Vegfb−/− mice (Fig. 7C). In summary, the metabolic tolerance tests showed that genetic deletion of Vegfb in HFD-fed MPGC-1αTG mice is sufficient to prevent hyperglycemia and hyperinsulinemia, reduce insulin resistance, and improve dyslipidemia, thus rescuing the aberrant phenotype of this previously enigmatic mouse model.

In this study, we demonstrate that Vegfb is a downstream target of the PGC-1α/ERR-α signaling pathway. PGC-1α is induced by physiological stimuli, including exercise, fasting, and cold temperature (4). Of note, mRNA levels of Vegfb are also increased by nutrient deprivation (Supplementary Fig. 1) and during exercise, which is shown in muscles biopsy specimens from mice and human subjects (21,22). The coregulation of PGC-1α and VEGF-B ensures that lipid uptake from the circulation is coordinated with tissue lipid oxidation (Fig. 7D). PGC-1α/ERR-α have also been shown to induce VEGF-A levels and angiogenesis in skeletal muscle in vivo during starvation (8,2325). Thus, PGC-1α and ERR-α coordinate VEGF-A and VEGF-B expression levels, mitochondrial biogenesis, and lipid oxidation not only by controlling vessel growth but also by regulating lipid uptake.

Given the impact of PGC-1α as the main activator of mitochondrial biogenesis and energy metabolism, efforts have been made to elucidate the role of PGC-1α in metabolic conditions such as insulin resistance and type 2 diabetes. The muscular expression of Ppargc1a and OXPHOS genes is reduced in patients with type 2 diabetes, suggesting that low PGC-1α activity could be the underlying mechanism of type 2 diabetes (26,27). Therefore, it was surprising and paradoxical that HFD-fed MPGC-1αTG mice developed insulin resistance and type 2 diabetes (7). In this study, we have unraveled the mechanism underlying the diabetic phenotype reported for the HFD-fed MPGC-1αTG mice (7). We show that muscular overexpression of PGC-1α upregulates Vegfb levels, driving FA uptake and tissue accumulation and, as a consequence, insulin resistance. Inactivation of Vegfb in HFD-fed MPGC-1αTG mice reduced ectopic lipid accumulation and the development of type 2 diabetes by reduced protein levels of endothelial FATPs. Hence, the HFD-induced insulin resistance in MPGC-1αTG mice first described by Choi et al. (7) is most likely caused by a PGC-1α–dependent upregulation of Vegfb expression.

Ablation of Vegfb in MPGC-1αTG mice did not affect plasma levels of NEFAs or KBs, despite reduction of muscular lipid accumulation. The current data agree with that of Choi et al. (7), which showed that HFD-fed MPGC-1αTG mice had lower plasma levels of KB, despite increased muscular FA inflow. We have previously shown that reducing VEGF-B levels in db/db mice reduced both muscular lipid accumulation and plasma levels of NEFAs and KBs (2). Furthermore, lipid infusions in unchallenged Vegfb−/− mice redirected lipids from the peripheral tissues to the adipose tissue (AT) (1). PGC-1α is described as a regulator of several myokines shown to induce alterations in the AT (22). Therefore, the lack of differences in plasma NEFA levels between MPGC-1αTG and MPGC-1αTG//Vegfb−/− could be caused either by the effect of PGC-1α on AT tissue or by VEGF-B–dependent shunting of lipids to the AT.

Efforts have been made to try to link the VEGF-B signaling pathway to insulin resistance in humans, but it was reported that serum VEGF-B levels did not differ between patients with type 2 diabetes and healthy control subjects (28). However, a major confounding factor was that the trial enrolled patients taking oral antidiabetic drugs, such as metformin and thiazolidinediones. The authors showed that thiazolidinediones reduced circulating levels of VEGF-B. Similarly, in a more recent clinical trial of metformin treatment in women with polycystic ovary syndrome and insulin resistance, metformin was shown to reduce plasma VEGF-B levels (29). This trial enrolled only patients who had not received antidiabetic drugs within the past 3 months before the metformin treatment was initiated. Measurements of serum VEGF-B levels before metformin treatment showed that VEGF-B levels were increased in the subjects with insulin resistance and correlated positively with insulin resistance. In addition, gene association studies have linked the VEGF-B signaling pathway to insulin resistance in humans because a sequence variant in Fatp4 was identified to be associated with the metabolic syndrome and insulin resistance (30). Moreover, serum VEGF-B levels as well as AT Vegfb expression have been shown to be upregulated in patients who are obese (31,32). Taken together, several human studies have shown interesting links among VEGF-B levels, obesity, and insulin resistance.

In summary, the current study identifies Vegfb as a downstream target of the PGC-1α/ERR-α signaling pathway and a mediator of the PGC-1α–induced adverse effects upon HFD feeding. We provide evidence that tissue metabolism is intimately linked to the functional features of the vasculature and highlights the importance of PGC-1α as a major metabolic sensor/regulator to coordinate respiratory capacity with vessel growth through VEGF-A and lipid uptake through VEGF-B.

C.E.H. is currently affiliated with the Department of Cell and Molecular Biology, Karolinska Institutet, Stockholm, Sweden.

Acknowledgments. The authors thank Janet Rossant (Departments of Molecular Genetics and Obstetrics and Gynaecology, University of Toronto) and Guo-Hua Fong (Department of Cell Biology and Center for Vascular Biology, University of Connecticut Health Center) for the gift of the MPGC-1αTG mice; Thomas Perlmann (Department of Cell and Molecular Biology, Karolinska Institutet) for the gifts of pCMX-ERR-α, pcDNA3.1/myc-HisA-PGC-1α-FLAG, pTK-LUC, pCMX-β-Gal plasmids; and the Swedish Metabolomics Centre (Umeå University; www.swedishmetabolomicscentre.se) for help with lipid analysis. The authors also thank Sofia Wittgren and Karin Pettersson (Department of Medical Biochemistry and Biophysics, Karolinska Institutet) for mouse care and mouse genotyping.

Funding. This study was supported by the Wilhelm och Else Stockmanns Stiftelse (C.E.H.), Swedish Heart-Lung Foundation (U.E.), Novo Nordisk Foundation (U.E.), Swedish Cancer Foundation (U.E.), Swedish Research Council (U.E.), Torsten Söderbergs Stiftelse (U.E.), Ragnar Söderbergs Stiftelse (U.E.), Ludwig Institute for Cancer Research (U.E.), CSL Ltd., Melbourne, Australia (U.E.), and Karolinska Institutet.

Duality of Interest. A.M., U.E., and A.F. are shareholders in a company within the diabetes field. This study was supported by CSL Ltd., Melbourne, Australia (U.E.). U.E. is a consultant for CSL Ltd., Melbourne, Australia. This does not alter the author’s adherence to all policies of Diabetes. No other potential conflicts of interest relevant to this article were reported.

Author Contributions. A.M. and A.F. contributed to the study design and research, data analysis, and writing and review of the manuscript. I.P. performed expression, immunohistochemistry, and lipid analyses and contributed to the review of the manuscript. X.W. performed the in vitro analysis and contributed to the in vivo experiments and review of the manuscript. C.E.H. initiated the project and contributed to the review of the manuscript. U.E. designed the research and contributed to the review of the manuscript. U.E. and A.F. are the guarantors of this work and, as such, had full access to all data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis.

Prior Presentation. Parts of this study were presented in abstract form at 2013 Keystone Symposia on Molecular and Cellular Biology Diabetes—New Insights into Mechanism of Disease and its Treatment, Keystone, CO, 27 January–1 February 2013.

1.
Hagberg
CE
,
Falkevall
A
,
Wang
X
, et al
.
Vascular endothelial growth factor B controls endothelial fatty acid uptake
.
Nature
2010
;
464
:
917
921
[PubMed]
2.
Hagberg
CE
,
Mehlem
A
,
Falkevall
A
, et al
.
Targeting VEGF-B as a novel treatment for insulin resistance and type 2 diabetes
.
Nature
2012
;
490
:
426
430
[PubMed]
3.
Aase
K
,
von Euler
G
,
Li
X
, et al
.
Vascular endothelial growth factor-B-deficient mice display an atrial conduction defect
.
Circulation
2001
;
104
:
358
364
[PubMed]
4.
Chan
MC
,
Arany
Z
.
The many roles of PGC-1α in muscle–recent developments
.
Metabolism
2014
;
63
:
441
451
[PubMed]
5.
Lowell
BB
,
Shulman
GI
.
Mitochondrial dysfunction and type 2 diabetes
.
Science
2005
;
307
:
384
387
[PubMed]
6.
Lin
J
,
Wu
H
,
Tarr
PT
, et al
.
Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres
.
Nature
2002
;
418
:
797
801
[PubMed]
7.
Choi
CS
,
Befroy
DE
,
Codella
R
, et al
.
Paradoxical effects of increased expression of PGC-1alpha on muscle mitochondrial function and insulin-stimulated muscle glucose metabolism
.
Proc Natl Acad Sci U S A
2008
;
105
:
19926
19931
[PubMed]
8.
Arany
Z
,
Foo
SY
,
Ma
Y
, et al
.
HIF-independent regulation of VEGF and angiogenesis by the transcriptional coactivator PGC-1alpha
.
Nature
2008
;
451
:
1008
1012
[PubMed]
9.
Ovcharenko
I
,
Loots
GG
,
Giardine
BM
, et al
.
Mulan: multiple-sequence local alignment and visualization for studying function and evolution
.
Genome Res
2005
;
15
:
184
194
[PubMed]
10.
Mehlem
A
,
Hagberg
CE
,
Muhl
L
,
Eriksson
U
,
Falkevall
A
.
Imaging of neutral lipids by oil red O for analyzing the metabolic status in health and disease
.
Nat Protoc
2013
;
8
:
1149
1154
[PubMed]
11.
Nygren
H
,
Seppänen-Laakso
T
,
Castillo
S
,
Hyötyläinen
T
,
Orešič
M
.
Liquid chromatography-mass spectrometry (LC-MS)-based lipidomics for studies of body fluids and tissues
.
Methods Mol Biol
2011
;
708
:
247
257
[PubMed]
12.
Ovcharenko
I
,
Nobrega
MA
,
Loots
GG
,
Stubbs
L
.
ECR Browser: a tool for visualizing and accessing data from comparisons of multiple vertebrate genomes
.
Nucleic Acids Res
2004
;
32
:
W280–W286
[PubMed]
13.
Sladek
R
,
Bader
JA
,
Giguère
V
.
The orphan nuclear receptor estrogen-related receptor alpha is a transcriptional regulator of the human medium-chain acyl coenzyme A dehydrogenase gene
.
Mol Cell Biol
1997
;
17
:
5400
5409
[PubMed]
14.
Summermatter
S
,
Baum
O
,
Santos
G
,
Hoppeler
H
,
Handschin
C
.
Peroxisome proliferator-activated receptor gamma coactivator 1alpha (PGC-1alpha) promotes skeletal muscle lipid refueling in vivo by activating de novo lipogenesis and the pentose phosphate pathway
.
J Biol Chem
2010
;
285
:
32793
32800
[PubMed]
15.
Pilegaard
H
,
Neufer
PD
.
Transcriptional regulation of pyruvate dehydrogenase kinase 4 in skeletal muscle during and after exercise
.
Proc Nutr Soc
2004
;
63
:
221
226
[PubMed]
16.
Wende
AR
,
Huss
JM
,
Schaeffer
PJ
,
Giguère
V
,
Kelly
DP
.
PGC-1alpha coactivates PDK4 gene expression via the orphan nuclear receptor ERRalpha: a mechanism for transcriptional control of muscle glucose metabolism
.
Mol Cell Biol
2005
;
25
:
10684
10694
[PubMed]
17.
Krssak
M
,
Petersen
KF
,
Bergeron
R
, et al
.
Intramuscular glycogen and intramyocellular lipid utilization during prolonged exercise and recovery in man: a 13C and 1H nuclear magnetic resonance spectroscopy study
.
J Clin Endocrinol Metab
2000
;
85
:
748
754
[PubMed]
18.
Clerk
LH
,
Rattigan
S
,
Clark
MG
.
Lipid infusion impairs physiologic insulin-mediated capillary recruitment and muscle glucose uptake in vivo
.
Diabetes
2002
;
51
:
1138
1145
[PubMed]
19.
Samuel
VT
,
Petersen
KF
,
Shulman
GI
.
Lipid-induced insulin resistance: unravelling the mechanism
.
Lancet
2010
;
375
:
2267
2277
[PubMed]
20.
Majer
M
,
Popov
KM
,
Harris
RA
,
Bogardus
C
,
Prochazka
M
.
Insulin downregulates pyruvate dehydrogenase kinase (PDK) mRNA: potential mechanism contributing to increased lipid oxidation in insulin-resistant subjects
.
Mol Genet Metab
1998
;
65
:
181
186
[PubMed]
21.
Vind
BF
,
Pehmøller
C
,
Treebak
JT
, et al
.
Impaired insulin-induced site-specific phosphorylation of TBC1 domain family, member 4 (TBC1D4) in skeletal muscle of type 2 diabetes patients is restored by endurance exercise-training
.
Diabetologia
2011
;
54
:
157
167
[PubMed]
22.
Boström
P
,
Wu
J
,
Jedrychowski
MP
, et al
.
A PGC1-α-dependent myokine that drives brown-fat-like development of white fat and thermogenesis
.
Nature
2012
;
481
:
463
468
[PubMed]
23.
Chinsomboon
J
,
Ruas
J
,
Gupta
RK
, et al
.
The transcriptional coactivator PGC-1alpha mediates exercise-induced angiogenesis in skeletal muscle
.
Proc Natl Acad Sci U S A
2009
;
106
:
21401
21406
[PubMed]
24.
Zhang
K
,
Lu
J
,
Mori
T
, et al
.
Baicalin increases VEGF expression and angiogenesis by activating the ERRalpha/PGC-1alpha pathway
.
Cardiovasc Res
2011
;
89
:
426
435
[PubMed]
25.
Wallace
MA
,
Hock
MB
,
Hazen
BC
,
Kralli
A
,
Snow
RJ
,
Russell
AP
.
Striated muscle activator of Rho signalling (STARS) is a PGC-1α/oestrogen-related receptor-α target gene and is upregulated in human skeletal muscle after endurance exercise
.
J Physiol
2011
;
589
:
2027
2039
[PubMed]
26.
Mootha
VK
,
Lindgren
CM
,
Eriksson
KF
, et al
.
PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes
.
Nat Genet
2003
;
34
:
267
273
[PubMed]
27.
Patti
ME
,
Butte
AJ
,
Crunkhorn
S
, et al
.
Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: potential role of PGC1 and NRF1
.
Proc Natl Acad Sci U S A
2003
;
100
:
8466
8471
[PubMed]
28.
Sun
CY
,
Lee
CC
,
Hsieh
MF
,
Chen
CH
,
Chou
KM
.
Clinical association of circulating VEGF-B levels with hyperlipidemia and target organ damage in type 2 diabetic patients
.
J Biol Regul Homeost Agents
2014
;
28
:
225
236
[PubMed]
29.
Cheng
F
,
Zhao
L
,
Wu
Y
, et al
.
Serum vascular endothelial growth factor B is elevated in women with polycystic ovary syndrome and can be decreased with metformin treatment
.
Clin Endocrinol (Oxf)
2016
;
84
:
386
393
[PubMed]
30.
Gertow
K
,
Bellanda
M
,
Eriksson
P
, et al
.
Genetic and structural evaluation of fatty acid transport protein-4 in relation to markers of the insulin resistance syndrome
.
J Clin Endocrinol Metab
2004
;
89
:
392
399
[PubMed]
31.
Gómez-Ambrosi
J
,
Catalán
V
,
Rodríguez
A
, et al
.
Involvement of serum vascular endothelial growth factor family members in the development of obesity in mice and humans
.
J Nutr Biochem
2010
;
21
:
774
780
[PubMed]
32.
Gómez-Ambrosi
J
,
Catalán
V
,
Diez-Caballero
A
, et al
.
Gene expression profile of omental adipose tissue in human obesity
.
FASEB J
2004
;
18
:
215
217
[PubMed]

Supplementary data