Permanent neonatal diabetes mellitus (PNDM) is caused by reduced β-cell number or impaired β-cell function. Understanding of the genetic basis of this disorder highlights fundamental β-cell mechanisms. We performed trio genome sequencing for 44 patients with PNDM and their unaffected parents to identify causative de novo variants. Replication studies were performed in 188 patients diagnosed with diabetes before 2 years of age without a genetic diagnosis. EIF2B1 (encoding the eIF2B complex α subunit) was the only gene with novel de novo variants (all missense) in at least three patients. Replication studies identified two further patients with de novo EIF2B1 variants. In addition to having diabetes, four of five patients had hepatitis-like episodes in childhood. The EIF2B1 de novo mutations were found to map to the same protein surface. We propose that these variants render the eIF2B complex insensitive to eIF2 phosphorylation, which occurs under stress conditions and triggers expression of stress response genes. Failure of eIF2B to sense eIF2 phosphorylation likely leads to unregulated unfolded protein response and cell death. Our results establish de novo EIF2B1 mutations as a novel cause of permanent diabetes and liver dysfunction. These findings confirm the importance of cell stress regulation for β-cells and highlight EIF2B1’s fundamental role within this pathway.

Permanent neonatal diabetes mellitus (PNDM) is a genetically and clinically heterogeneous condition diagnosed before the age of 6 months. A genetic cause is identified in 82% of cases, resulting in improved treatment in almost 40% (1).

Thirty-nine percent of patients with PNDM have a genetic etiology resulting in development of at least one extrapancreatic feature, alongside diabetes (1). The most common PNDM syndromic subtype is Wolcott-Rallison syndrome, which is caused by autosomal recessive mutations in the EIF2AK3 gene. Individuals with Wolcott-Rallison syndrome usually develop diabetes in the first year of life. They also present with repeated episodes of hepatitis-like liver dysfunction, which eventually results in fatal liver failure, and skeletal dysplasia. The EIF2AK3 mutations in these patients are thought to result in disruption of the unfolded protein response and cell death due to unregulated endoplasmic reticulum (ER) stress (2,3). Approximately 15% of individuals with syndromic PNDM do not have a mutation in one of the known causative genes, suggesting the existence of novel genetic subtypes (4).

Identifying novel genetic causes of PNDM is crucially important to gain insights into human β-cell development, function, and survival and could identify potential targets for novel therapies.

We used a trio-based genome sequencing approach to identify heterozygous de novo EIF2B1 mutations as the cause of a novel genetic syndrome characterized by PNDM/early-onset diabetes and transient liver dysfunction.

Subjects

Individuals with PNDM and individuals with early-onset diabetes were recruited by their clinicians for genetic analysis in the Exeter Molecular Genetics Laboratory. The study was conducted in accordance with the Declaration of Helsinki, and all subjects or their parents gave informed consent for genetic testing.

Genome Sequencing

Genome sequencing was performed on DNA extracted from peripheral blood leukocytes of 44 probands diagnosed with PNDM before the age of 6 months and their unaffected, unrelated parents. Samples were sequenced on an Illumina HiSeq 2500 with a mean read depth of 30. The sequencing data were analyzed using an approach based on the gatk (Genome Analysis Toolkit) best practices guidelines. Briefly, the reads were aligned to the hg19/GRCh37 human reference genome with BWA-MEM and Picard was used for duplicates removal and gatk IndelRealigner for local realignment. gatk HaplotypeCaller was used to identify variants, which were annotated using Alamut Batch 1.8 (Interactive Biosoftware, Rouen, France). Variants that failed the QD2 VCF filter or had five or fewer reads supporting the variant were excluded. Copy number variations (CNVs) were called by SavvyCNV (5), which uses read depth to predict copy number.

Targeted Next-Generation Sequencing

Replication studies were performed in a cohort of 188 patients diagnosed with diabetes before 2 years of age in whom the 25 known genetic causes of neonatal diabetes had been excluded. Patients were analyzed using a targeted next-generation sequencing assay, including the known monogenic diabetes genes and additional candidate genes, such as EIF2B1 (NM_001414.3). Variant confirmation and cosegregation in family members were performed by Sanger sequencing.

Sanger Sequencing Confirmation

EIF2B1 exon 3 (NM_001414.3) was amplified using in-house designed primers (F, TGTTCACTGATGTATCCCTAGCA, and R, TCCTAGGAAGAAAAGAGCAAACT). PCR products were sequenced on an ABI3730 capillary machine (Applied Biosystems) and analyzed using Mutation Surveyor, version 3.98 (SoftGenetics). The bioinformatics tools SIFT, PolyPhen-2, and Align GVGD were accessed through the Alamut Visual software (Interactive Biosoftware) to predict the effect of the variants.

Variants are reported using the Human Genome Variation Society (HGVS) nomenclature guidelines (6).

Molecular Modeling of the EIF2B1 Stop-Loss Variant

The predicted structure of the EIF2B1 stop-loss variant, c.915_916del, p.(*306Thrext*12), was modeled using the Phyre2 Web server in intensive mode 3, with the full-length sequence of variant eIF2Bα as input. The resulting structure was modeled entirely on PDB (Protein Data Bank) entry 3ECS (crystal structure of human eIF2Bα 4), except for the COOH-terminal extension, which was modeled ab initio. All structures were visualized in PyMOL (Molecular Graphics System v2.0; Schrödinger LLC).

Data and Resource Availability

EIF2B1 mutation details have been deposited in the Decipher database (https://decipher.sanger.ac.uk/). All other data sets generated and/or analyzed for this study are available from the corresponding author upon reasonable request.

Genetic Analysis

EIF2B1 was the only gene identified with de novo variants in at least three patients. The three missense EIF2B1 variants identified, p.(Gly44Asp), p.(Gly44Val), and p.(Ser77Asn) (Table 1), were not listed in the GnomAD database (7). All affected residues are highly conserved across species (up to zebrafish for p.Gly44, up to chicken for p.Ser77). No deletions or duplications involving EIF2B1 were detected.

Table 1

Patients’ clinical features

Case subject number
12345
Mutation c.131G>A, p.(Gly44Asp) c.131G>T, p.(Gly44Val) c.230G>A, p.(Ser77Asn) c.101T>G, p.(Leu34Trp) c.915_916del, p.(*306Thrext*12) 
De novo Yes Yes Yes Yes Yes 
Sex Male Male Female Male Male 
Current age (years) Deceased 13 18 
Country Vietnam Jordan Chile England Israel 
Birth weight (g) 2,600 3,000 2,986 2,920 3,600 
Gestation (weeks) 39 N/A 40 40 42 
Birth weight centile (SDS) 4th (−1.74) N/A 18th (−0.90) 7th (−1.44) 20th (−0.84) 
Diabetes features      
 Age at onset 9 weeks 4 weeks 17 weeks 56 weeks 21 weeks 
 Insulin treatment From diagnosis, 0.46 units/kg/day (at 2 months) From diagnosis, 0.8 units/kg/day From diagnosis, 1.0 units/kg/day From diagnosis, 0.7 units/kg/day From diagnosis, 0.75 units/kg/day 
Hepatic features      
 Age at first episode of liver dysfunction 38 months None reported 16 months 18 months 5 months 
 Outcome of first episode Resolved N/A Deceased Resolved Resolved 
 Recurrent episodes No N/A N/A Yes, 8 episodes Yes, 2 episodes 
 Age at last episode of liver dysfunction N/A N/A N/A 5.5 years 5.5 months 
Other features      
 Neurological features None None None Mild learning disability Attention deficit disorder 
 Additional comments Anemia  Died at 16 months after respiratory infection and acute liver failure Renal failure at 14 years  
Case subject number
12345
Mutation c.131G>A, p.(Gly44Asp) c.131G>T, p.(Gly44Val) c.230G>A, p.(Ser77Asn) c.101T>G, p.(Leu34Trp) c.915_916del, p.(*306Thrext*12) 
De novo Yes Yes Yes Yes Yes 
Sex Male Male Female Male Male 
Current age (years) Deceased 13 18 
Country Vietnam Jordan Chile England Israel 
Birth weight (g) 2,600 3,000 2,986 2,920 3,600 
Gestation (weeks) 39 N/A 40 40 42 
Birth weight centile (SDS) 4th (−1.74) N/A 18th (−0.90) 7th (−1.44) 20th (−0.84) 
Diabetes features      
 Age at onset 9 weeks 4 weeks 17 weeks 56 weeks 21 weeks 
 Insulin treatment From diagnosis, 0.46 units/kg/day (at 2 months) From diagnosis, 0.8 units/kg/day From diagnosis, 1.0 units/kg/day From diagnosis, 0.7 units/kg/day From diagnosis, 0.75 units/kg/day 
Hepatic features      
 Age at first episode of liver dysfunction 38 months None reported 16 months 18 months 5 months 
 Outcome of first episode Resolved N/A Deceased Resolved Resolved 
 Recurrent episodes No N/A N/A Yes, 8 episodes Yes, 2 episodes 
 Age at last episode of liver dysfunction N/A N/A N/A 5.5 years 5.5 months 
Other features      
 Neurological features None None None Mild learning disability Attention deficit disorder 
 Additional comments Anemia  Died at 16 months after respiratory infection and acute liver failure Renal failure at 14 years  

N/A, not available.

Sequencing of EIF2B1 in 188 further patients without a known genetic diagnosis who had developed diabetes before the age of 2 years identified two additional novel heterozygous EIF2B1 variants, p.(Leu34Trp) and p.(*306Thrext*12). Parental testing showed that both variants had arisen de novo.

Clinical Features

The clinical features of the five subjects with de novo EIF2B1 mutations are summarized in Table 1. All had been diagnosed with permanent diabetes between the ages of 4 and 56 weeks and were treated with full replacement insulin doses (range 0.46–1.00 units/kg/day). All four patients for whom data were available had low birth weight (<20th centile, SDS range −0.84 to −1.74) consistent with reduced insulin secretion in utero.

Four of the five patients had suffered episodes of hepatic dysfunction in childhood with hepatitis-like derangement of liver enzymes. The severity of these episodes was variable: for case subject 3, the first episode resulted in fatal acute liver failure, while the other three cases resolved with return to normal liver function and enzymes. Case subject 1 presented once with elevated liver enzymes at the age of 38 months. Case subjects 4 and 5 experienced multiple episodes requiring hospitalization between the ages of 5 months and 5.5 years but have not experienced any further episodes (current ages 13 and 18 years).

No severe neurological features were reported; however, case subject 4 has a mild learning disability and case subject 5 has attention deficit disorder.

In Silico Protein Analysis

EIF2B1 encodes for the α-subunit of the heterodecameric eIF2B complex, which modulates the activity of the eukaryotic translation initiation factor 2 (eIF2) to regulate translation initiation and protein synthesis in basal and stress cell conditions. Under cell stress, serine 51 of eIF2α is phosphorylated by kinases of the integrated stress response (ISR) (8). This phosphorylation results in altered interaction with eIF2B to inhibit the rate of translation of most mRNAs, with the exception of stress response gene RNAs, which are able to circumvent this block to allow cell recovery (9,10). The recent publication of the structures of human eIF2B in complex with both phosphorylated and nonphosphorylated eIF2 (11,12) showed that in its nonphosphorylated form, eIF2α makes contact with the eIF2Bβ, γ, and δ subunits—but not with eIF2Bα. However, upon Ser51 phosphorylation, eIF2α binds tightly to eIF2Bα, resulting in a markedly different orientation of eIF2 in the complex with eIF2B (Fig. 1A).

Figure 1

Heterozygous EIF2B1 variants in neonatal diabetes lie in the binding surface for phosphorylated eIF2α. A: Structure of human eIF2B in complex with phosphorylated eIF2α Ser51 (eIF2α[Ser51-P]) (PDB identification 6o9z [12]); the eIF2B complex is a heterodecamer comprised of two molecules each of subunits α, β, γ, δ, and ε. B: As in A but shown without phosphorylated eIF2α Ser51; positions of heterozygous missense variants in eIF2Bα identified in patients with neonatal diabetes are colored red and labeled in black font, the position of the homozygous p.(Leu49Arg) variant reported in a VWM patient is colored orange and labeled in blue font, and Leu305 (gray) is the COOH-terminal (C-terminal) residue of eIF2Bα. C: The stop-loss variant c.915_916del, p.(*306Thrext*12), is expected to result in the addition of 12 novel amino acids (Thr-Cys-Glu-Pro-Phe-Pro-Ala-Lys-Val-Gln-Leu-Thr) to the COOH-terminal of eIF2B; this COOH-terminal extension (dark red) was predicted to form a short helix extending from Leu305 lying across the surface bound by phosphorylated eIF2α Ser51. D: As in A but zoomed and showing selected subunits (phosphorylated eIF2α Ser51and eIF2B subunits β, δ, and α′) in ribbon format. Surface positions of heterozygous missense variants identified in patients with neonatal patients are colored red, and the position of the homozygous p.(Leu49Arg) VWM variant is colored orange, as in B; positions of other homozygous variants identified in VWM patients are colored yellow and labeled in blue font (Tyr275, the site of the p.Tyr275Cys variant, is not visible in these views but is surface accessible at the junction of the interfaces with subunits δ and α′; Asn208, which was substituted by glutamate in a case of VWM, is not accessible at the eIF2Bα surface). The light-green residue in the eIF2α ribbon indicates the position of phosphorylated serine 51.

Figure 1

Heterozygous EIF2B1 variants in neonatal diabetes lie in the binding surface for phosphorylated eIF2α. A: Structure of human eIF2B in complex with phosphorylated eIF2α Ser51 (eIF2α[Ser51-P]) (PDB identification 6o9z [12]); the eIF2B complex is a heterodecamer comprised of two molecules each of subunits α, β, γ, δ, and ε. B: As in A but shown without phosphorylated eIF2α Ser51; positions of heterozygous missense variants in eIF2Bα identified in patients with neonatal diabetes are colored red and labeled in black font, the position of the homozygous p.(Leu49Arg) variant reported in a VWM patient is colored orange and labeled in blue font, and Leu305 (gray) is the COOH-terminal (C-terminal) residue of eIF2Bα. C: The stop-loss variant c.915_916del, p.(*306Thrext*12), is expected to result in the addition of 12 novel amino acids (Thr-Cys-Glu-Pro-Phe-Pro-Ala-Lys-Val-Gln-Leu-Thr) to the COOH-terminal of eIF2B; this COOH-terminal extension (dark red) was predicted to form a short helix extending from Leu305 lying across the surface bound by phosphorylated eIF2α Ser51. D: As in A but zoomed and showing selected subunits (phosphorylated eIF2α Ser51and eIF2B subunits β, δ, and α′) in ribbon format. Surface positions of heterozygous missense variants identified in patients with neonatal patients are colored red, and the position of the homozygous p.(Leu49Arg) VWM variant is colored orange, as in B; positions of other homozygous variants identified in VWM patients are colored yellow and labeled in blue font (Tyr275, the site of the p.Tyr275Cys variant, is not visible in these views but is surface accessible at the junction of the interfaces with subunits δ and α′; Asn208, which was substituted by glutamate in a case of VWM, is not accessible at the eIF2Bα surface). The light-green residue in the eIF2α ribbon indicates the position of phosphorylated serine 51.

Mapping the heterozygous EIF2B1 variants from our five case subjects shows that these all lie at the same surface as that occupied by phosphorylated eIF2α (Fig. 1B). Moreover, one of these variants (identified in case subject 3) occurs at p.Ser77 of eIF2Bα, which makes both hydrogen-bonded and nonbonded contacts with residues of phosphorylated eIF2α. In the stop-loss variant identified in case subject 5, the COOH-terminal extension to eIF2Bα is likely to sterically hinder the interaction of eIF2α with eIF2Bα p.Leu305 as well as possibly occluding other parts of the interface (Fig. 1C).

We report the identification of EIF2B1 heterozygous de novo variants in five patients with PNDM/early-onset diabetes and transient liver dysfunction. The variants, four missense and one stop-loss, are all predicted to map to the same protein surface, and in silico modeling suggests that they are likely to disrupt the interaction of the EIF2Bα subunit (encoded by EIF2B1) with phosphorylated EIF2α during the cell ISR.

Our patients’ clinical features are markedly different from those reported in patients with leukoencephalopathy with vanishing white matter (VWM), a rare pediatric neurological disease caused by recessive loss-of-function EIF2B1 mutations (13). VWM is a progressive condition, usually fatal in childhood. Extraneurological features are generally not present, although diabetic ketoacidosis at 8 months was reported in one patient with a homozygous p.(Leu49Arg) variant in EIF2B1 (14). None of the five patients we report had severe neurological features; however, case subject 4 has a mild learning disability and case subject 5 has attention deficit disorder. The parents of individuals with VWM, who are heterozygous carriers for EIF2B1 loss-of-function mutations, are unaffected, thereby supporting our hypothesis that the mutations identified in our patients do not result in complete loss of function of the eIF2B complex.

eIF2B regulates translation initiation and protein synthesis by modulating eIF2 activity. During protein synthesis under normal conditions, eIF2B acts to recycle initiation factor eIF2 for further rounds of translation by promoting its dissociation from GDP, allowing replacement by GTP and subsequent association of GTP-bound eIF2 with the initiator methionyl-tRNA. Under stress conditions, specific kinases phosphorylate the serine 51 of eIF2α (8) resulting in inhibition of GDP dissociation, attenuating recycling of eIF2 to its active GTP-bound form through altered interaction with eIF2B and consequently inhibiting the rate of translation of most mRNAs (9,10) (Fig. 2A).

Figure 2

Different forms of monogenic neonatal diabetes affect steps in the ISR pathway. A: Stress conditions induce activation of four kinases of the ISR. Pancreatic eIF2-α kinase (PERK) responds mainly to ER stress and is of particular importance in maintaining liver and pancreatic β-cells; other kinases of the IRS are protein kinase R (PKR), GCN2, and heme‐regulated eIF2α kinase (HRI), which respond to double-strand RNA, amino acid deprivation, and heme deprivation, respectively. Phosphorylation (P) of Ser51 of eIF2α results in a tight interaction with eIF2Bα, which inhibits the GDP dissociation activity mediated primarily by the γ and ε subunits of eIF2B and thus arrests translation of most mRNAs, except for specific mRNAs associated with the stress response program. B: In Wolcott-Rallison syndrome, homozygous or compound heterozygous loss-of-function variants in EIF2AK3, the gene encoding PERK, prevent phosphorylation of eIF2α Ser51 in response to ER stress; the lack of an appropriate stress response ultimately leads to a prolonged unfolded protein response and cell death. C: The dominant eIF2B1 variants identified in neonatal patients all lie in the binding surface for phosphorylated eIF2α and likely prevent effective sensing of Ser51 phosphorylation by eIF2B. This defect would be expected to affect the response to all kinases of the ISR, potentially explaining differences in the phenotype compared with that of Wolcott-Rallison syndrome and the dominant nature of the disease.

Figure 2

Different forms of monogenic neonatal diabetes affect steps in the ISR pathway. A: Stress conditions induce activation of four kinases of the ISR. Pancreatic eIF2-α kinase (PERK) responds mainly to ER stress and is of particular importance in maintaining liver and pancreatic β-cells; other kinases of the IRS are protein kinase R (PKR), GCN2, and heme‐regulated eIF2α kinase (HRI), which respond to double-strand RNA, amino acid deprivation, and heme deprivation, respectively. Phosphorylation (P) of Ser51 of eIF2α results in a tight interaction with eIF2Bα, which inhibits the GDP dissociation activity mediated primarily by the γ and ε subunits of eIF2B and thus arrests translation of most mRNAs, except for specific mRNAs associated with the stress response program. B: In Wolcott-Rallison syndrome, homozygous or compound heterozygous loss-of-function variants in EIF2AK3, the gene encoding PERK, prevent phosphorylation of eIF2α Ser51 in response to ER stress; the lack of an appropriate stress response ultimately leads to a prolonged unfolded protein response and cell death. C: The dominant eIF2B1 variants identified in neonatal patients all lie in the binding surface for phosphorylated eIF2α and likely prevent effective sensing of Ser51 phosphorylation by eIF2B. This defect would be expected to affect the response to all kinases of the ISR, potentially explaining differences in the phenotype compared with that of Wolcott-Rallison syndrome and the dominant nature of the disease.

Mapping the heterozygous EIF2B1 variants identified in the five case subjects we report shows that these all localize at the same surface as that occupied by phosphorylated eIF2α (Fig. 1B). Moreover one variant, p.(Ser77Asn), identified in case subject 3, occurs at a residue that directly interacts with phosphorylated eIF2α. Two mutations, identified in case subjects 1 and 2, involve eIF2Bα p.Gly44. Previous experiments have shown that mutation of the equivalent residue in GCN3, the yeast ortholog of EIF2B1, results in full cell viability under normal conditions but failure to respond to eIF2α phosphorylation under stress (15). In contrast, most EIF2B1 variants that have been reported in patients with VWM occur at interfaces with other eIF2B subunits (Fig. 1D), consistent with their reported effects on the formation and/or stability of the eIF2B complex (16). Taken together, this evidence strongly suggests that the EIF2B1 variants identified in our patients are likely to result in formation of the eIF2B complex and support translation under normal conditions but impair eIF2B binding to phosphorylated eIF2α under stress conditions.

Impaired cellular stress response is a known β-cell dysfunction mechanism and is involved in other genetic subtypes of PNDM, including Wolcott-Rallison syndrome, the most common syndromic form of the disease (17). Wolcott-Rallison syndrome is characterized by PNDM/early-onset diabetes, severe liver dysfunction (presenting with transient episodes of acute liver failure), and skeletal dysplasia and is caused by recessive mutations in the EIF2AK3 gene, encoding the pancreatic eIF2-α kinase (PERK) (18). EIF2AK3 loss-of-function variants in Wolcott-Rallison syndrome disrupt the ISR, thereby limiting the response to ER stress, impairing the cell’s ability to recover, and leading to cell death (Fig. 2B).

Our results are consistent with the hypothesis that the EIF2AK3 variants in Wolcott-Rallison syndrome and the novel EIF2B1 variants identified in our cases affect different steps within the same ER stress response pathway (Fig. 2C), highlighting the importance of this pathway in pancreatic β-cell and liver cell function and integrity (19). The convergence of both EIF2B1 and EIF2AK3 on the ISR provides an explanation for the phenotypic overlap between Wolcott-Rallison syndrome and the disease caused by dominant EIF2B1 variants, consisting of neonatal/early-onset diabetes and liver dysfunction. However, whereas liver symptoms appear to resolve with age in the patients with EIF2B1 variants, prognosis in Wolcott-Rallison syndrome is poor and most patients die of liver failure. Additionally, individuals with Wolcott-Rallison syndrome have skeletal dysplasia, a feature not observed in the case subjects with EIF2B1 variants we report. It has been proposed that the skeletal manifestations in Wolcott-Rallison syndrome arise specifically from a developmental defect in osteoblasts due to absence of PERK activity (2,3) rather than from the ER stress regulation defect that is thought to cause PNDM and liver failure. Another possible explanation for the differences in the extrapancreatic phenotypes in case subjects with Wolcott-Rallison syndrome and the individuals with EIF2B1 de novo variants we report could be the existence of quantitative differences in strength of signal or in its specific relationship to ER stress. It is possible that the level of attenuation of the ISR and the context for the attenuation caused by heterozygous mutations in EIF2B1 are enough to cause β-cell dysfunction and diabetes but not enough to result in the severe liver and skeletal phenotype.

In summary, we report a novel genetic syndrome of neonatal/early-onset diabetes and transient liver dysfunction caused by dominant de novo EIF2B1 mutations that disrupt the ability of the eIF2B complex to sense eIF2 phosphorylation and likely result in severe ER stress. These results further highlight the importance of ER stress regulation for β-cell function, adding another key gene to the list of ER stress regulators that, when mutated, cause syndromic forms of diabetes (4,2027). This knowledge is crucial to inform current efforts aimed at developing targeted therapies for patients with syndromic forms of diabetes caused by ER stress dysregulation (28,29) but also for patients with type 2 (30) and type 1 (31) diabetes, as ER stress is known to play a key role in the pathogenesis of these more common diabetes subtypes.

Acknowledgments. The authors thank the families for participating in the study. The authors are also grateful to Rebecca Ward (Exeter Genomics Laboratory, Royal Devon and Exeter Hospital) for technical assistance, Dr. Thomas Laver (University of Exeter Medical School) for critical review of the manuscript, and Dr. Ethel Codner (Institute for Mother and Child Research, University of Chile) for assistance with clinical data collection. Whole-genome data analysis was run on the University of Exeter ISCA high-performance computing facility.

Funding. E.D.F. is a Diabetes UK RD Lawrence Fellow (19/005971) and the recipient of a European Foundation for the Study of Diabetes Rising Star Fellowship (2018). E.D.F. has also received funding from the DRWF (Diabetes Research & Wellness Foundation). A.T.H. and S.E. are the recipients of a Wellcome Trust Senior Investigator award (grant WT098395/Z/12/Z). A.T.H. is employed as a core member of staff within the National Institute for Health Research (NIHR)-funded Exeter Clinical Research Facility and is an NIHR senior investigator. S.E.F. has a Sir Henry Dale Fellowship jointly funded by the Wellcome Trust and the Royal Society (grant number 105636/Z/14/Z). D.R.’s research is supported by a Wellcome Trust Principal Research Fellowship (Wellcome Trust 200848/Z/16/Z).

Duality of Interest. No potential conflicts of interest relevant to this article were reported.

Author Contributions. E.D.F., A.T.H., S.E., and S.E.F. participated in study conception and design. E.D.F., S.E.F., M.B.J., and S.E. performed the genetic analysis. A.T.H. analyzed the clinical data. M.N.W. and R.C. performed bioinformatics analysis. D.R. participated in data analysis and interpretation. E.D.F. wrote the first draft of the manuscript. R.C., A.T.H., and D.R. participated in manuscript improvement. A.Z., V.C.D., C.T.B.N., R.G., M.V.J., and M.E.-K. collected patients’ samples and clinical data. All authors reviewed the manuscript. E.D.F. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

1.
De Franco
E
,
Flanagan
SE
,
Houghton
JA
, et al
.
The effect of early, comprehensive genomic testing on clinical care in neonatal diabetes: an international cohort study
.
Lancet
2015
;
386
:
957
963
2.
Wei
J
,
Sheng
X
,
Feng
D
,
McGrath
B
,
Cavener
DR
.
PERK is essential for neonatal skeletal development to regulate osteoblast proliferation and differentiation
.
J Cell Physiol
2008
;
217
:
693
707
3.
Zhang
P
,
McGrath
B
,
Li
S
, et al
.
The PERK eukaryotic initiation factor 2 alpha kinase is required for the development of the skeletal system, postnatal growth, and the function and viability of the pancreas
.
Mol Cell Biol
2002
;
22
:
3864
3874
4.
De Franco
E
,
Flanagan
SE
,
Yagi
T
, et al
.
Dominant ER stress-inducing WFS1 mutations underlie a genetic syndrome of neonatal/infancy-onset diabetes, congenital sensorineural deafness, and Congenital Cataracts
.
Diabetes
2017
;
66
:
2044
2053
5.
Laver
TW
,
De Franco
E
,
Johnson
MB
, et al
.
SavvyCNV: genome-wide CNV calling from off-target reads
[article online], 2019. Available from https://www.biorxiv.org/content/10.1101/617605v2.full. Accessed 10 September 2019
6.
den Dunnen
JT
,
Dalgleish
R
,
Maglott
DR
, et al
.
HGVS recommendations for the description of sequence variants: 2016 update
.
Hum Mutat
2016
;
37
:
564
569
7.
Karczewski
KJ
,
Francioli
LC
,
Tiao
G
, et al
.
Variation across 141,456 human exomes and genomes reveals the spectrum of loss-of-function intolerance across human protein-coding genes [article online], 2019. Available from https://www.biorxiv.org/content/10.1101/531210v2. Accessed 10 September 2019
8.
Pakos-Zebrucka
K
,
Koryga
I
,
Mnich
K
,
Ljujic
M
,
Samali
A
,
Gorman
AM
.
The integrated stress response
.
EMBO Rep
2016
;
17
:
1374
1395
9.
Jennings
MD
,
Pavitt
GD
.
A new function and complexity for protein translation initiation factor eIF2B
.
Cell Cycle
2014
;
13
:
2660
2665
10.
Holcik
M
.
Could the eIF2α-independent translation be the Achilles heel of cancer
?
Front Oncol
2015
;
5
:
264
11.
Kashiwagi
K
,
Yokoyama
T
,
Nishimoto
M
, et al
.
Structural basis for eIF2B inhibition in integrated stress response
.
Science
2019
;
364
:
495
499
12.
Kenner
LR
,
Anand
AA
,
Nguyen
HC
, et al
.
eIF2B-catalyzed nucleotide exchange and phosphoregulation by the integrated stress response
.
Science
2019
;
364
:
491
495
13.
van der Knaap
MS
,
Leegwater
PA
,
Könst
AA
, et al
.
Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter
.
Ann Neurol
2002
;
51
:
264
270
14.
Alamri
H
,
Al Mutairi
F
,
Alothman
J
,
Alothaim
A
,
Alfadhel
M
,
Alfares
A
.
Diabetic ketoacidosis in vanishing white matter
.
Clin Case Rep
2016
;
4
:
717
720
15.
Pavitt
GD
,
Yang
W
,
Hinnebusch
AG
.
Homologous segments in three subunits of the guanine nucleotide exchange factor eIF2B mediate translational regulation by phosphorylation of eIF2
.
Mol Cell Biol
1997
;
17
:
1298
1313
16.
Wortham
NC
,
Proud
CG
.
Biochemical effects of mutations in the gene encoding the alpha subunit of eukaryotic initiation factor (eIF) 2B associated with Vanishing White Matter disease
.
BMC Med Genet
2015
;
16
:
64
17.
Gupta
S
,
McGrath
B
,
Cavener
DR
.
PERK (EIF2AK3) regulates proinsulin trafficking and quality control in the secretory pathway
.
Diabetes
2010
;
59
:
1937
1947
18.
Delépine
M
,
Nicolino
M
,
Barrett
T
,
Golamaully
M
,
Lathrop
GM
,
Julier
C
.
EIF2AK3, encoding translation initiation factor 2-alpha kinase 3, is mutated in patients with Wolcott-Rallison syndrome
.
Nat Genet
2000
;
25
:
406
409
19.
Cnop
M
,
Toivonen
S
,
Igoillo-Esteve
M
,
Salpea
P
.
Endoplasmic reticulum stress and eIF2α phosphorylation: the Achilles heel of pancreatic β cells
.
Mol Metab
2017
;
6
:
1024
1039
20.
Poulton
CJ
,
Schot
R
,
Kia
SK
, et al
.
Microcephaly with simplified gyration, epilepsy, and infantile diabetes linked to inappropriate apoptosis of neural progenitors
.
Am J Hum Genet
2011
;
89
:
265
276
21.
Skopkova
M
,
Hennig
F
,
Shin
BS
, et al
.
EIF2S3 mutations associated with severe X-linked intellectual disability syndrome MEHMO
.
Hum Mutat
2017
;
38
:
409
425
22.
Støy
J
,
Edghill
EL
,
Flanagan
SE
, et al.;
Neonatal Diabetes International Collaborative Group
.
Insulin gene mutations as a cause of permanent neonatal diabetes
.
Proc Natl Acad Sci USA
2007
;
104
:
15040
15044
23.
Abdulkarim
B
,
Nicolino
M
,
Igoillo-Esteve
M
, et al
.
A missense mutation in PPP1R15B causes a syndrome including diabetes, short stature, and microcephaly
.
Diabetes
2015
;
64
:
3951
3962
24.
Amr
S
,
Heisey
C
,
Zhang
M
, et al
.
A homozygous mutation in a novel zinc-finger protein, ERIS, is responsible for Wolfram syndrome 2
.
Am J Hum Genet
2007
;
81
:
673
683
25.
Bonnycastle
LL
,
Chines
PS
,
Hara
T
, et al
.
Autosomal dominant diabetes arising from a Wolfram syndrome 1 mutation
.
Diabetes
2013
;
62
:
3943
3950
26.
Inoue
H
,
Tanizawa
Y
,
Wasson
J
, et al
.
A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome)
.
Nat Genet
1998
;
20
:
143
148
27.
Synofzik
M
,
Haack
TB
,
Kopajtich
R
, et al
.
Absence of BiP co-chaperone DNAJC3 causes diabetes mellitus and multisystemic neurodegeneration
.
Am J Hum Genet
2014
;
95
:
689
697
28.
Abreu
D
,
Urano
F
.
Current landscape of treatments for Wolfram Syndrome
.
Trends Pharmacol Sci
2019
;
40
:
711
714
29.
Ryno
LM
,
Wiseman
RL
,
Kelly
JW
.
Targeting unfolded protein response signaling pathways to ameliorate protein misfolding diseases
.
Curr Opin Chem Biol
2013
;
17
:
346
352
30.
Ozcan
U
,
Cao
Q
,
Yilmaz
E
, et al
.
Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes
.
Science
2004
;
306
:
457
461
31.
Engin
F
.
ER stress and development of type 1 diabetes
.
J Investig Med
2016
;
64
:
2
6
Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered. More information is available at https://www.diabetesjournals.org/content/license.