The signal peptide of preproinsulin is a major source for HLA class I autoantigen epitopes implicated in CD8 T cell (CTL)–mediated β-cell destruction in type 1 diabetes (T1D). Among them, the 10-mer epitope located at the C-terminal end of the signal peptide was found to be the most prevalent in patients with recent-onset T1D. While the combined action of signal peptide peptidase and endoplasmic reticulum (ER) aminopeptidase 1 (ERAP1) is required for processing of the signal peptide, the mechanisms controlling signal peptide trimming and the contribution of the T1D inflammatory milieu on these mechanisms are unknown. Here, we show in human β-cells that ER stress regulates ERAP1 gene expression at posttranscriptional level via the IRE1α/miR-17-5p axis and demonstrate that inhibition of the IRE1α activity impairs processing of preproinsulin signal peptide antigen and its recognition by specific autoreactive CTLs during inflammation. These results underscore the impact of ER stress in the increased visibility of β-cells to the immune system and position the IRE1α/miR-17 pathway as a central component in β-cell destruction processes and as a potential target for the treatment of autoimmune T1D.

Type 1 diabetes (T1D) results from selective and progressive destruction of insulin-producing cells by autoreactive CD8+ T cells (CTLs) (1,2). Immunohistochemistry of insulitic pancreases obtained through the Network for Pancreatic Organ Donors with Diabetes program (nPOD) have shown infiltration of immune cells and an increased expression of markers characteristic of the unfolded protein response (UPR) (36). Altogether, these results suggest an association between endoplasmic reticulum (ER) stress and the increased visibility of β-cells to the immune system (79). While several proteins have been identified as potential autoreactive T-cell targets, evidence from mouse and human studies have suggested that insulin protein itself could be the main and primary autoantigen targeted by infiltrating CTLs (1012). The posttranslational processing pathway that generates insulin from its precursor molecule preproinsulin (PPI) is well established: the signal peptidase Sec11 cleaves off the signal peptide (SP) cotranslationally upon translocation of the protein into the ER via the translocon Sec61 (13). After folding and formation of disulfide bonds, proinsulin is transported via the Golgi system into immature secretory vesicles where mature insulin is generated by the combined action of prohormone convertases and release of the C-peptide central region (1315). Although being the least studied domain of the PPI molecule, increasing evidence highlights the importance of the 24 amino acids–long insulin SP sequence as a major source of insulin-derived class I epitopes (16). Peptide elution experiments performed on HLA-A2 purified from surrogate β-cells have led to the identification of prominent HLA class I binders derived from the SP domain (17), and PPI15–24–directed CTLs were highly prevalent in patients with recent-onset T1D (18). Recently, the importance of the combined action of the SP peptidase and ER aminopeptidase 1 (ERAP1) in the trimming of the PPI SP and in the generation of PPI SP–derived epitopes was demonstrated using cell-free translocation assay and CRISPR/Cas technology (19). While these data match with the substrate preference of ERAP1 (20,21), the link between pathophysiological features of T1D and the immunoreactivity against PPI15–24 remains unclear.

Here, we investigated the effect of inflammation and ER stress on ERAP1 gene expression in human β-cells and show that proinflammatory cytokines modulate ERAP1 expression both at transcriptional and posttranscriptional level though interaction with miR-17. More importantly, we show in primary human islets that during inflammation, the specific inhibition of IRE1α endoribonuclease activity reduces ERAP1 expression and limits SP-derived epitope presentation to PPI autoreactive CTLs. Altogether, these data establish a direct connection between ER stress and β-cell immunogenicity and underline the importance of ER sensors in shaping antigenic peptide presentation to diabetogenic CTLs.

DNA Constructs

PPI cDNA was obtained from reverse transcriptase reaction of total human islets RNA extraction using the following primers: PPI-Full (forward): ATG GCC CTG TGG ATG CGC CTC CTG CCC; PPI-Full (reverse): GTT GCA GTA GTT CTC CAG CTG GTA GAG GGA GCA. Lentivirus (LV)-cytomegalovirus (CMV)-PPI was generated by insertion of the coding region of the PPI cDNA into pLV-CMV-bcGFP. For miRNA reporter construct, the following primers were annealed and cloned into pMIR-REPORT (Thermo Fisher Scientific) open with PmeI. ERAP untranslated region (UTR) forward: 5′-GTA ATT TGA ATA TAG ACA CAA TGC ACT TTA TTG CAC TTT CAA TTC TTA TAA AGC; ERAP UTR reverse: 5′-GCT TTA TAA GAA TTG AAA GTG CAA TAA AGT GCA TTG TGT CTA TAT TCA AAT TAC; ERAP UTR mutated (mut) forward: 5′-GTA ATT TGA ATA TAG ACA CAA TGC ACT TTA TTG TGC TTT CAA TTC TTA TAA AGC; and ERAP UTR mut reverse: 5′-GCT TTA TAA GAA TTG AAA GCA CAA TAA AGT GCA TTG TGT CTA TAT TCA AAT TAC. The ERAP1 promoter reporter construct was generated by inserting a XhoI/HindIII fragment containing the −1,325/+60 region of the ERAP1 promoter into pGL3 vector (Promega, Madison, WI). The promoter region was cloned from human genomic DNA using the following primers: ERAP promoter forward: 5′-CCC TCG AGG TCA CAG AAT GAG ATA GAA GGT AGG CAC AAG-3′ and ERAP promoter reverse: 5′-GGA AGC TTC CTA CCC GCG GCT CGA GCG CGC TGT ACC TGG-3′. The underlined sequences represent the restriction sites used for cloning. The constructs were verified by sequencing.

Cells and Reagents

HEK 293T cells were grown in high-glucose DMEM supplemented with 10% (v/v) heat-inactivated FBS (Gibco BRL) and penicillin/streptomycin at 37°C, 5% CO2. PPI15–24–directed CTLs (17) were maintained in Iscove's Modified Dulbecco's Medium supplemented with 10% human serum, interleukin (IL)-2 and IL-15 and restimulated every 14 days with irradiated JY cells (pulsed with 2 μg/mL PPI15–24 peptide) at a 1:1 ratio and irradiated peripheral blood mononuclear cells of five different donors (at a ratio of 1:5) in the presence of IL-2, IL-15, IL-l7, IL12, and leuco-A. PPI15–24 was synthesized using solid-phase fluorenylmethyloxycarbonyl (Fmoc) chemistry and analyzed by reverse-phase high-performance liquid chromatography (RP-HPLC) mass spectrometry for purity and identity. HEK293T cells are HLA-A2+ and routinely used in our laboratory as a target for HLA-A2–restricted CD8 clones (22). Although many differences could be expected between cell line and primary β-cells, EndoC-βH1 cells remain the best material available to study human β-cell biology (23). EndoC-βH1 cells, obtained from Dr. Raphael Scharfmann (Paris Descartes University, France) (24), were maintained in low-glucose DMEM supplemented with 5.5 μg/mL human transferrin, 10 mmol/L nicotinamide, 6.7 ng/mL selenite, 50 μmol/L β-mercaptoethanol, 2% human albumin, 100 units/mL penicillin, and 100 μg/mL streptomycin. Cells were seeded in extracellular matrix, fibronectin precoated culture plates. Inflammatory stress was induced by a mixture of 1,000 units/mL interferon-γ (IFN-γ) and 2 ng/mL IL-1β for 24 h. Staurosporine was used at 100 nmol/L for 1 h and thapsigargin was used at 100 nmol/L for 24 h. MKC3946 inhibitor was used at 10 μmol/L for 24 h in our assay, unless differently stated. The inhibitor was added simultaneously to other treatments.

miRNA and DNA Transfection

Transient transfection of miRNA mimics and DNA vectors were performed using Lipofectamine 2000 (Invitrogen, Karlsruhe, Germany) according to manufacturer’s protocol. EndoC-βH1 cells were transfected in a 12-well plate, using a final concentration of 200 nmol/L total miRNA precursor. The Homo sapiens (hsa)-miR-17-5p precursor (PM12412; Ambion), premiR #1 (negative control 1, AM17110; Ambion) and hsa-miR-17-5p inhibitor (AM12412; Ambion) were used. Experiments were continued 24 h after transfection. For the validation of miRNA targeting sites, 293T cells were cotransfected in a 96-well plate with 125 ng pMiR-luciferase (luc)-ERAP1-wild-type (wt)UTR or pMIR-luc-ERAP1-mutUTR and 50 nmol/L miRNA precursor hsa-miR-17-5p precursor or premiR hsa-miR-1 per well. Transfections were performed in triplicate, and cells were analyzed 24 h after transfection. For the evaluation of ERAP1 transcriptional regulation, EndoC-βH1 cells were cotransfected with the ERAP1 promoter reporter construct and a lentiviral vector including a GFP gene under the control of a CMV promoter to estimate transfection efficiency. Transfections were performed in a 96-well plate with 150 ng total DNA per well. Transfected cells were treated 24 h later with thapsigargin (100 nmol/L) or 1,000 units/mL IFN-γ and 2 ng/mL IL-1β for 24 h, and luciferase activity was measured.

Luciferase Assay

Cells were lysed in luciferase lysis buffer (125 mmol/L Tris/HCl [pH 7.8], 10 mmol/L cyclohexane-1,2-diaminetetraacetic acid, 10 mmol/L dithiothreitol, 50% [v/v] glycerol, and 5% [v/v] Triton X-100]. Luciferase activity was determined by luminometry using the Luciferase Assay Reagent (Promega). β-Galactosidase activity was determined by luminometry using the Galacto-Light Dual-Light kit (Tropix). Light emission was determined using the Lumat LB9501 luminometer (Berthold, Bad Wildbad, Germany).

Lentiviruses Production and Transduction

The vectors were produced as described previously (25). Briefly, the lentiviral backbone containing the gene of interest and the three helper plasmids (encoding HIV-1 gag-pol, HIV-1 rev, and the VSV-G envelope protein) were cotransfected overnight using the calcium phosphate method into 293T cells. The medium was refreshed, and viruses were harvested after 48 and 72 h, passed through 0.45-µm filters, and stored at −80°C. Virus was quantified by antigen capture ELISA measuring HIV p24 levels (ZeptoMetrix, New York, NY) as described (26). Viral supernatants were added to fresh medium supplemented with 8 mg/mL Polybrene (Sigma-Aldrich), and the cells were incubated overnight. The next day, the medium was replaced with fresh medium. Transduction efficiency was analyzed 3–6 days after transduction.

ERAP1 Downregulation

shRNA lentiviral constructs for ERAP1 knockdown were obtained from the Mission shRNA library (clones TRCN060539, TRCN060540, TRCN060541, and TRCN060542; Sigma-Aldrich). Based on preliminary assays to assess knockdown efficiency (data not shown), we selected the TRCN060542 clone for further use. The shERAP1-encoding lentivirus was produced as described above.

RT-PCR/Quantitative PCR

Total RNA was extracted from cultured cells using TRIzol reagent following the manufacturer’s instructions. Isolated RNA was quantified using a Nanodrop 1000 spectrophotometer. Approximately 500 ng RNA was reverse transcribed using the Superscript RT II kit (Invitrogen). Expression of the genes interest was detected using the following primers: insulin forward: GCA GCC TTT GTG AAC CAA CA, insulin reverse: CGG GTC TTG GGT GTG TAG AAG; ERAP1 forward: GAA AAC CAT GAT GAA CAC TTG G, ERAP1 reverse: CCA CCT CTT CTG GGA GGA TGA G; GAPDH forward: ACA GTC AGC CGC ATC TTC TT, GAPDH reverse: AAT GAA GGG GTC ATT GAT GG; XBP1s forward: 5′-CTG AGT CCG CAG CAG GTG-3′, XBP1s reverse: 5′-GAG ATG TTC TGG AGG GGT GA-3′; and ERAP2 forward: GGG GCT TTC CCA GTA GCC ACT AAT GG, ERAP2 reverse: GAA TCT TCC TCT GAC TGA AGG GTG GC. PCRs were performed on a PTC-200 (Biozym, Landgraaf, the Netherlands) using the following conditions: 94°C for 5 min; 35 cycles of 30 s at 94°C, 30 s at 60°C, and 1.5 min at 72°C; 10 min at 72°C. Real-time PCRs were performed in triplicate using the SybrGreen master mix kit (Applied Biosystems, Nieuwerkerk a/d IJssel, the Netherlands) and an Applied Biosystems Step One Plus. Comparative ΔΔ cycle threshold values were performed using the GAPDH gene as reference. Values are represented as mean ± SE.

TaqMan Assay

For miRNA quantification, total RNA was reverse transcribed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) and detected using hsa-miR-17 TaqMan miRNA assays (PN4427975; Applied Biosystems) and TaqMan 2× Universal PCR Master Mix, no uracil N-glycosylase (Applied Biosystems) according to the manufacturer’s instructions. miRNA expression was normalized to RNU6 using the following primers: RNU6 forward: 5′-CTC GCT TCG GCA GCA CA-3′; and RNU6 reverse: 5′-AAC GCT TCA CGA ATT TGC GT-3′.

Western Blot Analyses

Cells were lysed in buffer containing 50 mmol/L Tris-HCl (pH 7.4), 250 mmol/L NaCl, 0.1% Triton X-100, and 5 mmol/L EDTA. The lysis buffer was supplemented with protease inhibitor cocktail (Roche). Protein quantification was performed with the BioRad protein assay reagent. For ERAP1 analyses, 50 μg proteins extracts were loaded on 12% acrylamide/bis acrylamide SDS page gel. After electrophoresis, protein transfer was performed on a nitrocellulose membrane (GE Healthcare). Membranes were stained with anti-ERAP1 overnight at 4°C (B10; Sc-271823; Santa Cruz), and goat anti-mouse IgG horseradish peroxidase (sc-2005; Santa Cruz Biotechnology) was used for the detection. The loading control was β-actin (MAB1501; EMD Millipore).

Flow Cytometry

For intracellular insulin staining, cells were fixed at 4°C with 2% paraformaldehyde PBS for 20 min, followed by 10-min incubation at 4°C with permeabilization buffer (0.5% saponin, 2% BSA, PBS). Rabbit anti-insulin (sc-9168; Santa Cruz Biotechnology) and anti–rabbit-phycoerythrin (1:500 dilution) (#111,116,144; Jackson ImmunoResearch) were used. All antibody incubations were performed in the permeabilization buffer for 30 min at 4°C. For surface staining, cells were incubated on at 4°C for 30 min with monoclonal mouse anti-human HLA-ABC Antigen/RPE Clone W6/32 (R7000; DAKO) or with mouse anti-human CD8 allophycocyanin (555369; BD Pharmigen) in the flow cytometry buffer (0.5% human albumin, 0.01% Na azide, PBS). Analysis was performed using BD LSR II (BD Biosciences) and Flowjo software. A total of 10,000 events were recorded.

Islet Donors

Pancreatic islets were obtained from human organ donor pancreata. Human islets were isolated from organ donors. Islets were only studied if they could not be used for clinical purposes and if research consent had been obtained. According to the national law, ethics approval is not required for research on donor tissues that cannot be used for clinical transplantation. The isolations were performed in the Good Manufacturing Practices-facility of Leiden University Medical Center according to the previously described protocol (27). For experimental use, human islets were maintained in ultra-low attachment plates (Corning, Corning, NY) in low-glucose DMEM supplemented with 10% FBS, 100 units/mL penicillin, and 100 μg/mL streptomycin. Dispersed islet cells were treated with 1,000 units/mL IFN-γ and 2 ng/mL IL-1β for 24 h to induce ER stress. All methods were performed in accordance with relevant guidelines and regulations.

T-Cell Activation Assays

Islet preparations were washed with PBS and dispersed by trypsinization in an ultra-low attachment 6-well plate. The day after, cells were counted and seeded in a 96-well plate at a concentration of 50,000 (for donor R153 and 615) or 200,000 (for donor R155) islet cells per well. Treatment with proinflammatory cytokines and MKC3946 was performed as described for 24 h. On the 3rd day, HLA-A2-PPI15–24–specific CTLs were added at a ratio 5E:1T (for donor R153 and 615) or 1E:2T (for donor R155) in the presence of mouse anti-human CD107a- FITC (11-1079-42; Thermo Fisher Scientific) was added. Cocultures were incubated at 37°C for 2 h. Cells were washed with flow cytometry buffer (0.5% human albumin, 0.01% Na azide, PBS), stained for CD8, and analyzed by flow cytometry, as mentioned above. The absolute degranulation (D) capacity of T cells was calculated as a ratio of (percentage of CD107a+ cells/percentage of total CD8+ cells) (data not shown). The relative degranulation was estimated by calculating the percentage of change of the absolute degranulation of the treated samples compared with their respective controls. More specifically for the cytokine (CYT)-treated sample: ([]/) ∗ 100. For the cytokine plus MKC3946 sample: ([]/) ∗ 100.

The supernatant was used for detection on MIP-1β production by the T cells, using the MIP-1β ELISA kit (BMS2030INST; Thermo Fisher Scientific), according to the manufacturer’s protocol.

In Silico Analyses and Statistical Analysis

miRNA interaction with ERAP1 mRNA has been evaluated by crossing information available at miRbase v21.0 (https://www.mirbase.org/) and Tarbase v8 (https://carolina.imis.athena-innovation.gr/diana_tools/web/index.php?r=tarbasev8/index) using β-cell–specific miRNAs databases, as previously published (28,29). A Venn diagram was generated using an online Venn diagram plotter (https://omics.pnl.gov/software/venn-diagram-plotter). Data are presented as mean ± SEM. Calculations were performed using GraphPad Prism 7 software. Unpaired t tests were performed for all comparisons, except from the experiments of T-cell activation upon coculture with dispersed islets (Fig. 4E and F), where a paired t test between samples of the same islet donor was performed. P values of ≤0.05 were considered statistically significant.

Data Resource and Availability

The data sets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.

ERAP1 Is Required for PPI SP Antigen Processing

The localization of insulin SP within the ER and the TAP (Transporter associated with antigen processing) independent routing of the PPI15–24 have suggested proteasome-independent degradation mechanisms (17). The presence of three alanine residues at the C-terminal part of the insulin SP represents a high-affinity binding motif for the hydrophobic pocket of ERAP1, and the two leucine residues in position 13–14 make this region a suitable substrate for ERAP1 trimming (Fig. 1A) (20,30). To test for the implication of ERAP1 on PPI SP processing and to evaluate the consequences for antigenic peptide recognition by CTLs, surrogate β-cells were generated by genetically modifying HEK 293T cells with a lentiviral vector containing the full-length PPI cDNA, driven by a CMV early enhancer and promoter. After verification of the increased insulin gene expression in these cells (Fig. 1B), we used an ERAP1-directed shRNA containing lentivirus to specifically downregulate ERAP1 gene expression. Transduction of ERAP1 shRNA (multiplicity of infection = 1) led to a 90% reduction in the ERAP1 mRNA level compared with nontarget control shRNA (Fig. 1C). Interestingly, ERAP1 downregulation in these experiments increased significantly ERAP2 gene expression (Fig. 1D) but had no impact on (pro)insulin expression or HLA class I surface expression (Fig. 1E and F). Yet, coculture of modified cells with PPI15–24–specific, HLA-A0201-restricted CTLs showed a reduced T-cell activation as measured by T-cell degranulation (exposure of CD107a at the cell surface) (Fig. 1E) and a reduced MIP-1β secretion (Fig. 1F). These data support the role of ERAP1 in the processing of the PPI15–24 epitope from human PPI (14).

Figure 1

ERAP1 downregulation in surrogate β-cells reduces specific CTL activation. A: Amino acid sequence of the PPI SP. The PPI SP epitope sequence PPI15–24 is presented between the arrows. The target sequence for the ERAP1 hydrophobic region is underlined. The N--term part of the proinsulin molecule is depicted as broken gray box. B: Insulin gene expression level in HEK 293T cells (open circles) and HEK 293T cells transduced with LV-CMV-PPI-bcGFP (filled circles) by qPCR (multiplicity of infection = 1) (n = 3). C and D: ERAP1 and ERAP2 gene expression evaluated by qPCR in HEK 293T-PPI cells 4 days posttransduction with nontargeted shRNA lentiviruses (shNS) or ERAP1-specific shRNA (shERAP1). Gene expression levels are corrected for GAPDH used as the housekeeping gene and presented as the induction ratio (control set to 1) (n = 3). E: Insulin protein expression in shERAP1- and shNS-modified cells assessed by flow cytometry. HEK 293T were used as a negative control (n = 3). F: HLA class I surface expression of shNS- and shERAP1-modified cells presented as mean fluorescence phycoerythrin (PE) intensity (MFI) (n = 6). G: CD107a surface expression on CD8+ cells after coculture with the modified HEK 293T cells. Data are presented as the percentage decrease to control set at 100% (n = 3). H: MIP-1β secretion of PPI15–24–specific CTLs after a 2-h coculture with 293T-PPI-shNS or shERAP1 (n = 3). *P ≤ 0.05; ****P ≤ 0.0001.

Figure 1

ERAP1 downregulation in surrogate β-cells reduces specific CTL activation. A: Amino acid sequence of the PPI SP. The PPI SP epitope sequence PPI15–24 is presented between the arrows. The target sequence for the ERAP1 hydrophobic region is underlined. The N--term part of the proinsulin molecule is depicted as broken gray box. B: Insulin gene expression level in HEK 293T cells (open circles) and HEK 293T cells transduced with LV-CMV-PPI-bcGFP (filled circles) by qPCR (multiplicity of infection = 1) (n = 3). C and D: ERAP1 and ERAP2 gene expression evaluated by qPCR in HEK 293T-PPI cells 4 days posttransduction with nontargeted shRNA lentiviruses (shNS) or ERAP1-specific shRNA (shERAP1). Gene expression levels are corrected for GAPDH used as the housekeeping gene and presented as the induction ratio (control set to 1) (n = 3). E: Insulin protein expression in shERAP1- and shNS-modified cells assessed by flow cytometry. HEK 293T were used as a negative control (n = 3). F: HLA class I surface expression of shNS- and shERAP1-modified cells presented as mean fluorescence phycoerythrin (PE) intensity (MFI) (n = 6). G: CD107a surface expression on CD8+ cells after coculture with the modified HEK 293T cells. Data are presented as the percentage decrease to control set at 100% (n = 3). H: MIP-1β secretion of PPI15–24–specific CTLs after a 2-h coculture with 293T-PPI-shNS or shERAP1 (n = 3). *P ≤ 0.05; ****P ≤ 0.0001.

ERAP1 Is Upregulated by Inflammation and ER Stress

In the course of diabetes development, proinflammatory cytokines secreted by infiltrating immune cells are believed to promote autoimmunity by inducing ER stress in β-cells (7,3133). To evaluate the impact of the T1D pathophysiological condition on ERAP1 gene expression, EndoC-βH1 cells were exposed to a mixture of proinflammatory cytokines (i.e., IFN-γ and Il-1β) or to a sarcoplasmic reticulum Ca2+-ATPase pump blocker (i.e., thapsigargin) as an ER stress inducer. Although the stress response of EndoCBH1 and primary human β-cells differs (34), cytokine treatment and thapsigargin stimulation led to increased expression of marker from the unfolded protein response in EndoCBH1 (Supplementary Figs. 1 and 2). In these conditions, the increased stress status, as measured by XBP1 splicing (Fig. 2A), correlated with an upregulation of ERAP1 expression both at the gene and protein level (Fig. 2B and C). To characterize the underlying regulatory mechanisms, we generated a luciferase reporter construct to assess the transcriptional regulation of the ERAP1 gene by introducing the ERAP1 promoter region (−1,325/+60) (35) upstream of a luciferase encoding sequence (Fig. 2D). After transfection of the reporter construct in EndoC-βH1 and stress treatment induction, a threefold increase in light emission after IFN-γ/IL-1β treatment was observed, which confirms the transcriptional regulation by IFN-γ (36). However, the absence of transcriptional activation of the ERAP1 promoter after thapsigargin treatment in our assay suggested additional regulatory mechanisms controlling ERAP1 gene expression during ER stress.

Figure 2

Transcriptional and posttranscriptional regulation of ERAP1. XBP1 spliced isoform (XBPs) expression (A) and ERAP1 gene expression (B) in EndoC-βH1 cells after 24 h of treatment with proinflammatory cytokines (IFN-γ, IL-1β) (light gray filled circles) or thapsigargin (black filled circles), as determined by qPCR. Gene expression levels are corrected for GAPDH used as the housekeeping gene and presented as the induction ratio (nontreated controls set to 1). C: ERAP1 protein expression level determined by Western blot analysis of EndoC-βH1 cells treated with proinflammatory cytokines (IFN-γ, IL-1β) or thapsigargin (n = 4). Actin was used as internal control for quantification (unprocessed image and quantification n = 3 are presented in Supplementary Fig. 4). D: Luciferase activity measured in EndoC-βH1 cells transfected with the ERAP1 promoter reporter construct after treatment with cytokines or thapsigargin for 24 h (n = 8). Luciferase was measured in relative light units (RLU) and presented as the relative induction ratio (luciferase activity in the absence of treatment was arbitrarily set to 1). E: Venn diagram showing the overlap between miRNAs found in β-cells and predicted ERAP1 targeting miRNAs according to miRbase v21.0 and TarBase v8 (upper panel). Schematic representation of the miR-17 targeting sequence in the 3′-UTR of ERAP1 mRNA (wt 3′-UTR) and the mutated ERAP1 UTR (mut 3′-UTR, mutations shown in red) in the luciferase reporter constructs with the predicted folding energy (lower panel). F: Relative luciferase activity after cotransfection of miR-ns (negative control) or miR-17 with ERAP1 wt UTR luciferase construct or ERAP1 mut UTR in HEK 293T cells (n = 3). Data are presented as the induction ratio (control miR-ns set to 1). ERAP1 (G) and insulin (H) gene expression in EndoC-βH1 cells transfected with miR-ns, miR-17, and anti–miR-17, analyzed by qPCR, at 24 h posttransfection (n = 3). I: Relative expression of miR-17 in EndoC-βH1 cells after IFN-γ and IL-1β stimulation compared with nontreated cells (n = 3). Relative expression of ERAP1 (J) and insulin (K) in EndoC-βH1 cells after miR-17 or control miR-ns transfection in the presence or absence of cytokine stimulation (n = 5). Gene expression levels are corrected for GAPDH used as the housekeeping gene. miRNA expression is corrected for RNU6 expression used as control. All data are presented as induction ratio (controls set to 1). **P ≤ 0.01; ***P ≤ 0.001; ****P ≤ 0.0001.

Figure 2

Transcriptional and posttranscriptional regulation of ERAP1. XBP1 spliced isoform (XBPs) expression (A) and ERAP1 gene expression (B) in EndoC-βH1 cells after 24 h of treatment with proinflammatory cytokines (IFN-γ, IL-1β) (light gray filled circles) or thapsigargin (black filled circles), as determined by qPCR. Gene expression levels are corrected for GAPDH used as the housekeeping gene and presented as the induction ratio (nontreated controls set to 1). C: ERAP1 protein expression level determined by Western blot analysis of EndoC-βH1 cells treated with proinflammatory cytokines (IFN-γ, IL-1β) or thapsigargin (n = 4). Actin was used as internal control for quantification (unprocessed image and quantification n = 3 are presented in Supplementary Fig. 4). D: Luciferase activity measured in EndoC-βH1 cells transfected with the ERAP1 promoter reporter construct after treatment with cytokines or thapsigargin for 24 h (n = 8). Luciferase was measured in relative light units (RLU) and presented as the relative induction ratio (luciferase activity in the absence of treatment was arbitrarily set to 1). E: Venn diagram showing the overlap between miRNAs found in β-cells and predicted ERAP1 targeting miRNAs according to miRbase v21.0 and TarBase v8 (upper panel). Schematic representation of the miR-17 targeting sequence in the 3′-UTR of ERAP1 mRNA (wt 3′-UTR) and the mutated ERAP1 UTR (mut 3′-UTR, mutations shown in red) in the luciferase reporter constructs with the predicted folding energy (lower panel). F: Relative luciferase activity after cotransfection of miR-ns (negative control) or miR-17 with ERAP1 wt UTR luciferase construct or ERAP1 mut UTR in HEK 293T cells (n = 3). Data are presented as the induction ratio (control miR-ns set to 1). ERAP1 (G) and insulin (H) gene expression in EndoC-βH1 cells transfected with miR-ns, miR-17, and anti–miR-17, analyzed by qPCR, at 24 h posttransfection (n = 3). I: Relative expression of miR-17 in EndoC-βH1 cells after IFN-γ and IL-1β stimulation compared with nontreated cells (n = 3). Relative expression of ERAP1 (J) and insulin (K) in EndoC-βH1 cells after miR-17 or control miR-ns transfection in the presence or absence of cytokine stimulation (n = 5). Gene expression levels are corrected for GAPDH used as the housekeeping gene. miRNA expression is corrected for RNU6 expression used as control. All data are presented as induction ratio (controls set to 1). **P ≤ 0.01; ***P ≤ 0.001; ****P ≤ 0.0001.

miR17-5p Acts as a Posttranscriptional Regulator of ERAP1 Expression

To evaluate a possible posttranscriptional control of ERAP1 mRNA by miRNAs, we searched for potential miRNA binding sites within the ERAP1 3′-UTR region. Using β-cell–specific miRNA data sets (37) and two different algorithms for prediction of miRNA binding sites (miRbase and TarBase [28,38]) (Supplementary Table 1), six putative miRNAs were identified that could be expressed by β-cells and destabilize ERAP1 mRNA expression (Table 1 and Fig. 2E). Notably, these miRNAs belong to the miR-17 family, implying a conserved mechanism of regulation. To confirm these in silico findings, luciferase reporter constructs were generated harboring a 54-nucleotide-long fragment of the ERAP1–3′-UTR carrying the predicted miR-17 binding site as well as a mutant construct containing 2 nucleotides substitution preventing the formation of the miRNA-induced silencing complex. Transient transfection of miR-17 in HEK293T luciferase reporter cells reduced luciferase activity from the native UTR reporter construct but had no effect on the luciferase mutant construct (Fig. 2F). To validate that miR-17 expression negatively affects ERAP1 mRNA in β-cells, we forced expression of miR-17 in EndoC-βH1 and determined ERAP1 gene expression by quantitative (q)PCR. Transient transfection of miR-17 resulted in a 30% reduction of ERAP1 gene expression, while cotransfection of the complementary anti-miRNA (anti–miR-17) reversed the inhibitory effect of miR-17 on ERAP1 gene expression (Fig. 2G). Of note, insulin gene expression in these assays remained stable (Fig. 2H). Altogether, these results reveal that miR-17 contributes to ERAP1 regulation by direct interaction with the ERAP1 3′-UTR region. To connect inflammation-induced ER stress and miRNA regulation, EndoC-βH1 cells were treated with cytokines, and miR-17 expression was determined by TaqMan assay. Consistently with previous reports (39), we observed a >20% decrease in miR-17 expression after 24-h treatment, indicating that these cytokines may modulate ERAP1 expression by affecting the miR-17 level (Fig. 2I). These results have been confirmed after chemically induced stress by thapsigargin (Supplementary Fig. 2B). In line with these results, transfection of miR-17 in EndoC-βH1 blunted proinflammatory cytokine induction of ERAP1 (Fig. 2J) without affecting insulin gene expression (Fig. 2K).

Table 1

Putative miRNA regulating ERAP1

miRNAERAP1-target motifFolding energy (kcal/mol)
hsa-miR-20b-5p CAAAGUGCUCAUAGUGCAGGUAG −16.20 
hsa-miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG −16.20 
hsa-miR-106a-5p AAAAGUGCUUACAGUGCAGGUAG −16.00 
hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAG −16.00 
hsa-miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG −14.30 
hsa-miR-106b-5p UAAAGUGCUGACAGUGCAGAU −15.50 
miRNAERAP1-target motifFolding energy (kcal/mol)
hsa-miR-20b-5p CAAAGUGCUCAUAGUGCAGGUAG −16.20 
hsa-miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG −16.20 
hsa-miR-106a-5p AAAAGUGCUUACAGUGCAGGUAG −16.00 
hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAG −16.00 
hsa-miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG −14.30 
hsa-miR-106b-5p UAAAGUGCUGACAGUGCAGAU −15.50 

ERAP1-miRNA motif and the energy-folding characteristic of the miR-17 family on the ERAP1 UTR region. Data presented are according to in silico predictions performed on https://cm.jefferson.edu/rna22/Interactive/.

IRE1α Inhibition Partially Restores ERAP1 Homeostatic Expression

Previous studies have identified miR-17 as an important link between the endoribonuclease IRE1α and the induction of β-cell death via activation of the thioredoxin-interacting protein (TXNIP) (39). To determine whether the ERAP1 posttranscriptional regulation in stress conditions was mediated by IRE1α, EndoC-βH1 β-cells were treated with cytokines and XBPs, and miR-17 and ERAP1 gene expressions were monitored for 24 h in a time-course experiment (Supplementary Fig. 2A). As anticipated, IFN-γ/IL-1β stimulation led to decreased expression of miR-17 and increased expression of both XBPs and ERAP1. Interestingly, specific inhibition of IRE1α, by MKC3946 treatment (40) increased expression of miR-17 both at 6 h and 24 h in the homeostatic condition and prevented its degradation in cytokine conditions (Fig. 3A–C). Under these conditions, cytokines-induced ERAP1 gene expression was partially reduced by MKC3946 cotreatment at 6 h (Fig. 3B). This observation was more pronounced after 24 h of treatment, where inhibition of the cytokine-induced ERAP1 gene expression reached 40% (Fig. 3D) without any effect on cells viability (Supplementary Fig. 3A). IRE1α inhibitor dose-response experiments performed in EndoC-βH1 illustrated the direct correlation between IRE1α activity (as assessed by spliced XBP1 expression) and ERAP1 gene expression (Fig. 3E and F). Chemically induced stress led to similar changes in gene expression (Supplementary Fig. 2B); also in these conditions, the effect of thapsigargin on ERAP1 expression was inhibited by MKC3946 cotreatment (Supplementary Fig. 2C). More importantly, similar experiments performed in freshly isolated human islets confirmed that the increased ERAP1 expression mediated by cytokines or thapsigargin could be counteracted by MKC3946 treatment (Fig. 4A and B).

Figure 3

miR-17 and ERAP1 regulation by IRE1α inhibition. miR-17 expression (A) and ERAP1 gene expression (B) in EndoC-βH1 cells after 6-h treatment with IFN-γ and IL-1β, in the presence or absence of the IRE1α inhibitor MKC3946 (10 μmol/L), as determined by qPCR. miR-17 expression (C) and ERAP1 gene expression (D) after 24 h of treatment (n = 3). XBP1 spliced isoform (XBPs) expression (E) and ERAP1 gene expression (F) in EndoC-βH1 cells after 24 h of cytokines treatment in the presence of increasing amounts of MKC3946 (10, 20, and 50 μmol/L). Gene expression levels are corrected for GAPDH used as the housekeeping gene (n = 3). Data are presented as the induction ratio compared with expression level in nontreated cells used as control. *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001; ****P ≤ 0.0001.

Figure 3

miR-17 and ERAP1 regulation by IRE1α inhibition. miR-17 expression (A) and ERAP1 gene expression (B) in EndoC-βH1 cells after 6-h treatment with IFN-γ and IL-1β, in the presence or absence of the IRE1α inhibitor MKC3946 (10 μmol/L), as determined by qPCR. miR-17 expression (C) and ERAP1 gene expression (D) after 24 h of treatment (n = 3). XBP1 spliced isoform (XBPs) expression (E) and ERAP1 gene expression (F) in EndoC-βH1 cells after 24 h of cytokines treatment in the presence of increasing amounts of MKC3946 (10, 20, and 50 μmol/L). Gene expression levels are corrected for GAPDH used as the housekeeping gene (n = 3). Data are presented as the induction ratio compared with expression level in nontreated cells used as control. *P ≤ 0.05; **P ≤ 0.01; ***P ≤ 0.001; ****P ≤ 0.0001.

Figure 4

IRE1α regulates ERAP1 expression and PPI15–24 presentation in human islets. XBP1 spliced isoform (XBPs) expression (A) and ERAP1 gene expression (B), measured by qPCR, in intact human islets after 24 h of treatment with cytokines (light gray filled circles) or thapsigargin (black gray filled circles), in the presence or absence of MKC3946 (10 μmol/L). Gene expression levels are corrected for GAPDH used as the housekeeping gene. All data are presented as the induction ratio (controls set to 1). C: Flowchart of the islet cells/PPI15–24–specific CTLs coculture experiment (n = 3). D: HLA class I expression in dispersed islets, upon 24 h of cytokines treatment, in the presence or absence of MKC3946. CD107a surface expression (E) and MIP1β secretion (F) of PPI15–24–specific CTLs after a 2-h coculture with HLA-A2+ dispersed islets. Data were collected from replicates of three different donors (color coded). G: Schematic representation of the working model for posttranscriptional ERAP1 regulation and PPI15–24 processing via IRE1α-regulated miR-17.

Figure 4

IRE1α regulates ERAP1 expression and PPI15–24 presentation in human islets. XBP1 spliced isoform (XBPs) expression (A) and ERAP1 gene expression (B), measured by qPCR, in intact human islets after 24 h of treatment with cytokines (light gray filled circles) or thapsigargin (black gray filled circles), in the presence or absence of MKC3946 (10 μmol/L). Gene expression levels are corrected for GAPDH used as the housekeeping gene. All data are presented as the induction ratio (controls set to 1). C: Flowchart of the islet cells/PPI15–24–specific CTLs coculture experiment (n = 3). D: HLA class I expression in dispersed islets, upon 24 h of cytokines treatment, in the presence or absence of MKC3946. CD107a surface expression (E) and MIP1β secretion (F) of PPI15–24–specific CTLs after a 2-h coculture with HLA-A2+ dispersed islets. Data were collected from replicates of three different donors (color coded). G: Schematic representation of the working model for posttranscriptional ERAP1 regulation and PPI15–24 processing via IRE1α-regulated miR-17.

IRE1α Inhibition Limits PPI SP Epitope Presentation to Autoreactive Specific CTLs

To determine the consequences of our findings on the insulin SP trimming, presentation, and subsequent CTLs activation, we examined whether IRE1α inhibition affects immune recognition of the PPI15–24 SP–derived epitope presented by primary human β-cells. After dispersion, isolated human islet cells (HLA-A2) were maintained for 24 h in the presence or absence of IFN-γ/IL-1β and treated with MKC3946. After treatment, islet cells were cocultured with the PPI15–24–specific, HLA-A0201–restricted CTL clone for 2 h before the analyses (Fig. 4C). We verified that MKC3946 had no deleterious effect on T-cell function, no direct effect on CD107a surface expression (Supplementary Fig. 3B–D), and no effect on HLA class I surface expression on islet cells (Fig. 4D), and determined T-cell activation in the different conditions by measuring T-cell degranulation and MIP-1β secretion. We demonstrated in islet preparations from three different pancreas donors that CD107a surface expression in CD8+ cells was significantly increased after coculture with islet cells treated with cytokines, illustrating an increased surface density of the specific peptide HLA ligand at the β-cell surface. Furthermore, we showed that MKC3946 cotreatment abrogates the deleterious effect of cytokines on T-cell degranulation (Fig. 4E). Quantification of the MIP-1β production in the cell supernatant confirmed the effect of the IRE1α inhibition on PPI15–24 peptide processing (Fig. 4F), supporting the notion that ER stress is involved in shaping CTL responses in T1D.

We demonstrate that ERAP1 is critical for the generation of a prevalent PPI-derived autoantigenic peptide and present a new regulatory mechanism connecting ER stress and increased β-cell visibility to the immune system.

The upregulated ERAP1 expression observed both in isolated human islets and in a human β-cell line after cytokine stimulation or chemically induced stress extends proof for the implication of ERAP1 in PPI SP processing/presentation (19) and its participation in β-cell destruction during inflammation in patients with T1D. Several leucine amino peptidases induced by INF-γ have been shown to participate in peptide trimming (41); however, few have been shown to be located specifically within the ER, where processing of the insulin SP is likely to occur. Without excluding the participation of other ER resident endopeptidases to the process, the reduced T-cell activation and degranulation of PPI15–24 CTL observed after coculture with ERAP1 knockdown surrogate β-cells or human islet cells treated with the IRE1α inhibitor is in line with a previous study targeting ERAP1 expression by specific siRNA (19). Yet, whether the observed reduction in T-cell activation is sufficient for protecting β-cells from CTL-mediated attack remains to be established. As in a previous study (42), the reduced expression of ERAP1 led to increased expression of ERAP2 in our assays. On the view of the complementarity role of these two aminopeptidases (43), this compensatory effect may explain the absence of effect of the ERAP1 knockdown on HLA class I surface expression. Similar experiments performed in human and mouse cells have shown a maximal 10% reduction after ERAP1 downregulation by siRNA (44,45). Although the effect of the ER stress inhibitor on adhesion and costimulatory molecules has not been studied in depth, the lack of effect of MKC3946 on HLA-A/-B/-C expression in human islet cells suggests that the differential T-cell activation observed is a direct consequence of the relative density of PPI15–24/HLA complexes at the cell surface.

ERAP1 has been initially described as an IFN-γ–responsive gene (46). Although we cannot exclude the presence of an ER stress responsive element in an enhancer region more upstream to the promoter core region chosen in our transcriptional-based assays, our results are pointing to two distinct regulatory mechanisms during inflammation: a transcriptional regulation mediated by IFN-γ–responsive elements (i.e., IRF1 binding sites) within the ERAP1 promoter proximal region and an ER stress-dependent posttranscriptional regulation. In fact, our data using the sarcoplasmic reticulum Ca2+-ATPase pump blocker thapsigargin show additional regulatory mechanisms of ERAP1, initiated by the ER stress sensor IRE1α and involving a posttranscriptional control of ERAP1 mRNA. The results obtained in human islet cells exposed to IRE1α inhibitor, where MKC3946 treatment completely abolishes the chemically induced ER stress–mediated ERAP1 expression but only partially impacts (∼50%) cytokine-induced expression, perfectly illustrate this dual regulation.

Several miRNAs have been implicated in the response to stress (47); among these, miR-17 has been shown to be a master regulator of β-cell apoptosis by controlling the thioredoxin-interacting protein for type 1 and type 2 diabetes (39,48). Interestingly, TXNIP regulation was demonstrated to be dependent of both PERK and IRE1α sensors (49). The incomplete downregulation of ERAP1 in our experiments after treatment with MKC3946 inhibitor may also imply that, as for TXNIP, multiple arms of the unfolded protein response could be involved in ERAP1 regulation.

In this study, we confirmed the complexity of antigenic peptide generation originating from the SP domain of the human PPI. The implication of the IRE1α/miR-17 pathway in regulating the resident ER protein trimming underscores the key role played by ER stress in the development of autoimmunity. We propose that inflammatory cytokines released by infiltrating autoreactive immune cells during insulitis increase β-cell visibility to the immune system by increasing peptide processing and presentation (increase HLA). The increased density of the PPI15–24 peptide-HLA complex at the β-cell surface would be the consequence of a combined direct transcriptional activation mediated by binding of IFN regulatory factors to the ERAP1 promoter and posttranscriptional control of the ERAP1 mRNA mediated by the IRE1a/miR-17 axis (Fig. 4G). Supported by recent work performed in NOD mice highlighting the potential of IRE1a kinase inhibitors in maintaining β-cell integrity and preserving β-cell function (50), our study designates IRE1α as a relevant therapeutic target to reduce β-cell visibility to the immune system and to prevent T cell–mediated destruction in human diabetes pathogenesis.

S.T. and M.J.L.K. contributed equally to this work.

Acknowledgments. The authors thank Steve Cramer and Martijn Rabelink, Cell and Chemical Biology, Leiden University Medical Center, for technical help.

Funding. This work is supported by JDRF, Stichting Diabetes Onderzoek Nederland (DON), and the Diabetes Fonds (Dutch Diabetes Research Foundation) and by the Innovative Medicines Initiative 2 Joint Undertaking (IMI2-JU) under grant agreement No. 115797 (INNODIA). This Joint Undertaking receives support from the European Union’s Horizon 2020 Research and Innovation program and the European Federation of Pharmaceutical Industries and Associations, JDRF, and The Leona M. and Harry B. Helmsley Charitable Trust. B.O.R. is supported by the Wanek Family Project for Type 1 Diabetes.

Duality of Interest. No potential conflicts of interest relevant to this article were reported.

Author Contributions. S.T. and M.J.L.K. performed the experiments and wrote the manuscript. A.v.d.S. and S.L. performed the experiments. E.J.d.K and F.C. provided the human islets and wrote manuscript. R.C.H. wrote the manuscript. B.O.R. and A.Z. supervised the project, designed the experiments, and wrote the manuscript. A.Z. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

1.
Bottazzo
GF
,
al-Sakkaf
L
,
Dean
BM
,
Schwarz
G
,
Pujol-Borrell
R
.
Hypotheses on the etiology of insulin-dependent diabetes: published and recent ideas
.
Journ Annu Diabetol Hotel Dieu
1985
:
135
147
[in French]
2.
In’t Veld
P
,
Lievens
D
,
De Grijse
J
, et al
.
Screening for insulitis in adult autoantibody-positive organ donors
.
Diabetes
2007
;
56
:
2400
2404
3.
Campbell-Thompson
M
,
Wasserfall
C
,
Kaddis
J
, et al
.
Network for Pancreatic Organ Donors with Diabetes (nPOD): developing a tissue biobank for type 1 diabetes
.
Diabetes Metab Res Rev
2012
;
28
:
608
617
4.
Campbell-Thompson
M
.
Organ donor specimens: what can they tell us about type 1 diabetes
?
Pediatr Diabetes
2015
;
16
:
320
330
5.
Marhfour
I
,
Lopez
XM
,
Lefkaditis
D
, et al
.
Expression of endoplasmic reticulum stress markers in the islets of patients with type 1 diabetes
.
Diabetologia
2012
;
55
:
2417
2420
6.
Richardson
SJ
,
Willcox
A
,
Bone
AJ
,
Morgan
NG
,
Foulis
AK
.
Immunopathology of the human pancreas in type-I diabetes
.
Semin Immunopathol
2011
;
33
:
9
21
7.
Marré
ML
,
Piganelli
JD
.
Environmental factors contribute to β cell endoplasmic reticulum stress and neo-antigen formation in type 1 diabetes
.
Front Endocrinol (Lausanne)
2017
;
8
:
262
8.
Kracht
MJ
,
van Lummel
M
,
Nikolic
T
, et al
.
Autoimmunity against a defective ribosomal insulin gene product in type 1 diabetes
.
Nat Med
2017
;
23
:
501
507
9.
Kracht
MJL
,
Zaldumbide
A
,
Roep
BO
.
Neoantigens and microenvironment in type 1 diabetes: lessons from antitumor immunity
.
Trends Endocrinol Metab
2016
;
27
:
353
362
10.
Kent
SC
,
Chen
Y
,
Bregoli
L
, et al
.
Expanded T cells from pancreatic lymph nodes of type 1 diabetic subjects recognize an insulin epitope
.
Nature
2005
;
435
:
224
228
11.
Nakayama
M
,
Abiru
N
,
Moriyama
H
, et al
.
Prime role for an insulin epitope in the development of type 1 diabetes in NOD mice
.
Nature
2005
;
435
:
220
223
12.
Zhang
L
,
Nakayama
M
,
Eisenbarth
GS
.
Insulin as an autoantigen in NOD/human diabetes
.
Curr Opin Immunol
2008
;
20
:
111
118
13.
Liu
M
,
Wright
J
,
Guo
H
,
Xiong
Y
,
Arvan
P
.
Proinsulin entry and transit through the endoplasmic reticulum in pancreatic beta cells
.
Vitam Horm
2014
;
95
:
35
62
14.
Chang
SG
,
Choi
KD
,
Jang
SH
,
Shin
HC
.
Role of disulfide bonds in the structure and activity of human insulin
.
Mol Cells
2003
;
16
:
323
330
15.
Huang
XF
,
Arvan
P
.
Intracellular transport of proinsulin in pancreatic beta-cells. Structural maturation probed by disulfide accessibility
.
J Biol Chem
1995
;
270
:
20417
20423
16.
Abreu
JR
,
Martina
S
,
Verrijn Stuart
AA
, et al
.
CD8 T cell autoreactivity to preproinsulin epitopes with very low human leucocyte antigen class I binding affinity
.
Clin Exp Immunol
2012
;
170
:
57
65
17.
Skowera
A
,
Ellis
RJ
,
Varela-Calviño
R
, et al
.
CTLs are targeted to kill beta cells in patients with type 1 diabetes through recognition of a glucose-regulated preproinsulin epitope
[published correction appears in J Clin Invest 2009;119:2844]
.
J Clin Invest
2008
;
118
:
3390
3402
18.
Velthuis
JH
,
Unger
WW
,
Abreu
JR
, et al
.
Simultaneous detection of circulating autoreactive CD8+ T-cells specific for different islet cell-associated epitopes using combinatorial MHC multimers
.
Diabetes
2010
;
59
:
1721
1730
19.
Kronenberg-Versteeg
D
,
Eichmann
M
,
Russell
MA
, et al
.
Molecular pathways for immune recognition of preproinsulin signal peptide in type 1 diabetes
.
Diabetes
2018
;
67
:
687
696
20.
Chang
SC
,
Momburg
F
,
Bhutani
N
,
Goldberg
AL
.
The ER aminopeptidase, ERAP1, trims precursors to lengths of MHC class I peptides by a “molecular ruler” mechanism
.
Proc Natl Acad Sci U S A
2005
;
102
:
17107
17112
21.
Evnouchidou
I
,
Momburg
F
,
Papakyriakou
A
, et al
.
The internal sequence of the peptide-substrate determines its N-terminus trimming by ERAP1
.
PLoS One
2008
;
3
:
e3658
22.
Hoyng
SA
,
Gnavi
S
,
de Winter
F
, et al
.
Developing a potentially immunologically inert tetracycline-regulatable viral vector for gene therapy in the peripheral nerve
.
Gene Ther
2014
;
21
:
549
557
23.
Tsonkova
VG
,
Sand
FW
,
Wolf
XA
, et al
.
The EndoC-βH1 cell line is a valid model of human beta cells and applicable for screenings to identify novel drug target candidates
.
Mol Metab
2018
;
8
:
144
157
24.
Ravassard
P
,
Hazhouz
Y
,
Pechberty
S
, et al
.
A genetically engineered human pancreatic β cell line exhibiting glucose-inducible insulin secretion
.
J Clin Invest
2011
;
121
:
3589
3597
25.
Carlotti
F
,
Bazuine
M
,
Kekarainen
T
, et al
.
Lentiviral vectors efficiently transduce quiescent mature 3T3-L1 adipocytes
.
Mol Ther
2004
;
9
:
209
217
26.
Back
NK
,
Nijhuis
M
,
Keulen
W
, et al
.
Reduced replication of 3TC-resistant HIV-1 variants in primary cells due to a processivity defect of the reverse transcriptase enzyme
.
EMBO J
1996
;
15
:
4040
4049
27.
Ricordi
C
,
Lacy
PE
,
Finke
EH
,
Olack
BJ
,
Scharp
DW
.
Automated method for isolation of human pancreatic islets
.
Diabetes
1988
;
37
:
413
420
28.
Kozomara
A
,
Birgaoanu
M
,
Griffiths-Jones
S
.
miRBase: from microRNA sequences to function
.
Nucleic Acids Res
2019
;
47
:
D155
D162
29.
Li
JH
,
Liu
S
,
Zhou
H
,
Qu
LH
,
Yang
JH
.
starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data
.
Nucleic Acids Res
2014
;
42
:
D92
D97
30.
Hearn
A
,
York
IA
,
Rock
KL
.
The specificity of trimming of MHC class I-presented peptides in the endoplasmic reticulum
.
J Immunol
2009
;
183
:
5526
5536
31.
Eizirik
DL
,
Colli
ML
,
Ortis
F
.
The role of inflammation in insulitis and beta-cell loss in type 1 diabetes
.
Nat Rev Endocrinol
2009
;
5
:
219
226
32.
Gonzalez-Duque
S
,
Azoury
ME
,
Colli
ML
, et al
.
Conventional and neo-antigenic peptides presented by β cells are targeted by circulating naïve CD8+ T cells in type 1 diabetic and healthy donors
.
Cell Metab
2018
;
28
:
946
960.e6
33.
Thomaidou
S
,
Zaldumbide
A
,
Roep
BO
.
Islet stress, degradation and autoimmunity
.
Diabetes Obes Metab
2018
;
20
(
Suppl. 2
):
88
94
34.
Oleson
BJ
,
McGraw
JA
,
Broniowska
KA
, et al
.
Distinct differences in the responses of the human pancreatic b-cell line EndoC-bH1 and human islets to proinflammatory cytokines
.
Am J Physiol Regul Integr Comp Physiol
2015
;
309
:
R525
R534
35.
Hattori
A
,
Matsumoto
K
,
Mizutani
S
,
Tsujimoto
M
.
Genomic organization of the human adipocyte-derived leucine aminopeptidase gene and its relationship to the placental leucine aminopeptidase/oxytocinase gene
.
J Biochem
2001
;
130
:
235
241
36.
Compagnone
M
,
Cifaldi
L
,
Fruci
D
.
Regulation of ERAP1 and ERAP2 genes and their disfunction in human cancer
.
Hum Immunol
2019
;
80
:
318
324
37.
Klein
D
,
Misawa
R
,
Bravo-Egana
V
, et al
.
MicroRNA expression in alpha and beta cells of human pancreatic islets
.
PLoS One
2013
;
8
:
e55064
38.
Sethupathy
P
,
Corda
B
,
Hatzigeorgiou
AG
.
TarBase: a comprehensive database of experimentally supported animal microRNA targets
.
RNA
2006
;
12
:
192
197
39.
Hong
K
,
Xu
G
,
Grayson
TB
,
Shalev
A
.
Cytokines regulate β-cell thioredoxin-interacting protein (TXNIP) via distinct mechanisms and pathways
.
J Biol Chem
2016
;
291
:
8428
8439
40.
Kracht
MJL
,
de Koning
EJP
,
Hoeben
RC
,
Roep
BO
,
Zaldumbide
A
.
Bioluminescent reporter assay for monitoring ER stress in human beta cells
.
SC Rep
2018
;
8
:
17738
41.
Beninga
J
,
Rock
KL
,
Goldberg
AL
.
Interferon-gamma can stimulate post-proteasomal trimming of the N terminus of an antigenic peptide by inducing leucine aminopeptidase
.
J Biol Chem
1998
;
273
:
18734
18742
42.
Urban
S
,
Textoris-Taube
K
,
Reimann
B
, et al
.
The efficiency of human cytomegalovirus pp65(495-503) CD8+ T cell epitope generation is determined by the balanced activities of cytosolic and endoplasmic reticulum-resident peptidases
.
J Immunol
2012
;
189
:
529
538
43.
Guasp
P
,
Lorente
E
,
Martín-Esteban
A
, et al
.
Redundancy and complementarity between ERAP1 and ERAP2 revealed by their effects on the Behcet’s disease-associated HLA-B*51 peptidome
.
Mol Cell Proteomics
2019
;
18
:
1491
1510
44.
Saveanu
L
,
Carroll
O
,
Lindo
V
, et al
.
Concerted peptide trimming by human ERAP1 and ERAP2 aminopeptidase complexes in the endoplasmic reticulum
.
Nat Immunol
2005
;
6
:
689
697
45.
York
IA
,
Chang
SC
,
Saric
T
, et al
.
The ER aminopeptidase ERAP1 enhances or limits antigen presentation by trimming epitopes to 8-9 residues
.
Nat Immunol
2002
;
3
:
1177
1184
46.
Saric
T
,
Chang
SC
,
Hattori
A
, et al
.
An IFN-gamma-induced aminopeptidase in the ER, ERAP1, trims precursors to MHC class I-presented peptides
.
Nat Immunol
2002
;
3
:
1169
1176
47.
LaPierre
MP
,
Stoffel
M
.
MicroRNAs as stress regulators in pancreatic beta cells and diabetes
.
Mol Metab
2017
;
6
:
1010
1023
48.
Dong
D
,
Fu
N
,
Yang
P
.
MiR-17 downregulation by high glucose stabilizes thioredoxin-interacting protein and removes thioredoxin inhibition on ASK1 leading to apoptosis
.
Toxicol Sci
2016
;
150
:
84
96
49.
Oslowski
CM
,
Hara
T
,
O’Sullivan-Murphy
B
, et al
.
Thioredoxin-interacting protein mediates ER stress-induced β cell death through initiation of the inflammasome
.
Cell Metab
2012
;
16
:
265
273
50.
Morita
S
,
Villalta
SA
,
Feldman
HC
, et al
.
Targeting ABL-IRE1α signaling spares ER-stressed pancreatic β cells to reverse autoimmune diabetes
[published correction appears in Cell Metab 2017;25:1207].
Cell Metab
2017
;
25
:
883
897 e8
Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered. More information is available at https://www.diabetesjournals.org/content/license.

Supplementary data