In diabetic pathology, insufficiency in β-cell mass, unable to meet peripheral insulin demand, and functional defects of individual β-cells in production of insulin are often concurrently observed, collectively causing hyperglycemia. Here we show that the phosphorylation of ERK1/2 is significantly decreased in the islets of db/db mice as well as in those of a cohort of subjects with type 2 diabetes. In mice with abrogation of ERK signaling in pancreatic β-cells through deletion of Mek1 and Mek2, glucose intolerance aggravates under high-fat diet–feeding conditions due to insufficient insulin production with lower β-cell proliferation and reduced β-cell mass, while in individual β-cells dampening of the number of insulin exocytosis events is observed, with the molecules involved in insulin exocytosis being less phosphorylated. These data reveal bifunctional roles for MEK/ERK signaling in β-cells for glucose homeostasis, i.e., in regulating β-cell mass as well as in controlling insulin exocytosis in individual β-cells, thus providing not only a novel perspective for the understanding of diabetes pathophysiology but also a potential clue for new drug development for diabetes treatment.

The insulin secretion capacity of pancreas is determined by the amount of β-cells and the function of individual β-cell in secretion of insulin, both of which could be affected by various factors in the pathogenesis of diabetes (1,2). Mitogen-activated protein kinase (MAPK) kinase (MEK)/extracellular signal–regulated kinase (ERK) signaling is involved in many cellular functions including cell growth and survival and cellular differentiation (3). In mammals, the MEK/ERK pathway involves the kinases ERK1 (Mapk3) and ERK2 (Mapk1) and the MAPK kinases MEK1 (Map2k1) and MEK2 (Map2k2). At present, ERK1 and ERK2 are the only known substrates of MEK1 and MEK2 (4), whose functions are known to be redundant, consistent with the high homology in their amino acid sequences (5).

The MEK/ERK signaling pathway is activated by multiple upstream stimuli including insulin (6), and our group, as well as others, has demonstrated a significant role that the insulin signaling pathway plays in β-cells in the pathophysiological regulation of glucose metabolism (7). The MEK/ERK signaling pathway could also be activated by other hormones such as glucagon and growth factors including insulin-like growth factor 1 and platelet-derived growth factor—or by environmental stress as well (6,8,9). Besides, glucose and other nutrients may provoke MEK/ERK signaling activation in cultured β-cell lines, where glucose is proposed to stimulate MEK/ERK signaling in both insulin receptor–dependent and –independent fashions (8,10). While MEK/ERK signaling has been extensively studied in numerous models and its significant roles for β-cell physiology have been proposed (9,11), a systematic in vivo assessment of the roles that MEK/ERK signaling plays in β-cells for glucose metabolism has not been conducted.

Here we have performed in vivo assessments of the significance of MEK/ERK signaling in β-cells, which is downregulated in diabetic mice and in humans with diabetes. Studies using β-cell–specific Mek1/2-deficient mice and phosphoproteomics analyses of their islets and cultured β-cells have revealed that MEK/ERK signaling is required for β-cell mass regulation and plays a role in exocytosis of insulin granules, suggesting that MEK/ERK signaling plays roles in both the quantitative and the qualitative control of pancreatic β-cells.

Human Subjects

Autopsied pancreatic tissues from 13 subjects without diabetes and those from 5 subjects with type 2 diabetes were evaluated. Clinical data are briefly summarized in Supplementary Table 1. All patients were autopsied within 5 h of death for avoidance of autolytic changes in pancreas. Excised body of the pancreas was fixed with 10% neutral buffered formalin and embedded in paraffin (FFPE). Snap-frozen pancreas was also prepared for phosphorylated (phospho)-ERK immunofluorescence. The use of pancreatic tissue was approved by the ethics committee of the Hirosaki University Graduate School of Medicine (approval no. 2017-121).

Table 1

The mouse lines, antibodies used for immunoblotting and immunostaining, and primers and probes used for quantitative RT-PCR analyses

ResourceSourceIdentifierDilution
Mouse lines    
 BKS.Cg-+ Leprdb/+ Leprdb/Jcl CLEA Japan N/A  
 BKS.Cg-m+/m+/Jcl CLEA Japan N/A  
 C57BL/6JJcl CLEA Japan N/A  
 MIP-CreERT (B6.Cg-Tg(Ins1-cre/ERT)1Lphi/J) The Jackson Laboratory 024709 (49 
Mek2ko/ko Laboratory of Charron J (50N/A  
Mek1f/f Laboratory of Charron J (51N/A  
Antibodies    
 For immunoblotting    
  Rabbit anti-ERK1/2 Cell Signaling Technology 9102S 1:1,000 
  Rabbit anti–phospho-ERK1/2 Cell Signaling Technology 9101S 1:1,000 
  Rabbit anti-MEK1 Cell Signaling Technology 9146S 1:1,000 
  Rabbit anti-MEK2 Cell Signaling Technology 9147S 1:1,000 
  Rabbit anti–phospho-MEK1/2 Cell Signaling Technology 9154S 1:1,000 
  Rabbit anti-AKT Cell Signaling Technology 4691S 1:1,000 
  Rabbit anti–phospho-AKT Cell Signaling Technology 9271S 1:1,000 
  Mouse anti-ACTB Sigma-Aldrich A2228 1:5,000 
 For immunostaining    
  Rabbit anti-Ki67 NeoMarkers RM-9106-S0 1:500 
  Guinea pig anti-insulin DAKO A0564 1:300 
  Guinea pig anti-Gcg DAKO A0565 1:200 
  Rabbit anti-MEK1 Abcam ab32091 1:150 
  Rabbit anti-SOX9 Millipore AB5535-250G 1:100 
  Mouse anti-NGN3 Developmental Studies Hybridoma Bank F25A1B3 1:100 
  Rabbit anti-insulin Abcam ab181547 1:5,000 
  Mouse anti–phospho-ERK1/2 Santa Cruz Biotechnology sc-7383 1:1,000 
Primers and probes for quantitative RT-PCR analyses    
Ccnd1 ABI Mm00432359_m1  
Ccnd2 ABI Mm00438070_m1  
Ccnd3 ABI Mm01612362_m1  
Ccne1 ABI Mm01266311_m1  
Cdkn1a (p21) ABI Mm00432448_m1  
Gcg ABI Mm00801714_m1  
Arx Integrated DNA Technologies Mm.PT.58.31593773  
Stx1a ABI Mm00444008_m1  
Rab27a ABI Mm00469997_m1  
Vamp2 ABI Mm00494118_g1  
Snap25 ABI Mm00456921_m1  
Itpr3 ABI Mm01306070_m1  
Rab37 ABI Mm00445351_m1  
Pclo ABI Mm00465330_m1  
Sytl4 ABI Mm00489110_m1  
Rims2 ABI Mm01158145_m1  
ResourceSourceIdentifierDilution
Mouse lines    
 BKS.Cg-+ Leprdb/+ Leprdb/Jcl CLEA Japan N/A  
 BKS.Cg-m+/m+/Jcl CLEA Japan N/A  
 C57BL/6JJcl CLEA Japan N/A  
 MIP-CreERT (B6.Cg-Tg(Ins1-cre/ERT)1Lphi/J) The Jackson Laboratory 024709 (49 
Mek2ko/ko Laboratory of Charron J (50N/A  
Mek1f/f Laboratory of Charron J (51N/A  
Antibodies    
 For immunoblotting    
  Rabbit anti-ERK1/2 Cell Signaling Technology 9102S 1:1,000 
  Rabbit anti–phospho-ERK1/2 Cell Signaling Technology 9101S 1:1,000 
  Rabbit anti-MEK1 Cell Signaling Technology 9146S 1:1,000 
  Rabbit anti-MEK2 Cell Signaling Technology 9147S 1:1,000 
  Rabbit anti–phospho-MEK1/2 Cell Signaling Technology 9154S 1:1,000 
  Rabbit anti-AKT Cell Signaling Technology 4691S 1:1,000 
  Rabbit anti–phospho-AKT Cell Signaling Technology 9271S 1:1,000 
  Mouse anti-ACTB Sigma-Aldrich A2228 1:5,000 
 For immunostaining    
  Rabbit anti-Ki67 NeoMarkers RM-9106-S0 1:500 
  Guinea pig anti-insulin DAKO A0564 1:300 
  Guinea pig anti-Gcg DAKO A0565 1:200 
  Rabbit anti-MEK1 Abcam ab32091 1:150 
  Rabbit anti-SOX9 Millipore AB5535-250G 1:100 
  Mouse anti-NGN3 Developmental Studies Hybridoma Bank F25A1B3 1:100 
  Rabbit anti-insulin Abcam ab181547 1:5,000 
  Mouse anti–phospho-ERK1/2 Santa Cruz Biotechnology sc-7383 1:1,000 
Primers and probes for quantitative RT-PCR analyses    
Ccnd1 ABI Mm00432359_m1  
Ccnd2 ABI Mm00438070_m1  
Ccnd3 ABI Mm01612362_m1  
Ccne1 ABI Mm01266311_m1  
Cdkn1a (p21) ABI Mm00432448_m1  
Gcg ABI Mm00801714_m1  
Arx Integrated DNA Technologies Mm.PT.58.31593773  
Stx1a ABI Mm00444008_m1  
Rab27a ABI Mm00469997_m1  
Vamp2 ABI Mm00494118_g1  
Snap25 ABI Mm00456921_m1  
Itpr3 ABI Mm01306070_m1  
Rab37 ABI Mm00445351_m1  
Pclo ABI Mm00465330_m1  
Sytl4 ABI Mm00489110_m1  
Rims2 ABI Mm01158145_m1  

Animals

Male db/db mice, misty/misty mice, and C57BL/6J mice were purchased from CLEA Japan. For preparation of DIO mice, C57BL/6J mice were assigned either a high-fat diet (HFD) (HFD32; CLEA Japan) or a low-fat diet (a normal chow diet [NCD], CE-2; CLEA Japan) at 5 weeks of age. Genetically engineered mice used in this study are presented in Table 1. β-Cell–specific Mek1 deletion was conducted by crossing of Mek1-floxed mice with MIP-Cre/ERT mice and intraperitoneal injection of tamoxifen (Tmx) (100 mg/kg body wt for five consecutive days) (Sigma-Aldrich) at 6 weeks of age. For Mek1 and Mek2 abrogation in β-cells, MIP-Cre/ERT mice were crossed with mice homozygous for Mek1-floxed alleles on a systemic Mek2-knockout background, with Cre induction by Tmx at 6 weeks of age (MIP-Cre/ERT+/Mek1f/f/Mek2ko/ko [Tmx+]: hereafter referred to as βMek1/2DKO mice). The offspring were obtained by crossing of MIP-Cre/ERT+/Mek1f/f mice with Mek1f/f mice or by crossing of MIP-Cre/ERT+/Mek1f/f/Mek2ko/ko mice with Mek1f/f/Mek2ko/ko mice, and these mice were maintained in their respective closed colonies on a 129/SvEv/C57BL/6JJcl mixed background. As it has already been suggested that the expression of human growth hormone (hGH) in MIP-Cre/ERT construct itself may affect β-cell homeostasis (12,13), we used littermates of the same genotype injected with vehicle (corn oil) (MIP-CreERT+/Mek1f/f/Mek2ko/ko [Tmx]: hereafter referred to as Tmx controls) as the experimental controls. All the experiments were conducted after >4 weeks’ washout period following Tmx administration. HFD feeding was started 2 weeks after the last intraperitoneal injection of Tmx. Animal care and experimentations were approved by the Animal Care and Use Committee of the National Center for Global Health and Medicine.

Cell Line

MIN6 clone 4 (MINcl4) β-cell line (14) was maintained in DMEM containing 25 mmol/L glucose, 15% FBS, 0.07 mmol/L 2-mercaptoethanol, 100 units/mL penicillin, and 0.05 mg/mL streptomycin in humidified 5% CO2 at 37°C.

Metabolic Studies

Insulin tolerance tests, glucose tolerance tests (GTTs), and the measurements of plasma insulin levels on a glucose challenge were conducted as previously described (15). Blood glucose levels were measured with Glutest Neo alpha or Glutest Mint (Sanwa Kagaku Kenkyusho). Plasma insulin levels were measured with Morinaga Mouse Insulin ELISA kits and Morinaga Ultra Sensitive Mouse Insulin ELISA kits (Morinaga Institute of Biological Science, Inc.). For estimation of insulin clearance, mice were intraperitoneally injected with human insulin (Eli Lilly) (1.0 units/kg body wt) and blood samples were collected at the indicated time points. Plasma human insulin levels were measured with a human insulin–specific ELISA kit (Mercodia).

Islet Isolation

Pancreas was perfused with Liberase TL (Roche) solution and subsequently digested for 24 min at 37°C as previously described (15). Islets were picked manually, washed with PBS, and immediately used for further experiments or maintained in recovery media (16).

Immunoblotting

MINcl4 cells and freshly isolated islets were lysed by sonication in buffer A (17). Other tissues were homogenized in homogenization buffer (17). The samples were prepared by heating at 100°C with Laemmli buffer for 5 min and subjected to immunoblotting with use of antibodies listed in Table 1. Primary antibodies were diluted in 2.5% BSA in Tris-buffered saline with Tween, except for MEK1, MEK2, phospho-MEK1/2, and phospho-AKT antibodies, where Can Get Signal Solution 1 (TOYOBO) was used for dilution. The blots were developed with use of Chemi-Lumi One L (Nacalai Tesque) or BM Chemiluminescence Western Blotting Substrate (POD) (Roche). The band intensity was quantified with Image Lab (Bio-Rad Laboratories).

Immunostaining and Morphometric Analysis of Human Subjects

Several consecutive 4-μm-thick sections were obtained from FFPE specimens. The proportion of β-cell area relative to total pancreatic parenchymal area (β-cell volume density [Vβ]) was determined by insulin immunostaining (Abcam) with the point-counting method on at least 2,000 islets in each subject captured with Axio Imager A1 (Carl Zeiss) as previously described (18,19). For phospho-ERK immunofluorescence, 7-μm-thick frozen sections were incubated with primary antibodies for insulin (Abcam) and phospho-ERK (Santa Cruz Biotechnology), followed by incubation with Alexa Fluor 594– and Alexa Fluor 488–conjugated secondary antibodies (Invitrogen). Immunofluorescence images were captured at ×40 magnification with the BZ-X700 (KEYENCE). All morphometric analyses were performed in a blinded manner.

Immunostaining and Morphometric Analysis of Mouse Samples

The adult mice were perfused with PBS and 4% paraformaldehyde (PFA) under anesthesia. Resected mouse pancreases were further fixed in 4% PFA overnight and embedded in paraffin. Embryonic pancreases from mouse embryos (embryonic day 14.5) were fixed in 4% PFA and embedded in paraffin. Paraffin sections (3 μm) were deparaffined and autoclaved in 0.01 mol/L citrate buffer (pH 6.0) for antigen retrieval. For MEK1, NGN3, and SOX9 staining, sections were additionally incubated in 0.1% Triton X-100 for permeabilization after antigen retrieval. Sections were stained with antibodies listed in Table 1 and subsequently incubated with Alexa Fluor 594– and Alexa Fluor 488–conjugated secondary antibodies (Invitrogen), except for the MEK1 staining, where EnVision+ System- HRP Labeled Polymer Anti-rabbit (Dako) was used as a secondary antibody and DAB Peroxidase Substrate Kit ImmPACT (Vector Labs) was used for visualization. Counterstain was conducted with hematoxylin-eosin. The TUNEL staining was performed with an In Situ Cell Death Detection Kit (Roche). Images were obtained with the BZ-X700 (KEYENCE) and analyzed with Analysis Application Hybrid Cell Count (KEYENCE).

RNA Sequence Analysis

Total RNA was isolated from isolated islets with TRIZOL reagent (Invitrogen). Sample preparation and RNA sequencing were performed as previously described (20). FASTQ files were imported to CLC Genomics Workbench (CLC-GW) (version 10.1.1; QIAGEN). Reads were mapped to the mouse reference genome (mm10) and quantified for the annotated 49,585-gene set provided by CLC-GW.

Quantitative RT-PCR Analysis

Total RNA was extracted by RNeasy Mini Kit (QIAGEN), followed by reverse transcription with a high-capacity cDNA reverse transcription kit (Applied Biosystems [ABI]). Quantitative RT-PCR was performed by ABI StepOnePlus with use of KAPA PROBE FAST qPCR Master Mix (2X) ABI Prism (Kapa Biosystems). Gene expression levels were normalized to the expression of cyclophilin A (CypA) in each sample. The primer sequences for CypA are as follows: F, GGTCCTGGCATCTTGTCCAT, and R, CAGTCTTGGCAGTGCAGATAAAA. Other primers and probes, purchased from ABI and Integrated DNA Technologies, are listed in Table 1.

Two-Photon Excitation Imaging

Two-photon imaging of the islets was performed with an inverted laser-scanning microscope (IX81; Olympus) with 60X oil immersion objective lens (1.2 numerical aperture) at the wavelength of 830 nm as previously described (21). Glucose-stimulated exocytotic events of insulin granules were detected with extracellular polar tracer, sulforhodamine B (Thermo Fisher Scientific), counted in a region of interest (typically 3,200–4,500 μm2) and normalized to an area of 800 μm2. The acetoxymethyl esters of the Ca2+ indicators, Fura-2 (Thermo Fisher Scientific), as well as those of the caged-Ca2+ compound NP-EGTA (Thermo Fisher Scientific) were loaded to the islets as previously described (22). The intensity of Fura-2 poststimulation fluorescence (F) was analyzed in the cytoplasm and normalized by the resting fluorescence (F0). Photolysis of NP-EGTA was induced with a brief flash (1.0 s) of a mercury lamp (model IX-RFC; Olympus).

Phosphoproteomics Analysis for Isolated Islets and MINcl4 Cells

Isolated islets were placed in recovery media for 2 h in humidified 5% CO2 at 37°C (16). The islets were lysed by sonication in buffer A. Islets (500–1,000) were pooled to make one sample. MINcl4 cells were maintained in Krebs-Ringer bicarbonate buffer (KRBB) (15) with 0.2% BSA supplemented with 2.8 mmol/L glucose for 2 h at 37°C. Thirty minutes before glucose stimulation, U0126 (10 μmol/L) or vehicle (0.1% DMSO) was added to the buffer. The cells were then stimulated for 5 min by 2.8 mmol/L or 22.2 mmol/L glucose with U0126 (10 μmol/L) or vehicle (0.1% DMSO). After glucose stimulation, MINcl4 cells were lysed in buffer A. Lysates of islets or MINcl4 cells were boiled, sonicated, and subjected to reduction, alkylation, and digestion with trypsin and Lys-C (23). Phosphopeptides were enriched by a Fe-IMAC/C18 StageTip and labeled by TMT 10plex reagent. Labeled phosphopeptides were fractionated into seven fractions (24). The phosphoproteomics analysis was conducted with Q Exactive Plus (Thermo Fisher Scientific). Phosphopeptide identification was carried out with MaxQuant. The settings of liquid chromatography–tandem mass spectrometry and database search were performed according to the methodology of a previous phosphoproteomics study (23).

Statistical Analyses

Statistical significance was determined by an unpaired two-tailed Student t test, one-way ANOVA with the Tukey multiple comparisons test, and two-way ANOVA with the Sidak multiple comparisons test and with the Tukey multiple comparisons test, with use of GraphPad Prism, version 7 (GraphPad).

Data and Resource Availability

RNA-sequencing data generated and analyzed during the current study are available in DDBJ repository with accession code E-GEAD-385. Phosphoproteomics data generated and analyzed during the current study are available in jPOSTrepo and can be accessed with accession code JPST001021. No applicable resources were generated or analyzed during the current study.

MEK/ERK Phosphorylation Was Reduced in the Islets of db/db Mice but Remained Unchanged Under HFD Conditions

We first investigated the two different obese animal models, namely, db/db mice (25) and DIO mice (26). The db/db mice showed marked hyperinsulinemia at 6 weeks of age compared with the lean misty/misty control mice, and thereafter their circulating insulin levels declined and hyperglycemia developed (27) (Fig. 1A–C), while the plasma insulin levels continuously increased in the DIO mice, with their hyperglycemia being only mild for up to 20 weeks of HFD feeding (Fig. 1F–H). Interestingly, unlike the levels of Akt phosphorylation, which were significantly lower in the islets of both of the obese models compared with their controls (15) (Fig. 1D and I and Supplementary Fig. 1A and B), the levels of MEK1/2 and ERK1/2 phosphorylation were significantly lower in the db/db mouse islets (Fig. 1D and E and Supplementary Fig. 1A), while those in the DIO mouse islets were maintained or even higher compared with their controls (Fig. 1I and J and Supplementary Fig. 1B). These results prompted us to hypothesize that maintained MEK/ERK signaling would be necessary for the compensatory β-cell adaptation in insulin resistance.

Figure 1

ERK phosphorylation was attenuated in the islets of db/db mice but was maintained in those of DIO mice. AC: Profiles of db/db and misty/misty mice at 6, 10, and 14 weeks (w) of age: body weight (A), blood glucose levels (B), and plasma insulin concentrations (C). **P < 0.01, n = 6–15. All data are represented as mean ± SEM. D: Immunoblots of proteins of interest in the islets of 6-, 10-, and 14-week-old db/db mice and misty/misty mice. E: Levels of ERK and pERK as quantified in the immunoblots. *P < 0.05, **P < 0.01, n = 3. All data are represented as mean ± SEM. FH: Profiles of DIO mice fed HFD for 2, 10, and 20 weeks and the age-matched control mice on NCD; body weight (F), blood glucose levels (G), and plasma insulin concentrations (H). **P < 0.01, n = 6–13. All data are represented as mean ± SEM. I: Immunoblots of proteins of interest in the islets of DIO mice fed HFD for 2, 10, and 20 weeks and age-matched control mice fed NCD. J: Levels of ERK and phospho-ERK as quantified in the immunoblots. *P < 0.05, n = 3–4. All data are represented as mean ± SEM. K: Vβ in the subjects with (T2DM) or without (non-DM) type 2 diabetes. *P < 0.05, n = 5–13. All data are represented as mean ± SEM. L: Quantified proportions of phospho-ERK1/2+ cells in insulin+ cells in the subjects with or without type 2 diabetes. **P < 0.01, n = 5–13. All data are represented as mean ± SEM. M: Relation between the proportion of phospho-ERK1/2+ cells in insulin+ cells and the Vβ in the subjects with or without type 2 diabetes. Note that the regression line for those without diabetes and that for all subjects were almost indistinguishable. y = 0.03126x + 0.7314, **P = 0.0018, R2 = 0.47 for all subjects; y = 0.02959x + 0.7572, P = 0.052, R2 = 0.30 for subjects without diabetes; and y = 0.05306x + 0.5734, P = 0.29, R2 = 0.36 for subjects with type 2 diabetes. n = 5, type 2 diabetes; n = 13, no diabetes. See also Supplementary Fig. 1 and Supplementary Table 1. p, phosphorylated.

Figure 1

ERK phosphorylation was attenuated in the islets of db/db mice but was maintained in those of DIO mice. AC: Profiles of db/db and misty/misty mice at 6, 10, and 14 weeks (w) of age: body weight (A), blood glucose levels (B), and plasma insulin concentrations (C). **P < 0.01, n = 6–15. All data are represented as mean ± SEM. D: Immunoblots of proteins of interest in the islets of 6-, 10-, and 14-week-old db/db mice and misty/misty mice. E: Levels of ERK and pERK as quantified in the immunoblots. *P < 0.05, **P < 0.01, n = 3. All data are represented as mean ± SEM. FH: Profiles of DIO mice fed HFD for 2, 10, and 20 weeks and the age-matched control mice on NCD; body weight (F), blood glucose levels (G), and plasma insulin concentrations (H). **P < 0.01, n = 6–13. All data are represented as mean ± SEM. I: Immunoblots of proteins of interest in the islets of DIO mice fed HFD for 2, 10, and 20 weeks and age-matched control mice fed NCD. J: Levels of ERK and phospho-ERK as quantified in the immunoblots. *P < 0.05, n = 3–4. All data are represented as mean ± SEM. K: Vβ in the subjects with (T2DM) or without (non-DM) type 2 diabetes. *P < 0.05, n = 5–13. All data are represented as mean ± SEM. L: Quantified proportions of phospho-ERK1/2+ cells in insulin+ cells in the subjects with or without type 2 diabetes. **P < 0.01, n = 5–13. All data are represented as mean ± SEM. M: Relation between the proportion of phospho-ERK1/2+ cells in insulin+ cells and the Vβ in the subjects with or without type 2 diabetes. Note that the regression line for those without diabetes and that for all subjects were almost indistinguishable. y = 0.03126x + 0.7314, **P = 0.0018, R2 = 0.47 for all subjects; y = 0.02959x + 0.7572, P = 0.052, R2 = 0.30 for subjects without diabetes; and y = 0.05306x + 0.5734, P = 0.29, R2 = 0.36 for subjects with type 2 diabetes. n = 5, type 2 diabetes; n = 13, no diabetes. See also Supplementary Fig. 1 and Supplementary Table 1. p, phosphorylated.

Close modal

On the other hand, a cohort of patients with nonobese type 2 diabetes (Supplementary Table 1), showing a smaller proportion of β-cell area relative to the total pancreatic parenchymal area (Vβ) (19) (Fig. 1K), exhibited a significantly lower proportion of phospho-ERK1/2+ cells in insulin+ cells compared with the subjects without diabetes (Fig. 1L and Supplementary Fig. 1C), with a strong correlation observed between Vβ and the proportion of phospho-ERK1/2+ cells in insulin+ cells (Fig. 1M). These data suggested a possibility that MEK/ERK signaling could be involved in the regulation of β-cell mass under nondiabetic conditions and also in the pathogenesis of a certain type of diabetes in humans.

βMek1/2DKO Mice Exhibited Glucose Intolerance With Lower Insulin Secretion Under HFD Conditions

To assess the role of MEK/ERK signaling in vivo, we created a mouse model with defective pancreatic β-cell MEK/ERK signaling by targeting MEK1 and MEK2, the upstream kinases responsible for ERK1 and ERK2 phosphorylation (28). While the mice with β-cell–specific Mek1 deletion or those with systemic Mek2 deletion did not exhibit complete abrogation of ERK1/2 phosphorylation in the islets (Supplementary Fig. 2A and B), consistent with the functional redundancy of MEK1 and MEK2 as previously reported (5), βMek1/2DKO mice showed robust reductions in the levels of MEK1 protein expression as well as those of MEK1/2 and ERK1/2 phosphorylation in the islets compared with the Tmx control mice (Fig. 2A and B and Supplementary Fig. 2C). The levels of MEK1 protein expression remained unchanged in the liver, muscle, epididymal white adipose tissue, and hypothalamus (Supplementary Fig. 2D).

Figure 2

βMek1/2DKO mice fed HFD showed exacerbation of glucose intolerance with lower insulin secretion compared with Tmx control mice. A: Immunoblots of proteins of interest in the islets of 14-week-old MIP-Cre/ERT+/Mek1f/f/Mek2ko/ko mice with or without Tmx injection (βMek1/2DKO and Tmx control mice). B: Immunohistochemistry staining with an MEK1-specific antibody of the pancreatic sections from 15-week-old βMek1/2DKO and Tmx control mice. Scale bar, 50 μm. C and D: Profiles of βMek1/2DKO and Tmx control mice fed HFD; body weight (C) blood glucose levels (D). *P < 0.05, n = 10. All data are represented as mean ± SEM. E: Plasma insulin concentrations in βMek1/2DKO and Tmx control mice fed HFD. *P < 0.05, **P < 0.01, n = 17–18. All data are represented as mean ± SEM. FH: Blood glucose levels after intraperitoneal injection of glucose (1.0 g/kg body wt) in βMek1/2DKO and Tmx control mice fed HFD for 7 weeks (F), 12 weeks (G), and 19 weeks (H). **P < 0.01, n = 7–10. All data are represented as mean ± SEM. I: Plasma insulin concentrations after intraperitoneal injection of glucose (3.0 g/kg body wt) in βMek1/2DKO and Tmx control mice fed HFD for 22–23 weeks. *P < 0.05, n = 22–25. All data are represented as mean ± SEM. See also Supplementary Figs. 24. p, phosphorylated.

Figure 2

βMek1/2DKO mice fed HFD showed exacerbation of glucose intolerance with lower insulin secretion compared with Tmx control mice. A: Immunoblots of proteins of interest in the islets of 14-week-old MIP-Cre/ERT+/Mek1f/f/Mek2ko/ko mice with or without Tmx injection (βMek1/2DKO and Tmx control mice). B: Immunohistochemistry staining with an MEK1-specific antibody of the pancreatic sections from 15-week-old βMek1/2DKO and Tmx control mice. Scale bar, 50 μm. C and D: Profiles of βMek1/2DKO and Tmx control mice fed HFD; body weight (C) blood glucose levels (D). *P < 0.05, n = 10. All data are represented as mean ± SEM. E: Plasma insulin concentrations in βMek1/2DKO and Tmx control mice fed HFD. *P < 0.05, **P < 0.01, n = 17–18. All data are represented as mean ± SEM. FH: Blood glucose levels after intraperitoneal injection of glucose (1.0 g/kg body wt) in βMek1/2DKO and Tmx control mice fed HFD for 7 weeks (F), 12 weeks (G), and 19 weeks (H). **P < 0.01, n = 7–10. All data are represented as mean ± SEM. I: Plasma insulin concentrations after intraperitoneal injection of glucose (3.0 g/kg body wt) in βMek1/2DKO and Tmx control mice fed HFD for 22–23 weeks. *P < 0.05, n = 22–25. All data are represented as mean ± SEM. See also Supplementary Figs. 24. p, phosphorylated.

Close modal

To clarify the significance of MEK/ERK signaling in β-cells in diet-induced obesity, we fed βMek1/2DKO mice with HFD and investigated their metabolic phenotypes. While the body weight gain was similar between the DIO βMek1/2DKO mice and the Tmx control DIO mice, the DIO βMek1/2DKO mice showed higher blood glucose levels with ad libitum status (Fig. 2C and D) with significantly lower plasma insulin levels (Fig. 2E) than the Tmx controls at 12 weeks or 18 weeks of HFD feeding. The DIO βMek1/2DKO mice showed higher plasma glucose levels during a GTT than the Tmx controls, as they developed obesity after 19 weeks of HFD feeding (Fig. 2F–H). The DIO βMek1/2DKO mice also showed a moderate but significant decrease in plasma insulin levels on a glucose challenge than the Tmx controls at 22–23 weeks of HFD feeding (Fig. 2I), while there was no difference between the groups in their blood glucose levels during insulin tolerance tests (Supplementary Fig. 2E–G). We found no metabolic differences among Mek2ko/ko, Mek2wt/ko, and Mek2wt/wt (Supplementary Fig. 3A–I) or between the Mek1f/f/Mek2ko/ko mice injected with Tmx and those injected with vehicle (corn oil) (Supplementary Fig. 4A–I) under HFD conditions. Taken together, these data indicated that Mek1/2 deletion in β-cells exacerbated glucose intolerance with lower insulin secretion under HFD feeding conditions.

Figure 3

Histological and gene expression analyses of islets from βMek1/2DKO mice fed HFD. A: Proportion of insulin+ islet area in the whole pancreas as assessed using anti-insulin antibody- and DAPI-stained pancreas sections from βMek1/2DKO and Tmx control mice fed HFD for the indicated period of weeks (w). Four whole pancreatic sections per animal (400 μm apart) were analyzed. *P < 0.05, **P < 0.01, n = 4–8. All data are represented as mean ± SEM. B: The number of islets with a cross-sectional area of interest in the pancreas sections from βMek1/2DKO and Tmx control mice fed HFD for 23 weeks (HFD23w). *P < 0.05, **P < 0.01, n = 7–8. All data are represented as mean ± SEM. C: Immunohistochemistry (IHC) staining with an insulin-specific antibody (red), a Ki67-specific antibody (green), and DAPI (blue) of pancreatic sections from βMek1/2DKO and Tmx control mice fed HFD for 6 weeks (upper) and quantified proportions of Ki67+ cells in insulin+ cells for βMek1/2DKO and Tmx control mice fed HFD for 2 weeks and 6 weeks; **P = 0.01, n = 4–7 (lower). The number of Ki67+insulin+ cells was manually counted in at least 800 insulin+ β-cells per animal. Scale bar, 50 μm. All data are represented as mean ± SEM. D: Immunohistochemistry staining with an insulin-specific antibody (red), TUNEL staining (green), and DAPI (blue) of pancreatic sections from βMek1/2DKO and Tmx control mice fed HFD for 6 weeks (left) and quantified proportions of TUNEL+ cells in insulin+ cells; n = 5–7 (right). The number of TUNEL+insulin+ cells was manually counted in at least 1,400 insulin+ β-cells per animal. Scale bar, 50 μm. All data are represented as mean ± SEM. E: Immunohistochemistry staining with an insulin-specific antibody (red), an Ngn3-specific antibody (green), and DAPI (blue) of pancreatic sections from βMek1/2DKO and Tmx control fed HFD for 18 weeks. Scale bar, 50 μm. F: Levels of Ngn3 expression in the islets from βMek1/2DKO and Tmx control mice fed NCD or HFD for indicated periods. n = 4–9. All data are represented as mean ± SEM. G: Expression profiles of cell cycle–related genes as assessed by RNA-sequencing analyses (z scores). Genes with significantly altered expression values (P value <0.05) between βMek1/2DKO and Tmx control islets are indicated with an asterisk and underbar. H: Levels of expression of genes of interest in the islets from βMek1/2DKO and Tmx control mice fed NCD or HFD for indicated periods. *P= 0.05, **P = 0.01, n = 4–9. All data are represented as mean ± SEM. See also Supplementary Fig. 5.

Figure 3

Histological and gene expression analyses of islets from βMek1/2DKO mice fed HFD. A: Proportion of insulin+ islet area in the whole pancreas as assessed using anti-insulin antibody- and DAPI-stained pancreas sections from βMek1/2DKO and Tmx control mice fed HFD for the indicated period of weeks (w). Four whole pancreatic sections per animal (400 μm apart) were analyzed. *P < 0.05, **P < 0.01, n = 4–8. All data are represented as mean ± SEM. B: The number of islets with a cross-sectional area of interest in the pancreas sections from βMek1/2DKO and Tmx control mice fed HFD for 23 weeks (HFD23w). *P < 0.05, **P < 0.01, n = 7–8. All data are represented as mean ± SEM. C: Immunohistochemistry (IHC) staining with an insulin-specific antibody (red), a Ki67-specific antibody (green), and DAPI (blue) of pancreatic sections from βMek1/2DKO and Tmx control mice fed HFD for 6 weeks (upper) and quantified proportions of Ki67+ cells in insulin+ cells for βMek1/2DKO and Tmx control mice fed HFD for 2 weeks and 6 weeks; **P = 0.01, n = 4–7 (lower). The number of Ki67+insulin+ cells was manually counted in at least 800 insulin+ β-cells per animal. Scale bar, 50 μm. All data are represented as mean ± SEM. D: Immunohistochemistry staining with an insulin-specific antibody (red), TUNEL staining (green), and DAPI (blue) of pancreatic sections from βMek1/2DKO and Tmx control mice fed HFD for 6 weeks (left) and quantified proportions of TUNEL+ cells in insulin+ cells; n = 5–7 (right). The number of TUNEL+insulin+ cells was manually counted in at least 1,400 insulin+ β-cells per animal. Scale bar, 50 μm. All data are represented as mean ± SEM. E: Immunohistochemistry staining with an insulin-specific antibody (red), an Ngn3-specific antibody (green), and DAPI (blue) of pancreatic sections from βMek1/2DKO and Tmx control fed HFD for 18 weeks. Scale bar, 50 μm. F: Levels of Ngn3 expression in the islets from βMek1/2DKO and Tmx control mice fed NCD or HFD for indicated periods. n = 4–9. All data are represented as mean ± SEM. G: Expression profiles of cell cycle–related genes as assessed by RNA-sequencing analyses (z scores). Genes with significantly altered expression values (P value <0.05) between βMek1/2DKO and Tmx control islets are indicated with an asterisk and underbar. H: Levels of expression of genes of interest in the islets from βMek1/2DKO and Tmx control mice fed NCD or HFD for indicated periods. *P= 0.05, **P = 0.01, n = 4–9. All data are represented as mean ± SEM. See also Supplementary Fig. 5.

Close modal
Figure 4

The number of glucose-stimulated exocytotic events was lower in the β-cells from βMek1/2DKO mice fed HFD compared with Tmx controls. A: Average number of glucose-stimulated exocytotic events in the islets from βMek1/2DKO and Tmx control mice fed HFD for 24 weeks, as normalized to an arbitrary area (800 μm2) of islets (left), and the total number of exocytotic events occurring within 0–5 min and 5–10 min of glucose stimulation (right). n = 9 islets from one Tmx control mouse and 12 islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. B: Glucose-stimulated Ca2+ influx as measured on a single–β-cell basis by the Ca2+ indicator Fura-2. Maximum rates of change in (F0 − F)/F0 are shown. Fura-2 F values were normalized by their respective F0 values. n = 44 regions of interest for four islets from two Tmx control mice and 40 regions of interest for four islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. C: Alteration of cytosolic Ca2+ concentrations provoked by photolysis of a caged-Ca2+ compound in the islets of βMek1/2DKO and Tmx control mice fed HFD for 24 weeks. The average of six ROI from one Tmx control islet and the average of seven ROI from one βMek1/2DKO islet are shown. D: Total number of exocytotic events occurring in the islets on caged Ca2+ stimulation, as normalized to an arbitrary area (800 μm2) of islets. *P < 0.01, n = 6 islets from two Tmx control mice and 9 islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. See also Supplementary Fig. 6.

Figure 4

The number of glucose-stimulated exocytotic events was lower in the β-cells from βMek1/2DKO mice fed HFD compared with Tmx controls. A: Average number of glucose-stimulated exocytotic events in the islets from βMek1/2DKO and Tmx control mice fed HFD for 24 weeks, as normalized to an arbitrary area (800 μm2) of islets (left), and the total number of exocytotic events occurring within 0–5 min and 5–10 min of glucose stimulation (right). n = 9 islets from one Tmx control mouse and 12 islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. B: Glucose-stimulated Ca2+ influx as measured on a single–β-cell basis by the Ca2+ indicator Fura-2. Maximum rates of change in (F0 − F)/F0 are shown. Fura-2 F values were normalized by their respective F0 values. n = 44 regions of interest for four islets from two Tmx control mice and 40 regions of interest for four islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. C: Alteration of cytosolic Ca2+ concentrations provoked by photolysis of a caged-Ca2+ compound in the islets of βMek1/2DKO and Tmx control mice fed HFD for 24 weeks. The average of six ROI from one Tmx control islet and the average of seven ROI from one βMek1/2DKO islet are shown. D: Total number of exocytotic events occurring in the islets on caged Ca2+ stimulation, as normalized to an arbitrary area (800 μm2) of islets. *P < 0.01, n = 6 islets from two Tmx control mice and 9 islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. See also Supplementary Fig. 6.

Close modal

βMek1/2DKO Mice Had Smaller β-Cell Mass Than Tmx Controls

Next, we histologically assessed the islets of DIO βMek1/2DKO mice. In parallel with the results of GTTs, we observed a significantly smaller proportion of insulin+ islet area in the total pancreatic area in the βMek1/2DKO mice at 18 and 23 weeks of HFD feeding than in the DIO Tmx control mice (Fig. 3A), which was accounted for by the lower number of large islets their size >5 × 104 μm2 when normalized to the total pancreatic area (Fig. 3B). Furthermore, the proportion of Ki67+ cells in insulin+ cells was lower, while the proportion of TUNEL+ cells in insulin+ cells also tended to be lower, in the islets of DIO βMek1/2DKO mice than in those of DIO Tmx control animals (Fig. 3C and D). We found neither Ngn3+ cells (Ngn3hi) in the islets as an indicator of de-differentiation of β-cells (29) in DIO βMek1/2DKO mice at 18 weeks of HFD feeding nor significant difference in Ngn3 mRNA expression levels between the DIO βMek1/2DKO and DIO Tmx control mouse islets (Fig. 3E and F and Supplementary Fig. 5A). The islets of DIO βMek1/2DKO mice showed a significantly higher ratio of glucagon (Gcg)+ area to insulin+ area and tended to show higher levels of Gcg and Aristaless-related homeobox (Arx) mRNA expression than those of Tmx control islets (Supplementary Fig. 5B and C). However, the extent of increase in these α-cell markers was reciprocal to the extent of reduction in the insulin+ islet area, suggesting that transdifferentiation of β-cells into α-cells was unlikely to account for the mechanism of lower insulin+ islet area observed in the DIO βMek1/2DKO mouse islets. Thus, these data indicated that the lower insulin secretion in the DIO βMek1/2DKO mice was associated with smaller β-cell mass accompanied by decreased β-cell proliferation compared with that in the Tmx control mice. Consistently with the decreased β-cell proliferation in the DIO βMek1/2DKO mice, RNA-sequencing and real-time PCR analyses revealed that the expression of cyclin D1 (Ccnd1) was lower, and that of cyclin-dependent kinase inhibitor 1a (Cdkn1a, p21) higher, in DIO βMek1/2DKO islets than in those of Tmx controls after as early as 3 weeks of HFD feeding (Fig. 3G and H). These data suggested that Mek1/2 abrogation in β-cells led to dysregulated expressions of cell cycle regulatory genes.

Figure 5

The metabolic features and exocytotic capacity of βMek1/2DKO mice fed NCD. A: Average number of glucose-stimulated exocytotic events of islets of 15-week-old βMek1/2DKO and Tmx control mice fed NCD, as normalized to an arbitrary area (800 μm2) of islets (left), and total number of exocytotic events occurring within 0–5 min and 5–10 min of glucose stimulation (right). *P < 0.05, **P < 0.01, n = 9 islets from two Tmx control mice and 10 islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. B: ATP production per isolated islet of βMek1/2DKO and Tmx control mice on NCD after incubation with 22.2 mmol/L glucose. A total of 40 islets of equivalent size per mouse were divided into two groups and maintained in KRBB with 0.2% BSA supplemented with 2.8 mmol/L glucose for 30 min at 37°C. Subsequently, the islets were incubated for 30 minutes in KRBB with 0.2% BSA containing either 2.8 mmol/L glucose or 22.2 mmol/L glucose. ATP concentration was measured with use of ATPlite (PerkinElmer). Differences between the values of ATP content per islet incubated in 2.8 mmol/L glucose condition and those in 22.2 mmol/L glucose condition are defined as ATP production. **P < 0.01, n = 11–12. All data are represented as means ± SEM. C: Glucose-stimulated Ca2+ influx as measured on a single–β-cell basis with the Ca2+ indicator Fura-2. Maximum rates of change in (F0 − F)/F0 are shown. Fura-2 F values were normalized by their respective F0 values. n = 36 regions of interest for five islets from two Tmx control mice and 43 regions of interest for eight islets from two βMek1/2DKO mice. All data are represented as means ± SEM. D: Alteration of cytosolic Ca2+ concentrations provoked by photolysis of a caged-Ca2+ compound in the islets of 15-week-old βMek1/2DKO and Tmx control mice fed NCD. The average of six regions of interest from one Tmx control islet and the average of six regions of interest from one βMek1/2DKO islet are shown. E: Total number of exocytotic events occurring in the islets on caged Ca2+ stimulation, as normalized to an arbitrary area (800 μm2) of islets. **P < 0.01, n = 10 islets from two Tmx control mice and 10 islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. F and G: The profiles of βMek1/2DKO and Tmx control mice fed NCD; body weight (F) and blood glucose levels (G). n = 7–8. All data are represented as mean ± SEM. H: Plasma insulin concentrations at indicated weeks (w) of age in βMek1/2DKO and Tmx control mice fed NCD. n = 7–9. All data are represented as means ± SEM. I and J: Blood glucose levels after intraperitoneal injection of glucose (2.0 g/kg body wt) in βMek1/2DKO and Tmx control mice fed NCD. n = 7–9. All data are represented as mean ± SEM. K: Plasma insulin concentrations after intraperitoneal injection of glucose (3.0 g/kg body wt) in 12-week-old βMek1/2DKO and Tmx control mice fed NCD. *P < 0.05, n = 12. All data are represented as mean ± SEM. See also Supplementary Figs. 6 and 7. ipGTT, intraperitoneal GTT.

Figure 5

The metabolic features and exocytotic capacity of βMek1/2DKO mice fed NCD. A: Average number of glucose-stimulated exocytotic events of islets of 15-week-old βMek1/2DKO and Tmx control mice fed NCD, as normalized to an arbitrary area (800 μm2) of islets (left), and total number of exocytotic events occurring within 0–5 min and 5–10 min of glucose stimulation (right). *P < 0.05, **P < 0.01, n = 9 islets from two Tmx control mice and 10 islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. B: ATP production per isolated islet of βMek1/2DKO and Tmx control mice on NCD after incubation with 22.2 mmol/L glucose. A total of 40 islets of equivalent size per mouse were divided into two groups and maintained in KRBB with 0.2% BSA supplemented with 2.8 mmol/L glucose for 30 min at 37°C. Subsequently, the islets were incubated for 30 minutes in KRBB with 0.2% BSA containing either 2.8 mmol/L glucose or 22.2 mmol/L glucose. ATP concentration was measured with use of ATPlite (PerkinElmer). Differences between the values of ATP content per islet incubated in 2.8 mmol/L glucose condition and those in 22.2 mmol/L glucose condition are defined as ATP production. **P < 0.01, n = 11–12. All data are represented as means ± SEM. C: Glucose-stimulated Ca2+ influx as measured on a single–β-cell basis with the Ca2+ indicator Fura-2. Maximum rates of change in (F0 − F)/F0 are shown. Fura-2 F values were normalized by their respective F0 values. n = 36 regions of interest for five islets from two Tmx control mice and 43 regions of interest for eight islets from two βMek1/2DKO mice. All data are represented as means ± SEM. D: Alteration of cytosolic Ca2+ concentrations provoked by photolysis of a caged-Ca2+ compound in the islets of 15-week-old βMek1/2DKO and Tmx control mice fed NCD. The average of six regions of interest from one Tmx control islet and the average of six regions of interest from one βMek1/2DKO islet are shown. E: Total number of exocytotic events occurring in the islets on caged Ca2+ stimulation, as normalized to an arbitrary area (800 μm2) of islets. **P < 0.01, n = 10 islets from two Tmx control mice and 10 islets from two βMek1/2DKO mice. All data are represented as mean ± SEM. F and G: The profiles of βMek1/2DKO and Tmx control mice fed NCD; body weight (F) and blood glucose levels (G). n = 7–8. All data are represented as mean ± SEM. H: Plasma insulin concentrations at indicated weeks (w) of age in βMek1/2DKO and Tmx control mice fed NCD. n = 7–9. All data are represented as means ± SEM. I and J: Blood glucose levels after intraperitoneal injection of glucose (2.0 g/kg body wt) in βMek1/2DKO and Tmx control mice fed NCD. n = 7–9. All data are represented as mean ± SEM. K: Plasma insulin concentrations after intraperitoneal injection of glucose (3.0 g/kg body wt) in 12-week-old βMek1/2DKO and Tmx control mice fed NCD. *P < 0.05, n = 12. All data are represented as mean ± SEM. See also Supplementary Figs. 6 and 7. ipGTT, intraperitoneal GTT.

Close modal

The Regulation of Insulin Exocytosis Was Impaired in the β-Cells of DIO βMek1/2DKO Mice

The levels of insulin secretion are determined by both the total amount of pancreatic β-cells and the insulin-secretion capacity of individual pancreatic β-cells (1,2). To assess the insulin-secretion capacity of β-cells in DIO βMek1/2DKO mice, we conducted two-photon excitation imaging analyses of the islets, which allowed for assessment of insulin granule exocytotic events and Ca2+ influx on a single-cell basis (21,30). There was a trend toward lower number of exocytotic events associated with high-glucose stimulation in the DIO βMek1/2DKO mouse islets within 10 min (Fig. 4A), suggesting that the β-cells of the DIO βMek1/2DKO mice may have impairment in their glucose-stimulated insulin secretion (GSIS) response. The insulin content normalized by the number of islets or islet DNA contents were comparable between the DIO βMek1/2DKO islets and Tmx control islets (Supplementary Fig. 6A–C). The assessments of individual β-cells for Ca2+ influx revealed that the levels of Ca2+ influx on glucose stimulation were comparable between the β-cells of DIO βMek1/2DKO mice and those of Tmx controls (Fig. 4B), while the same extent of a large and rapid increase in Ca2+ influx induced by photolysis of a caged-Ca2+ compound (Fig. 4C) (22) led to a markedly lower number of exocytotic events in the βMek1/2DKO mouse islets in comparison with Tmx controls (Fig. 4D).

Figure 6

Phosphoproteomics analyses of pooled islets from βMek1/2DKO and Tmx control mice. A: The workflow of phosphoproteomics with isolated islets. B: Summary of the phosphoproteomics data. C: Volcano plot displaying the distribution of significantly changed phosphosites between the βMek1/2DKO and Tmx control islets. Phosphosites with significantly changed values between βMek1/2DKO and Tmx control islets are highlighted in red (P value <0.05, fold change > 1.5) and blue (P value <0.05, fold change < −1.5). Several proteins with low P values and high absolute fold change values are shown with their gene names and changed phosphosites. n = 3. D: The results of GO analyses of the 190 molecules harboring the 241 sites that were phosphorylated at significantly lower levels in βMek1/2DKO mouse islets than in the Tmx control mouse islets (P value <0.05, fold change < −1.5). Top 10 GO terms in the KEGG_PATHWAY category are shown with raw P values. E: The signal strengths of phosphosites of interest, i.e., SNAP25, PCLO, ITPR3, RAB37, SYTL4, and RIMS2, in islets from βMek1/2DKO and Tmx control mice fed NCD. *P < 0.05, **P < 0.01, n = 3. All data are represented as mean ± SEM. See also Supplementary Fig. 8. LC-MS/MS, liquid chromatography–tandem mass spectrometry.

Figure 6

Phosphoproteomics analyses of pooled islets from βMek1/2DKO and Tmx control mice. A: The workflow of phosphoproteomics with isolated islets. B: Summary of the phosphoproteomics data. C: Volcano plot displaying the distribution of significantly changed phosphosites between the βMek1/2DKO and Tmx control islets. Phosphosites with significantly changed values between βMek1/2DKO and Tmx control islets are highlighted in red (P value <0.05, fold change > 1.5) and blue (P value <0.05, fold change < −1.5). Several proteins with low P values and high absolute fold change values are shown with their gene names and changed phosphosites. n = 3. D: The results of GO analyses of the 190 molecules harboring the 241 sites that were phosphorylated at significantly lower levels in βMek1/2DKO mouse islets than in the Tmx control mouse islets (P value <0.05, fold change < −1.5). Top 10 GO terms in the KEGG_PATHWAY category are shown with raw P values. E: The signal strengths of phosphosites of interest, i.e., SNAP25, PCLO, ITPR3, RAB37, SYTL4, and RIMS2, in islets from βMek1/2DKO and Tmx control mice fed NCD. *P < 0.05, **P < 0.01, n = 3. All data are represented as mean ± SEM. See also Supplementary Fig. 8. LC-MS/MS, liquid chromatography–tandem mass spectrometry.

Close modal

βMek1/2DKO Mice Fed NCD Showed Impaired Insulin Secretion

Interestingly, the lower number of exocytotic events was clearly observed after glucose stimulation in the β-cells of lean βMek1/2DKO mice fed NCD (Fig. 5A). The insulin contents normalized by the number of islets or islet DNA contents were comparable between the DIO βMek1/2DKO islets and Tmx control islets (Supplementary Fig. 6D–F). Also, the βMek1/2DKO and Tmx control mouse islets were comparable in their ATP production on high-glucose stimulation (Fig. 5B). The glucose-stimulated Ca2+ influx was slightly lower in the β-cells of βMek1/2DKO mice than that in Tmx control mice (Fig. 5C), while the provoked Ca2+ influx again led to markedly fewer events of exocytosis in βMek1/2DKO mouse islets than in those of Tmx controls (Fig. 5D and E). The NCD-fed βMek1/2DKO mice also showed a moderate but significant decrease in plasma insulin levels on a glucose challenge at 12 weeks of age than the Tmx control mice, while otherwise no metabolic differences were observed between the groups (Fig. 5F–K and Supplementary Fig. 7A). Plasma human insulin levels after human insulin injection were comparable between the groups, suggesting that insulin clearance was not affected in βMek1/2DKO mice (Supplementary Fig. 7B). Immunohistochemistry analyses showed that the islet areas were comparable between βMek1/2DKO mice and Tmx controls at a younger age and were different only at 23 weeks of age, with a lower distribution of larger islets seen in βMek1/2DKO mice than in Tmx controls (Supplementary Fig. 7C and D). We again ruled out the possible impact of Mek2 deletion alone or Tmx injection per se on the difference in plasma insulin levels on a glucose challenge (Supplementary Fig. 7E–O). Collectively these data suggested that MEK/ERK signaling could play significant roles in the regulation of insulin exocytosis in pancreatic β-cells.

Figure 7

Phosphoproteomics analyses of MINcl4 cells stimulated with glucose. A: Immunoblots of ERK1/2 and phospho-ERK1/2 in MINcl4 cells. MINcl4 cells were maintained in KRBB with 0.2% BSA supplemented with 2.8 mmol/L glucose for 2 h at 37°C. Subsequently, the cells were incubated for indicated times in KRBB with 0.2% BSA containing either 2.8 mmol/L glucose or 22.2 mmol/L glucose. B: In vitro GSIS test performed with MINcl4 cells. MINcl4 cells were maintained in KRBB with 0.2% BSA supplemented with 2.8 mmol/L glucose for 2 h at 37°C. At 30 min before glucose stimulation, U0126 (10 μmol/L) or vehicle (0.1% DMSO) was added to the buffer. The cells were then incubated for 1 h in KRBB with 0.2% BSA containing 2.8 mmol/L glucose or 22.2 mmol/L glucose and U0126 (10 μmol/L) or vehicle (0.1% DMSO). The media were collected after 1 h incubation with glucose. For the insulin content measurement, the insulin was extracted from the islets by overnight incubation with acid ethanol at −20°C. *P < 0.05, **P < 0.01, n = 8. All data are represented as mean ± SEM. C: The workflow of phosphoproteomics with MINcl4 cells. D: Summary of the phosphoproteomics data. E: The results of GO analyses of the 282 molecules harboring the 373 sites that were phosphorylated at significantly higher levels in HG condition than in LG condition (P value <0.05, fold change > 1.5). Top 10 GO terms in the KEGG_PATHWAY category are shown with raw P values. F: The overlap between the phosphosites with significantly higher phosphorylation levels in HG condition than in LG condition (P value <0.05) and the phosphosites with significantly higher phosphorylation levels in HG condition than in HGi condition (P value <0.05) (upper) and the results of GO analyses of the 112 molecules harboring the 155 phosphosites with significantly higher phosphorylation levels in HG condition than in both LG and HGi conditions (P value <0.05). Top 10 GO terms in the KEGG_PATHWAY category were shown with raw P values (lower). G: The signal strength of ERK1T203, ERK1Y205, ERK1T203, Y205, ERK2T183, ERK2Y185, and ERK2T183, Y185. **P < 0.01, n = 3. All data are represented as means ± SEM. H: The overlap between the 534 phosphosites that were phosphorylated at significantly lower levels in βMek1/2DKO mouse islets than in the Tmx control mouse islets (P value <0.05) and the 155 phosphosites with significantly higher phosphorylation levels in HG condition compared with both LG and HGi conditions (P value <0.05). See also Supplementary Fig. 9 and Supplementary Table 2. hr., hour; LC-MS/MS, liquid chromatography–tandem mass spectrometry; p, phosphorylated.

Figure 7

Phosphoproteomics analyses of MINcl4 cells stimulated with glucose. A: Immunoblots of ERK1/2 and phospho-ERK1/2 in MINcl4 cells. MINcl4 cells were maintained in KRBB with 0.2% BSA supplemented with 2.8 mmol/L glucose for 2 h at 37°C. Subsequently, the cells were incubated for indicated times in KRBB with 0.2% BSA containing either 2.8 mmol/L glucose or 22.2 mmol/L glucose. B: In vitro GSIS test performed with MINcl4 cells. MINcl4 cells were maintained in KRBB with 0.2% BSA supplemented with 2.8 mmol/L glucose for 2 h at 37°C. At 30 min before glucose stimulation, U0126 (10 μmol/L) or vehicle (0.1% DMSO) was added to the buffer. The cells were then incubated for 1 h in KRBB with 0.2% BSA containing 2.8 mmol/L glucose or 22.2 mmol/L glucose and U0126 (10 μmol/L) or vehicle (0.1% DMSO). The media were collected after 1 h incubation with glucose. For the insulin content measurement, the insulin was extracted from the islets by overnight incubation with acid ethanol at −20°C. *P < 0.05, **P < 0.01, n = 8. All data are represented as mean ± SEM. C: The workflow of phosphoproteomics with MINcl4 cells. D: Summary of the phosphoproteomics data. E: The results of GO analyses of the 282 molecules harboring the 373 sites that were phosphorylated at significantly higher levels in HG condition than in LG condition (P value <0.05, fold change > 1.5). Top 10 GO terms in the KEGG_PATHWAY category are shown with raw P values. F: The overlap between the phosphosites with significantly higher phosphorylation levels in HG condition than in LG condition (P value <0.05) and the phosphosites with significantly higher phosphorylation levels in HG condition than in HGi condition (P value <0.05) (upper) and the results of GO analyses of the 112 molecules harboring the 155 phosphosites with significantly higher phosphorylation levels in HG condition than in both LG and HGi conditions (P value <0.05). Top 10 GO terms in the KEGG_PATHWAY category were shown with raw P values (lower). G: The signal strength of ERK1T203, ERK1Y205, ERK1T203, Y205, ERK2T183, ERK2Y185, and ERK2T183, Y185. **P < 0.01, n = 3. All data are represented as means ± SEM. H: The overlap between the 534 phosphosites that were phosphorylated at significantly lower levels in βMek1/2DKO mouse islets than in the Tmx control mouse islets (P value <0.05) and the 155 phosphosites with significantly higher phosphorylation levels in HG condition compared with both LG and HGi conditions (P value <0.05). See also Supplementary Fig. 9 and Supplementary Table 2. hr., hour; LC-MS/MS, liquid chromatography–tandem mass spectrometry; p, phosphorylated.

Close modal

Phosphoproteomic Analyses Revealed Altered Phosphorylated Protein Levels in βMek1/2DKO Mouse Islets Compared With Those of Tmx Control Mice

We next explored the molecular mechanism(s) whereby Mek1/2 abrogation led to a lower number of exocytotic events in β-cells. First, in order to assess the downstream targets of MEK/ERK signaling in β-cells, we compared phosphoproteome of βMek1/2DKO mouse islets versus those of Tmx control mice fed NCD (Fig. 6A). We identified 10,886 phosphosites in 3,718 proteins (Fig. 6B and C). In gene ontology (GO) analyses (31), the genes with the GO term “insulin secretion” were highly enriched in the 190 molecules harboring the 241 sites that were phosphorylated at significantly lower levels in βMek1/2DKO mouse islets than in the Tmx control mouse islets (P value <0.05, fold change < −1.5) (Fig. 6D), with the phosphorylation sites of exocytosis-regulating proteins SNAP25, PCLO, ITPR3, RAB37, SYTL4, and RIMS2 being significantly less phosphorylated (Fig. 6E). Gene expression analysis showed no differences between the groups in these molecules and those established to be involved in exocytosis of insulin granules such as STX1A, VAMP2, or a dock protein, RAB27A (32) (Supplementary Fig. 8A). In addition, the genes with GO terms related to cytoskeleton were highly enriched in the less phosphorylated proteins in βMek1/2DKO mouse islets compared with Tmx controls (Fig. 6D and Supplementary Fig. 8B), among which molecules, such as MARCKS, MAPT, and MAP2, have been reported to be involved in exocytosis of insulin or other secretory granules (3335). Thus, these results suggested the possibility that the MEK/ERK pathway regulated insulin secretion through dynamic changes in phosphorylation status of exocytosis-regulating molecules including cytoskeleton–related molecules in pancreatic β-cells.

Acute Stimulation by Glucose Dynamically Changed Phosphorylation Status of Cytoskeleton–Related Proteins Through MEK/ERK Signaling in MINcl4 Cells

Finally, we attempted to elucidate the possible upstream signaling responsible for MEK/ERK activation in β-cells. According to previous reports, glucose stimulation of β-cells causes phosphorylation of ERK1/2 in minutes (10,36), as we confirmed in the MINcl4 β-cell line (Fig. 7A). Moreover, pretreatment of MINcl4 cells with MEK inhibitor U0126 led to a decrease in their GSIS response (Fig. 7B), as already reported (37). Collectively with the results from our in vivo models, these data prompted us to hypothesize that glucose stimulation activated MEK/ERK signaling, which in turn caused phosphorylation of GSIS-related molecules and thereby impinged on GSIS response. To test the hypothesis, we compared phosphoproteomic profiles of MINcl4 cells cultured in low concentration of glucose (LG) with those stimulated with 22.2 mmol/L glucose for 5 min in absence or presence of U0126 (HG or HGi) (Fig. 7C). We identified 12,168 phosphosites in 3,589 proteins in total (Fig. 7D). GO analyses of the 282 molecules harboring the 373 sites that were phosphorylated at significantly higher levels in HG condition than in LG condition (P value <0.05, fold change >1.5) demonstrated that the MAPK signaling pathway was a main signaling pathway regulated by acute glucose stimulation (Fig. 7E and Supplementary Fig. 9A). A total of 155 phosphosites were phosphorylated at significantly higher levels in HG condition in comparison with both LG and HGi conditions (P value <0.05) (Fig. 7F). We considered them as the phosphosites regulated by glucose stimulation in a MEK/ERK signaling–dependent manner, which included ERK1T203, ERK1Y205, ERK2T183, and ERK2Y185 residues (Fig. 7G). GO analyses of the 112 molecules harboring these 155 phosphosites showed high enrichment of GO terms related to cytoskeleton (Fig. 7F and Supplementary Fig. 9B). Between the phosphosites showing less phosphorylation in the βMek1/2DKO islets than in the Tmx control mouse islets (P value < 0.05) and those showing higher phosphorylation in HG condition in comparison with LG and HGi conditions in MINcl4 cell (P value < 0.05), we found in common 21 sites of 15 proteins (Fig. 7H and Supplementary Table 2). Collectively, these data suggested that glucose was a potential stimulant causing MEK/ERK-mediated phospholyrations in β-cells, which could regulate GSIS response.

To date, several genetic factors have been suggested to cause maladaptation of β-cells leading to insufficient insulin production in the pathogenesis of diabetes, while its exact molecular mechanisms remain unclear (2).

We began by investigating the islets of murine type 2 diabetic models and found reductions in the levels of ERK1/2 phosphorylation in the islets of db/db mice, which were associated with a progressive decline in their plasma insulin levels as they grew. In contrast, the levels of ERK1/2 phosphorylation were not reduced, or remained even higher, in the islets of DIO mice, where only mild hyperglycemia was observed with relatively maintained plasma insulin levels. Of note, the mechanism causing the observed differences in phosphorylation levels of ERK1/2 and MEK1/2 in the islets of different mouse models is unclear, while there could be composite mechanisms reflected in the differences in the levels of responsible humoral factors, potentially including insulin, or in the cellular sensitivity to these stimuli, leading to the altered activation status of the signaling cascade.

While we found that MEK/ERK signaling is necessary for adaptive hyperplasia of β-cells in obesity, it is reported that obesity in humans only leads to a mild increase in β-cell mass compared with mouse models (1). Interestingly, however, a cohort of nonobese patients with type 2 diabetes showed lower proportion of phospho-ERK1/2+ cells in insulin+ cells with lower Vβ compared with subjects without diabetes. As βMek1/2DKO mice on NCD showed significantly lower islet area at 23 weeks of age, it is plausible that MEK/ERK signaling is required not only for adaptive β-cell hyperplasia in obesity but also for maintenance of β-cell mass under lean conditions, where the defects of MEK/ERK signaling could lead to hyperglycemia due to insulin insufficiency. In support of the MEK/ERK involvements in human diabetes pathogenesis, several genome-wide association studies showed an association between type 2 diabetes and a single nucleotide polymorphism (SNP) (rs5945326) near dual-specificity phosphatase 9 (DUSP9), an ERK-selective cytoplasmic phosphatase, in different ancestries (3840). Other SNPs, SNP rs1894299 on DUSP9 and SNP rs9648716 on BRAF, a kinase upstream for MEK1/2, are also reported to be associated with type 2 diabetes (41,42).

To determine the functional significance of MEK/ERK signaling in β-cells, we created a murine model with Mek1/2 abrogation and investigated its metabolic phenotypes. Our analyses collectively underscored the importance of MEK/ERK signaling–mediated cell proliferation in compensatory β-cell expansion under insulin-resistant conditions, which is plausible in light of the well-established roles that MEK/ERK signaling plays in cell proliferation (3). On the other hand, our data also indicate a significant role that MEK/ERK signaling plays in GSIS response, as revealed by the lower plasma insulin levels on a glucose challenge with comparable insulin sensitivity and the lower numbers of exocytotic events in two-photon excitation microscopy analyses in the islets of βMek1/2DKO mice. Of note, our analyses indicated impairment in the regulation of exocytosis machinery downstream of the Ca2+ influx in the β-cells of βMek1/2DKO mice. It has been suggested that reorganization of the actin cytoskeletal network is required for insulin granules to properly access cellular membrane in both the first and second phases of GSIS response (43,44). Our phosphoproteomics analyses of the isolated islets from βMek1/2DKO mice showed that the levels of phosphorylation in the proteins related to exocytosis and cytoskeleton were altered on Mek1/2 abrogation, suggesting that MEK/ERK signaling regulates these molecules by altering their phosphorylation levels and thus is involved in proper GSIS response. Additionally, as dramatic changes in cytoskeletal organization are also known to occur during mitotic processes (45), the MEK/ERK signaling–mediated cytoskeletal modifications could also be a part of mechanisms for cell proliferation regulated by MEK/ERK signaling.

We noticed that 21 sites with significantly higher phosphorylation levels in HG condition than in LG and HGi conditions were also identified in the less phosphorylated phosphosites in βMek1/2DKO islets, whereas the overlap between the phosphosites identified in these two models was not large. These data could be interpreted to indicate that upstream inputs other than glucose could have been involved in the regulation of altered phosphosites detected in the islets, including those derived from the non–β-cell components producing humoral factors in a paracrine manner. Further analyses are needed to fully elucidate the roles that MEK/ERK signaling plays in exocytosis regulation, which will include determining the upstream stimulants as well as the exact substrates of MEK/ERK signaling in β-cells during GSIS response and the significance of such posttranscriptional modifications for the functions of the exocytosis machineries.

Of note, while our experimental design properly controlled the effects of hGH expression from the MIP-Cre/ERT construct (12,13), we could not strictly rule out the possibility that the transient nuclear translocation of Cre/ERT protein could have modified the phenotypes of βMek1/2DKO mice, which is one of the limitations in our study.

Finally, from a therapeutic perspective, our results suggest that activation of the MEK/ERK pathway in pancreatic β-cells may have therapeutic potential for diabetes, in that it is expected to increase β-cell mass and enhance GSIS response at the same time. However, it has been reported that pharmacological inhibition, rather than activation, of MEKs improves glucose homeostasis in diabetic mouse models through control of peroxisome proliferator–activated receptor γ (PPARγ) in adipose tissues, thereby ameliorating insulin resistance (46). Besides, the RAS/RAF/MEK/ERK signaling is one of the major pathways known to be activated through mutations in cancer (47,48). Thus, simply activating MEK/ERK signaling in a systemic manner may have deleterious consequences. Instead, identifying and targeting the responsible mechanisms whereby ERK becomes less phosphorylated in the islets under diabetic conditions may represent a more promising strategy for the development of antidiabetes therapeutics.

Taken together, our data provide evidence that MEK/ERK signaling has bifunctional roles in β-cells in maintaining glucose homeostasis, suggesting that defects in MEK/ERK signaling could contribute to β-cell maladaptation in the pathogenesis of diabetes. Further research targeting the MEK/ERK pathway is required to formulate optimal therapeutic strategies for diabetes.

This article contains supplementary material online at https://doi.org/10.2337/figshare.14473791.

Acknowledgments. The authors thank Dr. H. Ishihara (Nihon University School of Medicine) for providing MIN6 clone 4 cell lines. The authors also greatly appreciate the technical support of Dr. W. Nishimura (International University of Health and Welfare Graduate School) in delivering embryonic pancreases. The authors’ thanks are also due to M. Nakano and T. Oyama for assistance in immunohistochemistry as well as F. Takahashi, Y. Masaki, and R. Honma for technical assistance.

Funding. This work was supported by Japan Society for the Promotion of Science KAKENHI grants JP16K19067 (to Y.M.I.) and JP19K16547 (to Y.M.I.) and National Center for Global Health and Medicine grants 29-1021 (to Y.M.I.) and 20A1011 (to Y.M.I.).

Duality of Interest. M.M. is supported by LSI Medience Corporation through the cross-appointment system of University of Tsukuba. No other potential conflicts of interest relevant to this article were reported.

Author Contributions. Y.M.I. organized and performed the experiments, wrote the manuscript, and secured funding. K.U. conceptualized, organized, and wrote the manuscript and secured funding. M.A. organized and wrote the manuscript. N.K., S.O., S.T., H.S., and K.S. performed the experiments. H.K. provided expertise and analyzed the study data. J.A. performed phosphoproteomics analyses. M.M. performed transcriptomic analyses. H.M. provided human data. Y.M. and N.T. performed two-photon excitation imaging analyses. J.C. provided mouse strains. All authors reviewed, edited, and approved the manuscript. K.U. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

1.
Weir
GC
,
Bonner-Weir
S
.
Islet β cell mass in diabetes and how it relates to function, birth, and death
.
Ann N Y Acad Sci
2013
;
1281
:
92
105
2.
Kahn
SE
,
Hull
RL
,
Utzschneider
KM
.
Mechanisms linking obesity to insulin resistance and type 2 diabetes
.
Nature
2006
;
444
:
840
846
3.
Wortzel
I
,
Seger
R
.
The ERK cascade: distinct functions within various subcellular organelles
.
Genes Cancer
2011
;
2
:
195
209
4.
Sidarala
V
,
Kowluru
A
.
The regulatory roles of mitogen-activated protein kinase (MAPK) pathways in health and diabetes: lessons learned from the pancreatic β-cell
.
Recent Pat Endocr Metab Immune Drug Discov
2017
;
10
:
76
84
5.
Aoidi
R
,
Maltais
A
,
Charron
J
.
Functional redundancy of the kinases MEK1 and MEK2: rescue of the Mek1 mutant phenotype by Mek2 knock-in reveals a protein threshold effect
.
Sci Signal
2016
;
9
:
ra9
6.
Gehart
H
,
Kumpf
S
,
Ittner
A
,
Ricci
R
.
MAPK signalling in cellular metabolism: stress or wellness?
EMBO Rep
2010
;
11
:
834
840
7.
Ueki
K
,
Okada
T
,
Hu
J
, et al
.
Total insulin and IGF-I resistance in pancreatic beta cells causes overt diabetes
.
Nat Genet
2006
;
38
:
583
588
8.
Lawrence
M
,
Shao
C
,
Duan
L
,
McGlynn
K
,
Cobb
MH
.
The protein kinases ERK1/2 and their roles in pancreatic beta cells
.
Acta Physiol (Oxf)
2008
;
192
:
11
17
9.
Chen
H
,
Gu
X
,
Liu
Y
, et al
.
PDGF signalling controls age-dependent proliferation in pancreatic β-cells
.
Nature
2011
;
478
:
349
355
10.
Assmann
A
,
Ueki
K
,
Winnay
JN
,
Kadowaki
T
,
Kulkarni
RN
.
Glucose effects on beta-cell growth and survival require activation of insulin receptors and insulin receptor substrate 2
.
Mol Cell Biol
2009
;
29
:
3219
3228
11.
Burns
CJ
,
Squires
PE
,
Persaud
SJ
.
Signaling through the p38 and p42/44 mitogen-activated families of protein kinases in pancreatic beta-cell proliferation
.
Biochem Biophys Res Commun
2000
;
268
:
541
546
12.
Oropeza
D
,
Jouvet
N
,
Budry
L
, et al
.
Phenotypic characterization of MIP-CreERT1Lphi mice with transgene-driven islet expression of human growth hormone
.
Diabetes
2015
;
64
:
3798
3807
13.
Brouwers
B
,
de Faudeur
G
,
Osipovich
AB
, et al
.
Impaired islet function in commonly used transgenic mouse lines due to human growth hormone minigene expression
.
Cell Metab
2014
;
20
:
979
990
14.
Yamato
E
,
Tashiro
F
,
Miyazaki
J
.
Microarray analysis of novel candidate genes responsible for glucose-stimulated insulin secretion in mouse pancreatic β cell line MIN6
.
PLoS One
2013
;
8
:
e61211
15.
Kaneko
K
,
Ueki
K
,
Takahashi
N
, et al
.
Class IA phosphatidylinositol 3-kinase in pancreatic β cells controls insulin secretion by multiple mechanisms
.
Cell Metab
2010
;
12
:
619
632
16.
Mitok
KA
,
Freiberger
EC
,
Schueler
KL
, et al
.
Islet proteomics reveals genetic variation in dopamine production resulting in altered insulin secretion
.
J Biol Chem
2018
;
293
:
5860
5877
17.
Ueki
K
,
Yamauchi
T
,
Tamemoto
H
, et al
.
Restored insulin-sensitivity in IRS-1-deficient mice treated by adenovirus-mediated gene therapy
.
J Clin Invest
2000
;
105
:
1437
1445
18.
Sakuraba
H
,
Mizukami
H
,
Yagihashi
N
,
Wada
R
,
Hanyu
C
,
Yagihashi
S
.
Reduced beta-cell mass and expression of oxidative stress-related DNA damage in the islet of Japanese type II diabetic patients
.
Diabetologia
2002
;
45
:
85
96
19.
Mizukami
H
,
Takahashi
K
,
Inaba
W
, et al
.
Involvement of oxidative stress-induced DNA damage, endoplasmic reticulum stress, and autophagy deficits in the decline of β-cell mass in Japanese type 2 diabetic patients
.
Diabetes Care
2014
;
37
:
1966
1974
20.
Morito
N
,
Yoh
K
,
Usui
T
, et al
.
Transcription factor MafB may play an important role in secondary hyperparathyroidism
.
Kidney Int
2018
;
93
:
54
68
21.
Takahashi
N
,
Kishimoto
T
,
Nemoto
T
,
Kadowaki
T
,
Kasai
H
.
Fusion pore dynamics and insulin granule exocytosis in the pancreatic islet
.
Science
2002
;
297
:
1349
1352
22.
Takahashi
N
,
Hatakeyama
H
,
Okado
H
, et al
.
Sequential exocytosis of insulin granules is associated with redistribution of SNAP25
.
J Cell Biol
2004
;
165
:
255
262
23.
Abe
Y
,
Hirano
H
,
Shoji
H
, et al
.
Comprehensive characterization of the phosphoproteome of gastric cancer from endoscopic biopsy specimens
.
Theranostics
2020
;
10
:
2115
2129
24.
Adachi
J
,
Hashiguchi
K
,
Nagano
M
, et al
.
Improved proteome and phosphoproteome analysis on a cation exchanger by a combined acid and salt gradient
.
Anal Chem
2016
;
88
:
7899
7903
25.
Lee
GH
,
Proenca
R
,
Montez
JM
, et al
.
Abnormal splicing of the leptin receptor in diabetic mice
.
Nature
1996
;
379
:
632
635
26.
Hull
RL
,
Kodama
K
,
Utzschneider
KM
,
Carr
DB
,
Prigeon
RL
,
Kahn
SE
.
Dietary-fat-induced obesity in mice results in beta cell hyperplasia but not increased insulin release: evidence for specificity of impaired beta cell adaptation
.
Diabetologia
2005
;
48
:
1350
1358
27.
Dalbøge
LS
,
Almholt
DL
,
Neerup
TS
, et al
.
Characterisation of age-dependent beta cell dynamics in the male db/db mice
.
PLoS One
2013
;
8
:
e82813
28.
Boucherat
O
,
Nadeau
V
,
Bérubé-Simard
FA
,
Charron
J
,
Jeannotte
L
.
Crucial requirement of ERK/MAPK signaling in respiratory tract development
.
Development
2014
;
141
:
3197
3211
29.
Talchai
C
,
Xuan
S
,
Lin
HV
,
Sussel
L
,
Accili
D
.
Pancreatic β cell dedifferentiation as a mechanism of diabetic β cell failure
.
Cell
2012
;
150
:
1223
1234
30.
Takahashi
N
,
Sawada
W
,
Noguchi
J
, et al
.
Two-photon fluorescence lifetime imaging of primed SNARE complexes in presynaptic terminals and β cells
.
Nat Commun
2015
;
6
:
8531
31.
Huang
W
,
Sherman
BT
,
Lempicki
RA
.
Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources
.
Nat Protoc
2009
;
4
:
44
57
32.
Rorsman
P
,
Ashcroft
FM
.
Pancreatic β-cell electrical activity and insulin secretion: of mice and men
.
Physiol Rev
2018
;
98
:
117
214
33.
Trexler
AJ
,
Taraska
JW
.
Regulation of insulin exocytosis by calcium-dependent protein kinase C in beta cells
.
Cell Calcium
2017
;
67
:
1
10
34.
Maj
M
,
Hoermann
G
,
Rasul
S
,
Base
W
,
Wagner
L
,
Attems
J
.
The microtubule-associated protein tau and its relevance for pancreatic beta cells
.
J Diabetes Res
2016
;
2016
:
1964634
35.
Anhê
GF
,
Torrão
AS
,
Nogueira
TC
, et al
.
ERK3 associates with MAP2 and is involved in glucose-induced insulin secretion
.
Mol Cell Endocrinol
2006
;
251
:
33
41
36.
Khoo
S
,
Cobb
MH
.
Activation of mitogen-activating protein kinase by glucose is not required for insulin secretion
.
Proc Natl Acad Sci U S A
1997
;
94
:
5599
5604
37.
Dioum
EM
,
Osborne
JK
,
Goetsch
S
,
Russell
J
,
Schneider
JW
,
Cobb
MH
.
A small molecule differentiation inducer increases insulin production by pancreatic β cells
.
Proc Natl Acad Sci U S A
2011
;
108
:
20713
20718
38.
Li
H
,
Gan
W
,
Lu
L
, et al.;
DIAGRAM Consortium
;
AGEN-T2D Consortium
.
A genome-wide association study identifies GRK5 and RASGRP1 as type 2 diabetes loci in Chinese Hans
.
Diabetes
2013
;
62
:
291
298
39.
Hara
K
,
Fujita
H
,
Johnson
TA
, et al.;
DIAGRAM Consortium
.
Genome-wide association study identifies three novel loci for type 2 diabetes
.
Hum Mol Genet
2014
;
23
:
239
246
40.
Voight
BF
,
Scott
LJ
,
Steinthorsdottir
V
, et al.;
MAGIC investigators
;
GIANT Consortium
.
Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis
.
Nat Genet
2010
;
42
:
579
589
41.
Suzuki
K
,
Akiyama
M
,
Ishigaki
K
, et al
.
Identification of 28 new susceptibility loci for type 2 diabetes in the Japanese population
.
Nat Genet
2019
;
51
:
379
386
42.
Zhao
W
,
Rasheed
A
,
Tikkanen
E
, et al.;
CHD Exome+ Consortium
;
EPIC-CVD Consortium
;
EPIC-Interact Consortium
;
Michigan Biobank
.
Identification of new susceptibility loci for type 2 diabetes and shared etiological pathways with coronary heart disease
.
Nat Genet
2017
;
49
:
1450
1457
43.
Arous
C
,
Halban
PA
.
The skeleton in the closet: actin cytoskeletal remodeling in β-cell function
.
Am J Physiol Endocrinol Metab
2015
;
309
:
E611
E620
44.
Hoboth
P
,
Müller
A
,
Ivanova
A
, et al
.
Aged insulin granules display reduced microtubule-dependent mobility and are disposed within actin-positive multigranular bodies
.
Proc Natl Acad Sci U S A
2015
;
112
:
E667
E676
45.
Kunda
P
,
Baum
B
.
The actin cytoskeleton in spindle assembly and positioning
.
Trends Cell Biol
2009
;
19
:
174
179
46.
Banks
AS
,
McAllister
FE
,
Camporez
JP
, et al
.
An ERK/Cdk5 axis controls the diabetogenic actions of PPARγ
.
Nature
2015
;
517
:
391
395
47.
Roberts
PJ
,
Der
CJ
.
Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer
.
Oncogene
2007
;
26
:
3291
3310
48.
Iezzi
A
,
Caiola
E
,
Scagliotti
A
,
Broggini
M
.
Generation and characterization of MEK and ERK inhibitors- resistant non-small-cells-lung-cancer (NSCLC) cells
.
BMC Cancer
2018
;
18
:
1028
49.
Tamarina
NA
,
Roe
MW
,
Philipson
L
.
Characterization of mice expressing Ins1 gene promoter driven CreERT recombinase for conditional gene deletion in pancreatic β-cells
.
Islets
2014
;
6
:
e27685
50.
Bélanger
LF
,
Roy
S
,
Tremblay
M
, et al
.
Mek2 is dispensable for mouse growth and development
.
Mol Cell Biol
2003
;
23
:
4778
4787
51.
Bissonauth
V
,
Roy
S
,
Gravel
M
,
Guillemette
S
,
Charron
J
.
Requirement for Map2k1 (Mek1) in extra-embryonic ectoderm during placentogenesis
.
Development
2006
;
133
:
3429
3440
Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered. More information is available at https://www.diabetesjournals.org/content/license.