Nonalcoholic fatty liver disease (NAFLD) is an independent predictor of systemic insulin resistance and type 2 diabetes mellitus (T2DM). However, converse correlates between excess liver fat content and β-cell function remain equivocal. Specifically, how the accumulation of liver fat consequent to the enhanced de novo lipogenesis (DNL) leads to pancreatic β-cell failure and eventually to T2DM is elusive. Here, we have identified that low-molecular-weight calcium-binding protein S100A6, or calcyclin, inhibits glucose-stimulated insulin secretion (GSIS) from β cells through activation of the receptor for the advanced glycation end products and diminution of mitochondrial respiration. Serum S100A6 level is elevated both in human patients with NAFLD and in a high-fat diet–induced mouse model of NAFLD. Although serum S100A6 levels are negatively associated with β-cell insulin secretory capacity in human patients, depletion of hepatic S100A6 improves GSIS and glycemia in mice, suggesting that S100A6 contributes to the pathophysiology of diabetes in NAFLD. Moreover, transcriptional induction of hepatic S100A6 is driven by the potent regulator of DNL, carbohydrate response element-binding protein (ChREBP), and ectopic expression of ChREBP in the liver suppresses GSIS in a S100A6-sensitive manner. Together, these data suggest elevated serum levels of S100A6 may serve as a biomarker in identifying patients with NAFLD with a heightened risk of developing β-cell dysfunction. Overall, our data implicate S100A6 as, to our knowledge, a hitherto unknown hepatokine to be activated by ChREBP and that participates in the hepato-pancreatic communication to impair insulin secretion and drive the development of T2DM in NAFLD.

Lipotoxicity due to an imbalance of de novo lipogenesis (DNL) and lipid disposal coupled to systemic insulin resistance are crucial pathological events in nonalcoholic fatty liver disease (NAFLD) (1,2). Type 2 diabetes mellitus (T2DM) and NAFLD are often closely associated with driving synergistic adverse outcomes (35), and a two- to fourfold increase in the risk of incidence of T2DM in the NAFLD population has been documented (6). Thus, within a multiorgan framework, hepato-pancreatic crosstalk in meditating systemic glucose homeostasis and insulin sensitivity in metabolic diseases is being explored (710). Recent studies have underscored the importance of secreted bioactive peptides/proteins or hepatokines, including fetuin-A, FGF-21, and kisspeptin, in regulating pancreatic β-cell growth and function (1114). However, much remains unknown about the contribution of lipid stress-induced secretion of dysregulated hepatokines in the alteration of hepato-pancreatic communication and resulting in glucose intolerance and diabetes.

The Ca2+-binding S100 protein family of damage-associated molecular patterns mediates cellular response in multiple diseases, including cancer, NAFLD, hepatic fibrosis, coronary artery disease, and inflammatory and rheumatic diseases (15). By binding to a wide range of membrane receptors, proteins in this family modulate signal transduction, Ca2+ sensing, and extracellular factors. Notably, S100A8/A9 acts as a TLR4 ligand that triggers a signaling cascade modulating inflammation, cell proliferation, cellular metabolism, differentiation, and tumor development via nuclear factor-κB activation (16). S100A4, S100A8/9, S100A11, and S100A12 are upregulated in the synovial tissue, synovial fluid, or serum of patients with rheumatoid arthritis (17,18). In the liver, S100A11 regulates lipid metabolism through the receptor for the advanced glycation end products (RAGE)–mediated AKT-mTOR signaling pathway, and S100A14 may be a diagnostic marker for hepatocellular carcinoma (HCC) and its progression (16,19).

Our aim here was to explore the pathophysiological relevance of S100A6 protein in fatty liver–associated metabolic stress. In this study, we depleted hepatic S100A6 to explore the function of S100A6 in hepato-islet communication in dietary and genetic mice models of NAFLD, and we also surveyed S100A6 levels in the serum of human patients with NAFLD. We show that S100A6 expression is increased in serum of patients with NAFLD, and ChREBP regulates hepatic S100A6 expression, and suggest S100A6 antagonism improves glucose-stimulated insulin secretion (GSIS) and glycemia in NAFLD. Thus, we provide evidence that hepatic S100A6 is a messenger protein mediating, to our knowledge, a heretofore unknown interorgan communication between liver and pancreas upon intrahepatic lipid stress.

Human Patients

For this study, conducted in the Department of Hepatology, Institute of Postgraduate Medical Education and Research (IPGME&R), Kolkata, India, 28 patients with biopsy-proven NAFLD and 20 individuals without NAFLD (healthy control participants) were recruited. NAFLD was diagnosed according to histopathological parameters, including steatosis, hepatocellular ballooning, lobular inflammation, and stage of fibrosis (20), and the NAFLD activity score was calculated by one liver pathologist. Fasting blood samples were collected from both healthy control participants and patients with NAFLD. The bioclinical parameters included levels of plasma glucose, insulin, total cholesterol and triglycerides, serum aspartate aminotransferase, alanine aminotransferase, which were measured according to the manufacturer’s protocol. HOMA was performed to calculate HOMA for insulin resistance (HOMA-IR) and HOMA-β for β-cell function. HOMA-IR was calculated as (fasting insulin × fasting glucose)/22.5; and HOMA-β was calculated as (20 × fasting insulin)/(fasting glucose − 3.5). Plasma levels of S100A6 were measured using a commercially available ELISA kit according to the manufacturer’s protocol (ABclonal). The study was approved by the human ethics committee of IPGME&R hospital, and all the volunteers gave written informed consent.

Animal Experiments

All experiments were approved by the Institutional Animal Ethics Committee at the Council of Scientific and Industrial Research–Indian Institute of Chemical Biology, approved by the Committee for Control and Supervision of Experiments on Animals, the Ministry of Environment and Forest, and the Government of India. C57BL/6 male mice, 6–8 weeks old, were housed in a 12 h light/dark cycle at 22 ± 1°C with free access to food and water. Mice were fed a 60% high-fat diet (20% protein, 60% fat, 20% carbohydrate, and with energy density of 5.21% Kcal/g; D12492; Research Diets) for 8 weeks. For each in vivo experiment, mouse cohorts were randomized, then followed by the respective treatment of adenoviruses for both ChREBP and shS100A6 via intravenous injections.

Adenovirus Preparation

The recombinant adenovirus containing the shRNA construct for S100A6 was generated by BLOCK-iT Adenoviral Expression System (Invitrogen) using the sequence GGACCGTAACAAGGATCAGGA, following the manufacturer’s instructions. Recombinant adenoviruses were purified using PureVirus Adenovirus Purification Kit (Cell Biolabs Inc.) and administered through tail-vein injection at a titer of 2.5 × 1012 pfu/mouse.

Oral Glucose and Intraperitoneal Insulin Tolerance Tests

Oral glucose tolerance tests (OGTTs) and intraperitoneal insulin tolerance tests (ITTs) were performed per the previously described protocol by Mouse Metabolic Phenotyping Centers (23). For the OGTT, mice were fasted for 12 h and the fed glucose (2 g/kg). For ITTs, insulin (0.5 IU/kg body weight; Actrapid, Novo Nordisk) was intraperitoneally injected after 6 h fasting; mice had free access to water. Fasting blood glucose levels were detected at 30, 60, 90, and 120 min after injection from the tail-tip cut with a glucometer (Accu-Check Aviva).

Pancreatic Islet Isolation

The pancreas was inflated with 3 mL of collagenase P solution (Roche; 1 mg/mL in Hanks’ balanced salt solution) and excised and digested in a water bath at 37°C for 30 min. After digestion, islets were washed three times with cold Hanks’ balanced salt solution and cultured overnight in RPMI 1640 medium supplemented with 10% FBS, glucose (5.5 mmol/L), penicillin (100 U/mL), and streptomycin (100 U/mL) (HiMedia). On the following day, after dithizone staining, isolated islets (20/well) were handpicked in a 24 well plate under a stereoscopic microscope with the aid of a pipette and transferred to RPMI 1640 medium for further biochemical analysis.

Glucose-Stimulated Insulin Secretion

Islets were incubated in 500 µL of Krebs buffer (118 mmol/L NaCl, 4.7 mmol/L KCl, 1.2 mmol/L KH2PO4, 1.2 mmol/L MgSO4, 4.2 mmol/L NaHCO3, 2 mmol/L CaCl2, and 10 mmol/L HEPES, 0.1% (w/v) BSA, pH 7.4) containing 2.8 mmol/L glucose for 1 h at 37°C. Islets were then further incubated for 1 h in 200 µL Krebs buffer containing 2.8 mmol/L or 16.7 mmol/L glucose. After incubation, insulin concentrations in the medium were measured by ELISA (RayBioMouse Insulin Elisa Kit) and were normalized by total protein content.

For in vivo GSIS, mice were weighed at the start of the experiment, blood was collected from the tail vein, and 2 mg/kg body weight glucose was injected intraperitoneally. Blood was collected from the tail vein at 10, 20, 30, and 60 min. ELISA for the measurement of plasma insulin levels was performed using RayBioMouse Insulin Elisa Kit (EML-Insulin).

Immunohistochemistry and Pancreas Morphometrical Analysis

At least three Bouin’s solution–fixed and paraffin-embedded sections per mouse, 100 μm apart, were immunostained for insulin and analyzed for islet/β-cell mass. β-Cell mass for each pancreas was measured as the total β-cell area over the total pancreas area and the pancreas weight before fixation. The β-cell size was calculated by dividing the islet size by the corresponding number of β cells. Imaging was performed on a fluorescence microscope (Zeiss), and images were analyzed with Zeiss imaging software.

Cell Culture

Primary hepatocyte isolation was performed with C57BL/6 male mice (6–8 weeks old) according to the protocol previously described (21) and maintained in Hepatozyme (Gibco Life Technologies) supplemented with l-glutamine and 1% penicillin–streptomycin. Hepatocytes were then treated for 48 or 72 h with adenoviruses at a multiplicity of infection of 40. Human HCC cell-line HepG2 and rat insulinoma INS1 832/13 cells were cultured in, respectively, DMEM–high glucose supplemented with 10% FBS and 1% penicillin–streptomycin and in RPMI medium supplemented with 11 mM glucose, 2 mM l-glutamine, 1 mM sodium pyruvate, 10 mM HEPES, 50 μM β-mercaptoethanol, 10% FBS, and 1% penicillin–streptomycin. Plasmids and the siRNA were transiently transfected using Lipofectamine 3000 and Lipofectamine RNAiMAX reagents, respectively, following the manufacturer’s protocol.

Conditioned Medium Collection and Treatment

Mouse primary hepatocytes were transfected with Ad-EGFP and Ad-ChREBP. After 48 h, cell supernatant was collected and centrifuged to remove the dead cells and cellular debris. Primary islets then were treated with the conditioned medium thus obtained for GSIS assay.

HepG2 was transfected with plasmid-cloning DNA (pcDNA)–enhanced green fluorescent protein (eGFP) and pcDNA–ChREBP. After 48 h, cell supernatant was collected and centrifuged to remove the dead cells and cellular debris. The conditioned media thus obtained was then treated onto INS1 for GSIS assay and proteomic analysis.

Secretome Analysis

As mentioned, the conditioned medium collected was subjected to peptide and protein analysis. The cell supernatant collected (after overexpression) was treated with 6 M Gn-HCl supplemented with protease inhibitors and then sonicated to break nucleic acids. The supernatant was thus carefully collected after centrifugation and protein concentration was quantified using the bicinchoninic acid assay method. Samples were first reduced with 5 mmol/L tris (2-carboxyethyl) phosphine, further alkylated with 50 mmol/L iodoacetamide, and digested for 16 h at 37°C. Digests were then cleaned using a C18 silica cartridge and dried using a speed vacuum. The dried pellet was resuspended in Buffer A (5% acetonitrile, 0.1% formic acid). The peptide mixtures were analyzed via mass spectrometry using EASY-nLC 1000 system (Thermo Fisher Scientific) coupled to a QExactive mass spectrometer (Thermo Fisher Scientific) equipped with a nanoelectrospray ion source. The peptide mixture was resolved using a 15 cm PicoFrit column (360 µm outer diameter, 75 μm inner diameter, 10 μm tip) filled with 1.8 µm of C18-resin (Dr. Maeisch). The peptides were loaded with Buffer A and eluted with a 0–40% gradient of Buffer B (95% acetonitrile, 0.1% formic acid) at a flow rate of 300 mL/min for 100 min, and then finally equilibrated with Buffer A. Mass spectrometry data were acquired using a data-dependent, top-10 method that dynamically chooses the most abundant precursor ions from the survey scan (300–1650 Th) for higher-energy collisional dissociation fragmentation with dynamic exclusion duration of 60 s. The raw files were processed using Proteome Discoverer (version 2.2) against the Uniprot human database.

Insulin Secretion

INS1 832/13 cells were seeded in a 24 well plate and treated for 14 h with 1:5 diluted conditioned medium (as described previously in RESEARCH DESIGN AND METHODS) in RPMI medium containing 5.5 mM glucose. The cells were then washed with secretion assay buffer (114 mM NaCl, 4.7 mM KCl, 1.2 mM KH2PO4, 1.16 mM MgSO4, 20 mM HEPES, 2.5 mM CaCl2, 0.2% FFA–BSA, pH 7.4) and stimulated with 2.5 mM glucose for 1.5 h and then in 16.7 mM glucose for 1 h. The cell supernatant was then collected so insulin levels could be measured, and cells were harvested for protein extraction. Insulin levels were measured using Rat Insulin ELISA Kit (Thermo) and normalized using total cellular protein.

Quantitative PCR

After 48 h of overexpression, the total cellular RNA was extracted using RNA-Xpress Reagent (Himedia) from cell homogenates. For cDNA preparation using iScript cDNA Synthesis kit (Bio-Rad), 1 μg of RNA was used. The gene expression was measured using SYBR Green (Bio-Rad) in a real-time PCR thermocycler (Bio-Rad) and normalized by b-actin/18S as an internal control, using the comparative cycle threshold method. The primer sequences are listed in the Supplementary Information.

Immunoblotting

Total protein from the cells and tissue was isolated using radioimmunoprecipitation assay buffer supplemented with a 1× protease inhibitor cocktail (Sigma). The protein concentration was quantified using the bicinchoninic acid assay method. The samples were resolved on 10% SDS-PAGE and transferred onto a 0.2-µm polyvinylidene difluoride membrane (Bio-Rad). For immunoblotting, the membrane was blocked with 5% nonfat dry milk in Tris-buffered saline with 0.5% Tween 20 for 1 h, followed by incubation with specific primary antibodies overnight at 4°C and then with respective secondary antibodies for 1 h at room temperature. The signals were detected by chemiluminescence (Clarity ECL reagent, Bio-Rad). Antibodies used in the study are enlisted in the Supplementary Information.

Chromatin Immunoprecipitation

Primary hepatocytes or HepG2 cells were cultured in Hepatozyme (Gibco Life Technologies) or DMEM medium. The assay was performed using an Active Motif kit, strictly following the manufacturer’s protocol. Primer sequences are shared in the Supplementary Information.

Oxygen Consumption Rate

The Seahorse XFp Extracellular Flux Analyzer was used to assess various metabolic parameters of the cellular oxygen consumption rate (OCR) by real-time monitoring. INS-1 832/13 cells were cultured at a density of 15,000 cells/well in RPMI medium containing 11 mM glucose in six wells of Agilent Seahorse XF Cell Culture Microplate. The following day, cells were treated with recombinant S100A6 protein in 5.5 mM glucose-containing RPMI medium for 14 h. Cells were washed with prewarmed Seahorse XF DMEM medium supplemented with 1 mM pyruvate, 2 mM glutamine, and 10 mM glucose (pH 7.4) and incubated in the same medium for 1 h in a non-CO2 incubator. Three baseline measurements were recorded at the start of the assay before the addition of any of the inhibitors. The mitochondrial efficiency of the cells in control and treatment conditions was assessed after injection of specific compounds or inhibitors for ATP-linked respiration (1 uM oligomycin), maximal respiration (1 uM carbonyl cyanide p-trifluoromethoxyphenylhydrazone), and proton leak (0.5 µM antimycin A + 0.5 µM rotenone). The OCR data were plotted as absolute values.

cAMP Assay

The intracellular cAMP levels were measured in islets and in INS-1 cells using a luminescence-based assay from Promega (catalog V1501). The cAMP levels were then measured following the manufacturer’s protocol. The absolute values were plotted as relative luminescence units in GraphPad Prism 8.

ATP Content

ATP content was determined by using the ATP Determination Kit (Thermo Fisher Scientific), and ATP content was determined in terms of luminescence using Synergy 1H Hybrid reader (BioTek). ATP content was normalized to total protein content.

JC-1 Staining

INS1 cells were seeded on a coverslip and allowed to adhere overnight. The cells were then treated with the conditioned media from eGFP and ChREBP-overexpressed HepG2 cells for 14 h and then incubated with the JC-1 dye (5 µM) for 2 h. The cells were then washed with PBS and mounted using DAPI mounting media. The imaging was done using a Zeiss fluorescence microscope.

Human Transcriptome Analysis

For the reanalysis of the human hepatic transcriptome, the fastq samples were mapped to the Homo sapiens GRCm38 genome using STAR (version 2.27.2b) to create bam files and further processed using the Rsamtools, Rsubread, and Genomic Alignments R packages to create the abundance table. The count table was then normalized and differentially abundant genes were identified using the DESeq2 R package. Genes with a greater than twofold change with P < 0.05 and adjusted P < 0.05 were considered significant.

Intracellular Ca2+ Dynamics

The integrated response of glucose-stimulated calcium dynamics in INS1 cells was measured using fluorescent dye Fura-2 AM. Readings (excitation, 340 and 380 nm; emission, 508 nm) were taken at 5 min intervals from the bottom plane for 30 min. For fura 2/iCa2–specific signal, the 340 to 380-nm ratio was calculated.

Statistics

Data are presented as mean ± SEM. Graphpad Prism 8 software was used for statistical analysis. We used t tests and ANOVA as appropriate, followed by Bonferroni post hoc test. P < 0.05 was considered statistically significant. Two-tailed Fisher exact test was performed for contingency table analysis to compute the exact P value.

Data and Resource Availability

All study data are included in the manuscript and/or supporting information.

Circulatory Levels and Hepatic Expressions of S100A6 Are Elevated in Patients With NAFLD and in Preclinical Models of NASH

Hepatokines regulate an array of systemic metabolic functions, including the metabolism of fatty acids, carbohydrates, amino acids, along with the synthesis and secretion of several lipoproteins and hormones (14,22,23). A subgroup of hepatokines, the Ca2+-binding S100A family proteins, performs numerous cellular and molecular functions by regulating calcium balance, hepatocellular apoptosis, energy metabolism, and inflammation. To determine the relevance of S100A proteins in NAFLD, we first examined the expressions of S100A family genes using publicly available hepatic transcriptome data for both healthy people and patients with nonalcoholic steatohepatitis (NASH) (24,25). We found that expressions of three S100A proteins—S100A4, S100A6, and S100A14—were significantly upregulated in the livers of patients with NASH (Fig. 1A). Although S100A4 and S100A14 have already been reported to be associated with hepatic pathologies such as fibrosis and HCC (19,26,27), the role of S100A6 (log2 fold change, 1.2768; adjusted P = 1.16 × 10−8) in NASH and associated metabolic diseases is not known (Fig. 1B). A distinct gain of correlations of S100A6 expression with insulin pathway, fatty acid metabolism, and lipogenesis genes (r < −0.5, r > 0.5) further underscores the importance of S100A6 in NASH (Supplementary Fig. 1A).

Figure 1

Hepatic S100A6 expression and circulatory S100A6 levels are elevated in a mouse model of NAFLD and in patients with NASH. (A) Heat map and list of differentially expressed genes identified from the RNA sequencing of livers from healthy people and patients with NASH. (B) S100A6 transcript abundance in livers from healthy people (n = 14) and patients with NASH (n = 16). (C) Immunoblot analysis of S100A6 levels in plasma from healthy participants and patients with NASH. (D) Negative correlation between plasma S100A6 and HOMA-β of healthy participants (n = 20) and patients with NASH (n = 28). (E) The relative abundance of ChREBP and S100A6 mRNA levels from livers of mice fed a normal chow diet and those with HFD-induced NAFLD (n = 4). (F) Immunoblot analysis of ChREBP and S100A6 from liver lysates and serum of normal diet and HFD-fed mice (n = 5). (G) Schematic representation of the ChORE site on s100a6 promoter (top) and ChREBP occupancy on the ChORE site on the s100a6 promoter in primary hepatocytes after high-glucose stimulation (bottom). (H) ChREBP and S100A6 protein expression in primary hepatocytes after Ad-ChREBP treatment. (I) Immunoblot analysis of ChREBP and S100A6 in livers of Ad-EGFP– and Ad-ChREBP–injected mice (n = 5). The Western blot images were quantified using ImageJ software. Values are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ANOVA followed by Bonferroni’s multiple comparison test. A.U., arbitrary units; ns, not significant.

Figure 1

Hepatic S100A6 expression and circulatory S100A6 levels are elevated in a mouse model of NAFLD and in patients with NASH. (A) Heat map and list of differentially expressed genes identified from the RNA sequencing of livers from healthy people and patients with NASH. (B) S100A6 transcript abundance in livers from healthy people (n = 14) and patients with NASH (n = 16). (C) Immunoblot analysis of S100A6 levels in plasma from healthy participants and patients with NASH. (D) Negative correlation between plasma S100A6 and HOMA-β of healthy participants (n = 20) and patients with NASH (n = 28). (E) The relative abundance of ChREBP and S100A6 mRNA levels from livers of mice fed a normal chow diet and those with HFD-induced NAFLD (n = 4). (F) Immunoblot analysis of ChREBP and S100A6 from liver lysates and serum of normal diet and HFD-fed mice (n = 5). (G) Schematic representation of the ChORE site on s100a6 promoter (top) and ChREBP occupancy on the ChORE site on the s100a6 promoter in primary hepatocytes after high-glucose stimulation (bottom). (H) ChREBP and S100A6 protein expression in primary hepatocytes after Ad-ChREBP treatment. (I) Immunoblot analysis of ChREBP and S100A6 in livers of Ad-EGFP– and Ad-ChREBP–injected mice (n = 5). The Western blot images were quantified using ImageJ software. Values are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ANOVA followed by Bonferroni’s multiple comparison test. A.U., arbitrary units; ns, not significant.

Close modal

Next, we collected blood samples from a cohort patients with biopsy-proven NASH (n = 28) and age- and sex-matched control participants (Table 1). Consistent with the transcriptomic data, we found that circulatory S100A6 levels were considerably increased in patients with NASH (P < 0.001) (Fig. 1C). Interestingly, plasma S100A6 levels were negatively correlated with HOMA-β, representing pancreatic β-cell function, but not with HOMA-IR, representing insulin resistance (Fig. 1D), whereas such correlations were absent in the control group. Collectively, these results indicate that enhanced S100A6 levels in NASH are associated with increased lipogenesis and might adversely affect β-cell function.

Table 1

Baseline characteristics of the study individuals

VariableControl participants (± SD)Patients with NAFLD/NASH (± SD)P value
Sample size (n20 28  
Age (years) 47.8 (± 7.76) 43 (± 12.1) 0.1417 
Sex (male/female) 7/13 12/16 0.5832 
BMI (kg/m226.9 (± 2.09) 26.8 (± 4.01) 0.8440 
Waist circumference (cm) 96.2 (± 6.84) 94.2 (± 9.39) 0.4574 
Triglyceride (mg/dL) 136 (± 64) 187 (± 73.4) 0.0145 
Total cholesterol (mg/dL) 163 (± 47.9) 186 (± 29.7) 0.0630 
FBS (mg/dL) 103 (± 62.5) 98.8 (± 14.8) 0.0021 
Fasting insulin (mmol/L) 17.6 (± 8.59) 15.9 (± 18.1) 0.1317 
ALT (IU/L) 39.55 (± 6.76) 65 (± 47.8) 0.0021 
AST (IU/L) 20.15 (± 4.65) 41.4 (± 27.8) <0.0001 
HOMA-IR 4.14 (± 2.1) 4.09 (± 4.81) 0.1200 
HOMA-β 247 (± 204) 109 (± 62.9) 0.0391 
VariableControl participants (± SD)Patients with NAFLD/NASH (± SD)P value
Sample size (n20 28  
Age (years) 47.8 (± 7.76) 43 (± 12.1) 0.1417 
Sex (male/female) 7/13 12/16 0.5832 
BMI (kg/m226.9 (± 2.09) 26.8 (± 4.01) 0.8440 
Waist circumference (cm) 96.2 (± 6.84) 94.2 (± 9.39) 0.4574 
Triglyceride (mg/dL) 136 (± 64) 187 (± 73.4) 0.0145 
Total cholesterol (mg/dL) 163 (± 47.9) 186 (± 29.7) 0.0630 
FBS (mg/dL) 103 (± 62.5) 98.8 (± 14.8) 0.0021 
Fasting insulin (mmol/L) 17.6 (± 8.59) 15.9 (± 18.1) 0.1317 
ALT (IU/L) 39.55 (± 6.76) 65 (± 47.8) 0.0021 
AST (IU/L) 20.15 (± 4.65) 41.4 (± 27.8) <0.0001 
HOMA-IR 4.14 (± 2.1) 4.09 (± 4.81) 0.1200 
HOMA-β 247 (± 204) 109 (± 62.9) 0.0391 

Data are reported as mean ± SD. FBS, fasting blood glucose.

Toward establishing the causal links between aberrant lipid metabolism and lipogenesis with S100A6 expression, we generated an HFD-induced preclinical model of NAFLD. As shown in Fig. 1E and F, expression of both the S100A6 gene and proteins were upregulated in the liver with a corresponding increase in the serum. Consistently, the expression of glucose-sensing transcription factor and the major driver of hepatic DNL, ChREBP, was also enhanced (Fig. 1E and F). ChREBP often contributes to whole-body energy balance by regulating hepatic expression and secretion of hepatokines (26). In silico prediction of the carbohydrate response element (ChORE) site within the S100A6 promoter indicated ChREBP can potentially bind at 281 bp upstream of the transcription start site (Fig. 1G, top panel).

We next examined whether ChREBP can directly induce hepatic S100A6 expression. Chromatin immunoprecipitation followed by the quantitative PCR analysis of ChoRE revealed a fivefold-enriched glucose-dependent occupancy of ChREBP on the S100A6 promoter in primary hepatocytes and HepG2 cells (Fig. 1G bottom panel, and Supplementary Fig. 1E). In agreement with the chromatin immunoprecipitation results, overexpression of ChREBP, as well as high-glucose treatment, led to robust induction of S100A6 expression in HepG2 cells (Supplementary Fig. 1B). Conversely, siRNA-mediated knockdown of ChREBPα in HepG2 cells significantly suppressed high glucose–dependent, elevated S100A expression (Supplementary Fig. 1C). Knockdown was specific, as reflected on RT-PCR by a significant reduction of ChREBPα expression but not of ChREBPβ expression.

To validate the cell-autonomous effect of ChREBP-induced S100A6 expression, ChREBP was ectopically expressed in primary murine hepatocytes by adenovirus (Ad-ChREBP). As expected, overexpression of ChREBP led to enhanced lipid-droplet accumulation (Supplementary Fig. 1D) with elevated S100A6 protein expression (Fig. 1H). Finally, adenoviral-mediated ChREBP overexpression in the murine liver also significantly induced S100A6 expression (Fig. 1I). Taken together, the data showed serum S100A6 level is increased in patients or experimental animals with NAFLD, and ChREBP regulates hepatic S100A6 expression.

S100A6 Knockdown in ChREBP-Overexpressed Mouse Liver to Restore β-Cell Function

Taking cues from human data on the negative association of S100A6 and HOMA-β, we next examined the contribution of S100A6 in regulating β-cell function in the context of hepatic ChREBP overexpression. To execute this, S100A6 was depleted in the mouse liver by adenovirus (Ad-shS100A6), followed by overexpression of ChREBP (Fig. 2A). As expected, enhanced ChREBP expression led to induction of S100A6, an effect substantially blunted upon S100A6 knockdown (Fig. 2B). S100A6 knockdown also significantly reduced serum S100A6 levels (Fig. 2B). The livers from the Ad-ChREBP group were paler than those of the control (Ad-EGFP) group, depicting significant lipid accumulation, whereas lipid accumulation was modestly recovered in the sh-S100A6 cohort (Fig. 2C, upper panel). Consistently, the liver histology also showed enhanced lipid accumulation in Ad-ChREBP mice, which was somewhat restored upon S100A6 depletion (Fig. 2C, lower panel).

Figure 2

S100A6 knockdown in an Ad-ChREBP-overexpression mice model improves β-cell function. (A) Schematic representation of the ChREBP overexpression and S100A6 knockdown in vivo mice model. (B) Representative immunoblot of ChREBP and S100A6 protein expression in serum and liver protein lysates of Ad-GFP (n = 5), Ad-ChREBP (n = 5), and Ad-ChREBP + Ad-shS100A6 (n = 7) groups. The images were quantified using ImageJ software. (C) Representative morphology of mouse liver from Ad-GFP, Ad-ChREBP, and Ad-ChREBP + Ad-shS100A6 groups (top). Histological analysis of liver tissue sections via H-E staining (bottom). (D) Hepatic triglyceride levels from Ad-GFP, Ad-ChREBP, and Ad-ChREBP + Ad-shS100A6 groups. (E) Mouse body weight after completing the treatment regimen, and liver weight and liver to body weight ratio. (F) Plasma insulin levels during an in vivo GSIS assay as determined by insulin ELISA. Values are expressed as mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001, ANOVA followed by Bonferroni’s multiple comparison test. A.U., arbitrary units; ns, not significant; OE, overexpressed; sh, short hairpin.

Figure 2

S100A6 knockdown in an Ad-ChREBP-overexpression mice model improves β-cell function. (A) Schematic representation of the ChREBP overexpression and S100A6 knockdown in vivo mice model. (B) Representative immunoblot of ChREBP and S100A6 protein expression in serum and liver protein lysates of Ad-GFP (n = 5), Ad-ChREBP (n = 5), and Ad-ChREBP + Ad-shS100A6 (n = 7) groups. The images were quantified using ImageJ software. (C) Representative morphology of mouse liver from Ad-GFP, Ad-ChREBP, and Ad-ChREBP + Ad-shS100A6 groups (top). Histological analysis of liver tissue sections via H-E staining (bottom). (D) Hepatic triglyceride levels from Ad-GFP, Ad-ChREBP, and Ad-ChREBP + Ad-shS100A6 groups. (E) Mouse body weight after completing the treatment regimen, and liver weight and liver to body weight ratio. (F) Plasma insulin levels during an in vivo GSIS assay as determined by insulin ELISA. Values are expressed as mean ± SEM, *P < 0.05, **P < 0.01, ***P < 0.001, ANOVA followed by Bonferroni’s multiple comparison test. A.U., arbitrary units; ns, not significant; OE, overexpressed; sh, short hairpin.

Close modal

Consistently, ChREBP overexpression led to an increase in liver triglyceride levels; however, these remained unaltered by S100A6 knockdown (Fig. 2D). A similar phenomenon was previously observed by Benhamed et al., whereby mice overexpressing ChREBP developed greater hepatic steatosis than did control mice but did not develop insulin resistance (27). Furthermore, ChREBP overexpression led to increased liver weight and ratio of liver to body weight, which was reduced after S100A6 knockdown, suggesting its role in hepatic lipid accumulation (Fig. 2E). However, we did not find any significant difference either in pancreatic weight, histological features, β-cell size, or β-cell mass (Supplementary Fig. 2A–D). Consistently, the OGTT results revealed no change in glucose excursion among three experimental mice groups (Supplementary Fig. 2E). In contrast, ChREBP overexpression caused impaired insulin secretion, whereas depletion of S100A6 substantially enhanced glucose-induced insulin secretion (Fig. 2F). These data support the hypothesis that ChREBP-driven upregulation of hepatic and circulatory S100A6 impairs insulin secretion from the pancreatic β cells, albeit to an extent that did not cause glucose intolerance in the short term.

Hepatocyte-Derived S100A6 Autonomously Limits GSIS From β Cells Via RAGE

On the basis of our results, we surmise that hepatic ChREBP elicits two critical stimuli: enhanced DNL-dependent intrahepatic lipid accumulation and induction of hepatic S100A6 production and secretion. To determine the direct impact of ChREBP-driven hepatic S100A6 on pancreatic β-cell dysfunction, we generated an in vitro model of HepG2 cells expressing ChREBP (Fig. 3A). Proteomic analysis of the culture supernatant revealed a substantial enrichment number of proteins including S100A6 (Fig. 3B and Supplementary Table 1). We next incubated INS1 cells with the conditioned medium of ChREBP-overexpressed HepG2 cells and assayed for GSIS. As shown in Fig. 3C, GSIS was substantially reduced when cells were treated with ChREBP-overexpressed conditioned medium. Furthermore, conditioned-medium treatment from S100A6 knockdown in ChREBP-overexpressed HepG2 cells rescued them from impaired GSIS, in contrast to ChREBP-overexpressed conditioned medium–treated INS1 cells (Fig. 3D). Similarly, treatment of ChREBP-overexpressed conditioned medium from primary hepatocytes on islets also led to a significant reduction in GSIS (Fig. 3E2). As observed in INS1 cells, the reduction in GSIS in islets was abolished when S100A6 was concomitantly knocked down in primary hepatocytes (Fig. 3E2).

For validating the adverse impact of S100A6 on GSIS, treatment of recombinant S100A6 protein (rS100A6) in nanomolar concentrations also caused a decrement in insulin secretion in INS1 cells (Fig. 3F). Consequently, we sought to determine the possible mechanism for S100A6-mediated impairment of GSIS. S100 proteins can interact with RAGE (28), which are abundantly expressed in pancreatic β cells and are involved in regulating the apoptotic and inflammatory pathways (29,30). To specifically investigate the functional role of RAGE on β cells in mediating S100A6 action on GSIS, we pretreated INS1 cells and islets with a RAGE antagonist, FPS-ZM1 (31), followed by rS100A6 treatment for 14 h. FPS-ZM1 significantly abrogated rS100A6-mediated abatement of GSIS (Fig. 3G and H), suggesting S100A6 suppresses insulin secretion by engaging with RAGE.

Figure 3

S100A6 impairs glucose stimulated insulin secretion via interaction with the RAGE receptor on pancreatic β cells. (A) Schematic representation of the overall in vitro experimental design. (B) The abundance of significantly upregulated proteins in ChREBP-overexpressed conditioned medium relative to eGFP-overexpressed conditioned medium. (C) Supernatants from the ChREBP overexpressed or with concomitant s100A6 knockdown in HepG2 cells were treated on INS1 cells for 14 h and GSIS was performed. (D1) Supernatants from ChREBP overexpression and S100A6 knockdown in HepG2 cells were collected and applied to INS1 cells, and GSIS was measured. (D2) Quantitative PCR depicting ChREBP overexpression and S100A6 knockdown in HepG2 cells. (E1) Schematic representation of the experimental design in primary cells. (E2) Supernatants from the ChREBP overexpressed or with concomitant s100A6 knockdown primary hepatocytes were applied to mouse primary islets for 14 h, and GSIS was performed. (F) GSIS analysis of INS1 cells after rS100A6 protein (1.2 nM) treatment. (G) GSIS analysis of INS1 cells after rS100A6 protein (1.2 nM) treatment in the presence and absence of RAGE receptor antagonism (FPS-ZM1). (H) GSIS analysis of islets after rS100A6 protein (1.2 nM) treatment in the presence and absence of RAGE receptor antagonism (FPS-ZM1). Values are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, ANOVA followed by Bonferroni’s multiple comparison test. CM, conditioned medium; ns, not significant; OE, overexpressed.

Figure 3

S100A6 impairs glucose stimulated insulin secretion via interaction with the RAGE receptor on pancreatic β cells. (A) Schematic representation of the overall in vitro experimental design. (B) The abundance of significantly upregulated proteins in ChREBP-overexpressed conditioned medium relative to eGFP-overexpressed conditioned medium. (C) Supernatants from the ChREBP overexpressed or with concomitant s100A6 knockdown in HepG2 cells were treated on INS1 cells for 14 h and GSIS was performed. (D1) Supernatants from ChREBP overexpression and S100A6 knockdown in HepG2 cells were collected and applied to INS1 cells, and GSIS was measured. (D2) Quantitative PCR depicting ChREBP overexpression and S100A6 knockdown in HepG2 cells. (E1) Schematic representation of the experimental design in primary cells. (E2) Supernatants from the ChREBP overexpressed or with concomitant s100A6 knockdown primary hepatocytes were applied to mouse primary islets for 14 h, and GSIS was performed. (F) GSIS analysis of INS1 cells after rS100A6 protein (1.2 nM) treatment. (G) GSIS analysis of INS1 cells after rS100A6 protein (1.2 nM) treatment in the presence and absence of RAGE receptor antagonism (FPS-ZM1). (H) GSIS analysis of islets after rS100A6 protein (1.2 nM) treatment in the presence and absence of RAGE receptor antagonism (FPS-ZM1). Values are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, ANOVA followed by Bonferroni’s multiple comparison test. CM, conditioned medium; ns, not significant; OE, overexpressed.

Close modal

S100A6 Suppresses cAMP Synthesis and Inhibits Mitochondrial ATP Production

Insulin secretion from the β cells involves a sequence of intracellular events in response to various exogenous mediators (32,33), including cytosolic Ca2+ levels, cAMP signaling, and mitochondrial respiration (3436). To elucidate the S100A6-mediated pathways influencing insulin secretion, we performed a series of experiments. Mouse islets were used to measure intracellular cAMP levels in response to S100A6 treatment. Furthermore, islets were cotreated with the GLP1R agonist exendin-4 (E4) and the phosphodiesterase inhibitor IBMX in the presence and absence of recombinant S100A6 protein and RAGE antagonist FPS-ZM1. S100A6 impaired islet cAMP production in response to the long-acting GLP1 analog E4, a widely used antidiabetic agent that binds and activates GLP1R on β cells and potentiates GSIS by stimulating β-cell cAMP synthesis. Although S100A6 suppressed intracellular cAMP production in response to E4 stimulation, antagonizing RAGE significantly abrogated the reduction in cAMP levels (Fig. 4A), suggesting the potential involvement of S100A6 in either inhibiting GLP1R or stimulating the activity of phosphodiesterase. Consistently, S100A6 also led to a decrement in E4-induced protein kinase A (PKA) activity in primary islets, a readout of the cAMP-signaling axis, which was also abrogated upon RAGE antagonism (Fig. 4B). Consistently, recombinant S100A6 protein treatment led to a significant reduction in IBMX and forskolin-induced intracellular cAMP and PKA levels in INS1 cells in a RAGE-sensitive manner (Supplementary Fig. 3A and B). Moreover, S100A6 was unable to diminish cAMP levels in INS1 cells treated with 8-bromo cAMP, a phosphodiesterase-resistant, cell-permeable cAMP analog (Supplementary Fig. 3C).

Figure 4

S100A6 suppresses cAMP synthesis and inhibits mitochondrial ATP production. (A) cAMP synthesis in response to S100A6 and incretin analog E4 in primary islets in the presence and absence of RAGE antagonist FPS-ZM1. (B) PKA activity in response to S100A6 and E4 in primary islets in the presence and absence of FPS-ZM1. (C) Intracellular ATP levels upon S100A6 protein treatment in islets. (D and E) Fluorescent microscopic images of INS1 cells stained with JC-1 dye after ChREBP-overexpressed conditioned medium (CM) from HepG2 cells and quantitative estimation of JC-1 aggregates fluorescence. (F) OCR analysis of INS1 cells after treatment with S100A6 protein (1.2 nM) using the Seahorse XFp analyzer. (G) The graphs represent the quantitative analysis of the OCR. Values are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, ANOVA followed by Bonferroni’s multiple comparison test. AA, antimycin A; FCCP, carbonyl cyanide p-trifluoromethoxyphenylhydrazone; GFP, green fluorescent protein; ns, not significant; RFP, red fluorescent protein; Rot, rotenone.

Figure 4

S100A6 suppresses cAMP synthesis and inhibits mitochondrial ATP production. (A) cAMP synthesis in response to S100A6 and incretin analog E4 in primary islets in the presence and absence of RAGE antagonist FPS-ZM1. (B) PKA activity in response to S100A6 and E4 in primary islets in the presence and absence of FPS-ZM1. (C) Intracellular ATP levels upon S100A6 protein treatment in islets. (D and E) Fluorescent microscopic images of INS1 cells stained with JC-1 dye after ChREBP-overexpressed conditioned medium (CM) from HepG2 cells and quantitative estimation of JC-1 aggregates fluorescence. (F) OCR analysis of INS1 cells after treatment with S100A6 protein (1.2 nM) using the Seahorse XFp analyzer. (G) The graphs represent the quantitative analysis of the OCR. Values are expressed as mean ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, ANOVA followed by Bonferroni’s multiple comparison test. AA, antimycin A; FCCP, carbonyl cyanide p-trifluoromethoxyphenylhydrazone; GFP, green fluorescent protein; ns, not significant; RFP, red fluorescent protein; Rot, rotenone.

Close modal

We next investigated the effect of S100A6 protein in regulating intracellular calcium dynamics in pancreatic β cells. The recombinant S100A6 protein was incubated with INS1 cells and intracellular calcium was measured using Fura-2 AM. Interestingly, the glucose-stimulated intracellular calcium response was unaffected upon S100A6 recombinant protein treatment in high-glucose concentrations (Supplementary Fig. 3D).

We further examined the glucose-dependent mitochondrial metabolism on insulin secretion (3739). The recombinant S100A6 protein treatment on primary islets led to a significant reduction in intracellular ATP levels as observed via decreased luminescence (Fig. 4C). Expectedly, high-glucose treatment led to the hyperpolarization of the mitochondrial membrane potential as depicted by the red fluorescence of the JC-1 J dimers, whereas ChREBP-overexpressed conditioned medium from HepG2 cells led to attenuation in the red to green fluorescence-intensity ratio depicting mitochondrial membrane depolarization (Fig. 4D and E). Both basal and maximal OCRs, a readout of mitochondrial respiration, were also reduced by rS100A6 protein (Fig. 4F). The ATP synthase activity was also attenuated, as depicted by the diminished respiratory response upon oligomycin addition. Rotenone and antimycin treatment, inhibiting complexes 1 and 3 of the electron transport chain, respectively, showed a similar pattern of suppression in control and protein-treated INS-1 cells, revealing no mitochondrial leak (Fig. 4G). Collectively, our results indicate that S100A6 reduces β-cell cAMP production, impairs mitochondrial metabolism, causes a reduction in intracellular ATP levels required for insulin secretion, and may impair incretin action on the cAMP synthesis and GSIS potentiation from β cells.

Hepatic S100A6 Deficiency Improves Glycemic Control in NAFLD by Increasing Insulin Secretory Capacity

We next examined the role of hepatic S100A6 on the insulin secretory capacity in a preclinical model of NAFLD. To this end, mice were fed a HFD for 8 weeks and the S100A6 gene was knocked down in the liver via adenovirus expressing S100A6-specific shRNA (Ad-shS100A6) (Fig. 5A). HFD-fed mice gained substantial body weight at a faster rate than did the chow diet-fed group, and the depletion of S100A6 did not cause any difference in body weight (Fig. 5B). Knockdown of the S100A6 expectedly led to decreased hepatic and serum levels of S100A6 (Fig. 5C), indicating that the liver is the predominant source of circulating S100A6. Importantly, Ad-shS100A6 treatment did not affect S100A6 expression in adipose tissue (Supplementary Fig. 4A). Moreover, knockdown of S100A6 did not alter liver weight, liver to body weight ratio, hepatic fat accumulation, epididymal fat mass, pancreatic weight (Fig. 5D and E), and morphology of the pancreas, as evident by the hematoxylin and eosin (H-E) staining (Supplementary Fig. 4B).

Figure 5

Hepatic S100A6 deficiency improves glycemic control in HFD-induced NAFLD mice by increasing insulin secretory capacity. (A) Schematic representation of in vivo study plan. (B) The graph represents body weight measurements in normal chow diet (n = 5), HFD (n = 5), and HFD+shS100A6 (n = 7) mice groups. (C) Immunoblot analysis of ChREBP and S100A6 in serum and mice liver lysates of normal chow diet, HFD, and HFD+shS100A6 mice groups. (D) Representative morphology of mice liver from normal chow diet, HFD, and HFD+shS100A6 mice groups (top). Histological analysis of liver tissue sections via H-E staining (bottom). (E) The graph represents the liver weight, liver to body weight ratio, pancreas weight, and epididymal fat weight among different mice groups: normal chow diet, HFD, and HFD+shS100A6. (F) Plasma glucose levels measurement by OGTT and area under the curve (AUC) for plasma glucose levels, as determined from OGTT. (G) Plasma insulin levels during an in vivo GSIS assay, as determined by insulin ELISA. Immunoblots are quantified using ImageJ software. Values are expressed as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ANOVA followed by Bonferroni’s multiple comparison test. A.U., arbitrary units; ITT, insulin tolerance test.

Figure 5

Hepatic S100A6 deficiency improves glycemic control in HFD-induced NAFLD mice by increasing insulin secretory capacity. (A) Schematic representation of in vivo study plan. (B) The graph represents body weight measurements in normal chow diet (n = 5), HFD (n = 5), and HFD+shS100A6 (n = 7) mice groups. (C) Immunoblot analysis of ChREBP and S100A6 in serum and mice liver lysates of normal chow diet, HFD, and HFD+shS100A6 mice groups. (D) Representative morphology of mice liver from normal chow diet, HFD, and HFD+shS100A6 mice groups (top). Histological analysis of liver tissue sections via H-E staining (bottom). (E) The graph represents the liver weight, liver to body weight ratio, pancreas weight, and epididymal fat weight among different mice groups: normal chow diet, HFD, and HFD+shS100A6. (F) Plasma glucose levels measurement by OGTT and area under the curve (AUC) for plasma glucose levels, as determined from OGTT. (G) Plasma insulin levels during an in vivo GSIS assay, as determined by insulin ELISA. Immunoblots are quantified using ImageJ software. Values are expressed as mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ANOVA followed by Bonferroni’s multiple comparison test. A.U., arbitrary units; ITT, insulin tolerance test.

Close modal

Mice receiving an HFD for 8 weeks predictively developed glucose intolerance and impaired GSIS, as compared with chow diet-fed control mice (Fig. 5F and G). Interestingly, hepatic S100A6 depletion in HFD-fed mice resulted in significantly lower fasting glucose levels as well as improved glucose tolerance, and also resulted in restored GSIS in the HFD-fed mice (Fig. 5G). Conversely, after knockdown of S100A6, a similar trend in insulin-mediated glucose-lowering capacity excludes the possibility of differential insulin sensitivity or a compensatory increase in insulin secretion in the face of altered insulin resistance as the underlying mechanism for improved glucose tolerance (Supplementary Fig. 4C). Moreover, pancreas morphometric parameters were also unaltered after 8 weeks of HFD feeding, thereby excluding differences in β-cell mass and size to account for the differences in glucose homeostasis (Supplementary Fig. 4D and E).

Taken together, our data strongly suggest that HFD-induced fatty liver impairs insulin secretion via S100A6. Diminution of circulatory S100A6 would improve metabolic outcomes by enhancing insulin secretion and glucose tolerance in HFD-induced NAFLD.

Using complementary human patient data and in vitro, ex vivo, and in vivo experiments, we identified hepatic S100A6 as a messenger mediating β-cell dysfunction in NAFLD. We show that intracellular lipid stress induced either by treatment with high glucose in vitro, by feeding an HFD to mice, or overexpression of ChREBP led to upregulation of hepatic as well systemic S100A6 levels. Augmented systemic S100A6, in turn, perturbed intracellular cAMP synthesis and inhibited mitochondrial ATP production in β cells, leading to inhibition of GSIS. Knockdown of S100A6 in both HFD-fed and in Adv-ChREBP mice resulted in improved GSIS in vivo, uncovering the liver as a site of regulated S100A6 production and release, and providing the first evidence, to our knowledge, that secreted S100A6 is a critical contributor behind NAFLD-driven T2DM. Thus, in NAFLD, the liver is exposed to two critical stimuli elicited by ChREBP action: intrahepatic lipid accumulation by enhanced DNL and S100A6 production that impairs GSIS in pancreatic β cells. These observations propose a direct sequential role of enhanced DNL-induced NAFLD progression in driving the development of T2DM. Furthermore, the results assign what we believe is a heretofore unknown role of S100A6 in liver-to-islet endocrine signaling (Fig. 6).

Figure 6

Proposed model for ChREBP-mediated S100A6 expression and its role in regulating β-cell function. A high-calorie diet (i.e., an HFD and high-carbohydrate diet) leads to enhanced ChREBP expression in the liver. ChREBP transactivation leads to enhanced DNL and, at the same time, also upregulates the transcription of S100A6 and its secretion. S100A6 interacts with the RAGE receptor on pancreatic β cells and impairs GSIS. S100A6-mediated RAGE receptor activation inhibits cAMP synthesis and also alters mitochondrial respiration. ΔΨ, membrane potential.

Figure 6

Proposed model for ChREBP-mediated S100A6 expression and its role in regulating β-cell function. A high-calorie diet (i.e., an HFD and high-carbohydrate diet) leads to enhanced ChREBP expression in the liver. ChREBP transactivation leads to enhanced DNL and, at the same time, also upregulates the transcription of S100A6 and its secretion. S100A6 interacts with the RAGE receptor on pancreatic β cells and impairs GSIS. S100A6-mediated RAGE receptor activation inhibits cAMP synthesis and also alters mitochondrial respiration. ΔΨ, membrane potential.

Close modal

Endocrine communication between the liver and other distal organs plays a critical role in maintaining whole-body energy homeostasis. For example, enhanced hepatic extracellular signal-regulated kinase activity in obese mice is associated with pancreatic β-cell proliferation (40). Authors of another study deciphered the role of hepatocyte-derived factor(s) in promoting β-cell proliferation using in vivo parabiosis (41). Hepatocyte-derived kisspeptin1 was reported to reciprocally regulate pancreatic β-cell function (13). Studies have also demonstrated the role of HFD-induced, hepatocyte-derived extracellular vesicles in promoting the proliferation of β-cells, but these vesicles have no significant effect on insulin secretion (42). However, there is still no evidence, to our knowledge, for whether hepato-pancreatic crosstalk has any role in the accelerated occurrence of glucose intolerance and T2DM in patients with NAFLD.

In physiology, insulin secretion is augmented by glucose levels in a biphasic manner, with an early first-phase burst of insulin, followed by a second, more sustained release of insulin (43). Patients with T2DM and those at risk for developing the disease present with diminished first-phase insulin secretion (44). Therefore, targeting β-cells to improve their function and survival is of utmost importance for improving diabetes management by developing newer therapies for the disease. Experiments with RAGE antagonists suggest that RAGE signaling transduces extracellular S100A6’s effects in inhibiting GSIS in β cells. Apart from the epidemic of ectopic hepatic fat accumulation, an increase in the prevalence of obesity has also led to a concomitant increase in the prevalence of T2DM. Results from a series of studies conducted in patient samples and obese mice models have hinted about secretory factors (from nutrient-induced metabolically stressed tissues) that link obesity with insulin resistance and β-cell dysfunction. At this juncture, we do not know where S100A6 is also involved in this signaling process. Our data from the HFD-mice model hinted at a pivotal role for S100A6 in restoring β-cell function and achieving diabetes remission in the obese mice model, However, the exact participation of S100A6 in obesity-induced β-cell dysfunction remains to be determined.

In addition to an exploration of molecular and cellular events in DNL-driven S100A6 expression and its adverse impact on β-cell insulin secretory function, this study could also be relevant for translational medicine. First, elevated levels of S100A6 expression are associated with several diseases, such as cancer, Alzheimer’s disease, and inflammatory and autoimmune diseases (4547), and now we have unraveled its pathogenetic role in NAFLD. Although the exact mechanism of how S100A6 is secreted from the fat-laden hepatocytes is not well understood, elevated serum levels of S100A6 may serve as a biomarker in identifying patients with a heightened risk of developing β-cell dysfunction or T2DM. Second, our study also supports that neutralizing circulating S100A6 and/or antagonizing its receptor, RAGE, could be therapeutic in restoring β-cell function in NAFLD.

This article contains supplementary material online at https://doi.org/10.2337/figshare.20361846.

S.D. and D.D. contributed equally to this work.

Acknowledgments. We sincerely thank the BioX Center of Indian Institute of Technology Mandi for the facilities. S.D. thanks the DST, India for her research fellowship.

Funding. This research was supported by the Department of Biotechnology, Government of India (grant BT/PR27786/MED/30/1980/2018 to P.M.), the Science and Engineering Research Board (grant CRG/2019/004006 to P.M.), and by the Council of Scientific and Industrial Research, India (grant MLP138 to P.C.). S.D. was supported by a research fellowship from DST, India.

Duality of Interest. No potential conflicts of interest relevant to this article were reported.

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author Contributions. S.D., D.D., A.P., and S.K.M. contributed to the study methodology, validation, data curation and formal analysis, and investigation. S.D. and D.D. contributed to data visualization. S.D. wrote the original draft of the manuscript; D.D. reviewed and edited the manuscript. P.R. and P.V.D. contributed to the investigation. K.D. and S.M. contributed to the study methodology and investigation. P.C. and P.M. conceived of and designed the study, researched data and methodology, reviewed and edited the manuscript, and contributed to project administration and funding acquisition. P.C. and P.M. are the guarantors of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

1.
Brunt
EM
.
Nonalcoholic steatohepatitis: definition and pathology
.
Semin Liver Dis
2001
;
21
:
3
16
2.
Neuschwander-Tetri
BA
.
Hepatic lipotoxicity and the pathogenesis of nonalcoholic steatohepatitis: the central role of nontriglyceride fatty acid metabolites
.
Hepatology
2010
;
52
:
774
788
.
3.
Hassan
K
,
Bhalla
V
,
El Regal
ME
,
A-Kader
HH
.
Nonalcoholic fatty liver disease: a comprehensive review of a growing epidemic
.
World J Gastroenterol
2014
;
20
:
12082
12101
4.
Estes
C
,
Razavi
H
,
Loomba
R
,
Younossi
Z
,
Sanyal
AJ
.
Modeling the epidemic of nonalcoholic fatty liver disease demonstrates an exponential increase in burden of disease
.
Hepatology
2018
;
67
:
123
133
5.
Anstee
QM
,
McPherson
S
,
Day
CP
.
How big a problem is non-alcoholic fatty liver disease?
BMJ
2011
;
343
:
d3897
6.
Mantovani
A
,
Byrne
CD
,
Bonora
E
,
Targher
G
.
Nonalcoholic fatty liver disease and risk of incident type 2 diabetes: A meta-analysis
.
Diabetes Care
2018
;
41
:
372
382
7.
Byrne
CD
,
Targher
G
.
NAFLD: a multisystem disease
.
J Hepatol
2015
;
62
(
1 Suppl.
):
S47
S64
8.
Li
X
,
Wang
H
.
Multiple organs involved in the pathogenesis of non-alcoholic fatty liver disease
.
Cell Biosci
2020
;
10
:
140
9.
Wyne
KL
.
Management of type 2 diabetes mellitus: is it time for a paradigm shift?
Metab Syndr Relat Disord
2004
;
2
:
251
262
10.
Daryabor
G
,
Atashzar
MR
,
Kabelitz
D
,
Meri
S
,
Kalantar
K
.
The effects of type 2 diabetes mellitus on organ metabolism and the immune system
.
Front Immunol
2020
;
11
:
1582
11.
Esfahani
M
,
Baranchi
M
,
Goodarzi
MT
.
The implication of hepatokines in metabolic syndrome
.
Diabetes Metab Syndr
2019
;
13
:
2477
2480
12.
Wente
W
,
Efanov
AM
,
Brenner
M
, et al
.
Fibroblast growth factor-21 improves pancreatic β-cell function and survival by activation of extracellular signal-regulated kinase 1/2 and Akt signaling pathways
.
Diabetes
2006
;
55
:
2470
2478
13.
Song
WJ
,
Mondal
P
,
Wolfe
A
, et al
.
Glucagon regulates hepatic kisspeptin to impair insulin secretion
.
Cell Metab
2014
;
19
:
667
681
14.
Stefan
N
,
Fritsche
A
,
Weikert
C
, et al
.
Plasma fetuin-A levels and the risk of type 2 diabetes
.
Diabetes
2008
;
57
:
2762
2767
.
15.
Donato
R
,
Cannon
BR
,
Sorci
G
, et al
.
Functions of S100 proteins
.
Curr Mol Med
2013
;
13
:
24
57
16.
Ma
L
,
Sun
P
,
Zhang
JC
,
Zhang
Q
,
Yao
SL
.
Proinflammatory effects of S100A8/A9 via TLR4 and RAGE signaling pathways in BV-2 microglial cells
.
Int J Mol Med
2017
;
40
:
31
38
17.
Andrés Cerezo
L
,
Mann
H
,
Pecha
O
, et al
.
Decreases in serum levels of S100A8/9 (calprotectin) correlate with improvements in total swollen joint count in patients with recent-onset rheumatoid arthritis
.
Arthritis Res Ther
2011
;
13
:
R122
18.
Baillet
A
,
Trocmé
C
,
Berthier
S
, et al
.
Synovial fluid proteomic fingerprint: S100A8, S100A9 and S100A12 proteins discriminate rheumatoid arthritis from other inflammatory joint diseases
.
Rheumatology (Oxford)
2010
;
49
:
671
682
19.
Zhao
FT
,
Jia
ZS
,
Yang
Q
,
Song
L
,
Jiang
XJ
.
S100A14 promotes the growth and metastasis of hepatocellular carcinoma
.
Asian Pac J Cancer Prev
2013
;
14
:
3831
3836
20.
Oike
Y
,
Akao
M
,
Yasunaga
K
, et al
.
Angiopoietin-related growth factor antagonizes obesity and insulin resistance
.
Nat Med
2005
;
11
:
400
408
21.
Hashimoto
O
,
Funaba
M
,
Sekiyama
K
, et al
.
Activin E controls energy homeostasis in both brown and white adipose tissues as a hepatokine
.
Cell Rep
2018
;
25
:
1193
1203
.
22.
Suppli
MP
,
Rigbolt
KTG
,
Veidal
SS
, et al
.
Hepatic transcriptome signatures in patients with varying degrees of nonalcoholic fatty liver disease compared with healthy normal-weight individuals
.
Am J Physiol Gastrointest Liver Physiol
2019
;
316
:
G462
G472
23.
Das
D
,
Paul
A
,
Lahiri
A
, et al
.
Proteasome dysfunction under compromised redox metabolism dictates liver injury in NASH through ASK1/PPARγ binodal complementary modules
.
Redox Biol
2021
;
45
:
102043
24.
Yuan
Q
,
Hou
S
,
Zhai
J
, et al
.
S100A4 promotes inflammation but suppresses lipid accumulation via the STAT3 pathway in chronic ethanol-induced fatty liver
.
J Mol Med (Berl)
2019
;
97
:
1399
1412
25.
Chen
L
,
Li
J
,
Zhang
J
, et al
.
S100A4 promotes liver fibrosis via activation of hepatic stellate cells
.
J Hepatol
2015
;
62
:
156
164
26.
Jois
T
,
Chen
W
,
Howard
V
, et al
.
Deletion of hepatic carbohydrate response element binding protein (ChREBP) impairs glucose homeostasis and hepatic insulin sensitivity in mice
.
Mol Metab
2017
;
6
:
1381
1394
DOI: https://doi.org/10.1016/j.molmet.2017.07.006
27.
Benhamed
F
,
Denechaud
PD
,
Lemoine
M
, et al
.
The lipogenic transcription factor ChREBP dissociates hepatic steatosis from insulin resistance in mice and humans
.
J Clin Invest
2012
;
122
:
2176
2194
DOI: https://doi.org/10.1172/JCI41636
28.
Leclerc
E
,
Fritz
G
,
Vetter
SW
,
Heizmann
CW
.
Binding of S100 proteins to RAGE: an update
.
Biochim Biophys Acta
2009
;
1793
:
993
1007
29.
Lee
BW
,
Chae
HY
,
Kwon
SJ
,
Park
SY
,
Ihm
J
,
Ihm
SH
.
RAGE ligands induce apoptotic cell death of pancreatic β-cells via oxidative stress
.
Int J Mol Med
2010
;
26
:
813
818
30.
Zhu
Y
,
Shu
T
,
Lin
Y
, et al
.
Inhibition of the receptor for advanced glycation endproducts (RAGE) protects pancreatic β-cells
.
Biochem Biophys Res Commun
2011
;
404
:
159
165
31.
Hong
Y
,
Shen
C
,
Yin
Q
, et al
.
Effects of RAGE-specific inhibitor FPS-ZM1 on amyloid-β metabolism and AGEs-induced inflammation and oxidative stress in rat hippocampus
.
Neurochem Res
2016
;
41
:
1192
1199
32.
Ashcroft
FM
,
Rorsman
P
.
Diabetes mellitus and the β cell: the last ten years
.
Cell
2012
;
148
:
1160
1171
33.
Prentki
M
,
Matschinsky
FM
,
Madiraju
SRM
.
Metabolic signaling in fuel-induced insulin secretion
.
Cell Metab
2013
;
18
:
162
185
34.
Maechler
P
,
Wollheim
CB
.
Mitochondrial function in normal and diabetic β-cells
.
Nature
2001
;
414
:
807
812
35.
Duchen
MR
,
Smith
PA
,
Ashcroft
FM
.
Substrate-dependent changes in mitochondrial function, intracellular free calcium concentration and membrane channels in pancreatic β-cells
.
Biochem J
1993
;
294
:
35
42
36.
Peercy
BE
,
Sherman
AS
,
Bertram
R
.
Modeling of glucose-induced cAMP oscillations in pancreatic β cells: cAMP rocks when metabolism rolls
.
Biophys J
2015
;
109
:
439
449
37.
Wollheim
CB
,
Maechler
P
.
β-cell mitochondria and insulin secretion: messenger role of nucleotides and metabolites
.
Diabetes
2002
;
51
:
S37
S42
.
38.
Wikstrom
JD
,
Katzman
SM
,
Mohamed
H
, et al
.
β-Cell mitochondria exhibit membrane potential heterogeneity that can be altered by stimulatory or toxic fuel levels
.
Diabetes
2007
;
56
:
2569
2578
39.
Haythorne
E
,
Rohm
M
,
van de Bunt
M
, et al
.
Diabetes causes marked inhibition of mitochondrial metabolism in pancreatic β-cells
.
Nat Commun
2019
;
10
:
2474
40.
Imai
J
,
Katagiri
H
,
Yamada
T
, et al
.
Regulation of pancreatic β cell mass by neuronal signals from the liver
.
Science
2008
;
322
:
1250
1254
41.
El Ouaamari
A
,
Dirice
E
,
Gedeon
N
, et al
.
SerpinB1 promotes pancreatic β cell proliferation
.
Cell Metab
2016
;
23
:
194
205
42.
Fu
Q
,
Li
Y
,
Jiang
H
, et al
.
Hepatocytes derived extracellular vesicles from high-fat diet induced obese mice modulate genes expression and proliferation of islet β cells
.
Biochem Biophys Res Commun
2019
;
516
:
1159
1166
43.
Henquin
J-C
,
Ishiyama
N
,
Nenquin
M
,
Ravier
MA
,
Jonas
J-C
.
Signals and pools underlying biphasic insulin secretion
.
Diabetes
2002
;
51
(
Suppl. 1
):
S60
S67
44.
Porte
D
Jr
.
Banting lecture 1990. β-Cells in type II diabetes mellitus
.
Diabetes
1991
;
40
:
166
180
45.
Leong
S
,
Christopherson
RI
,
Baxter
RC
.
Profiling of apoptotic changes in human breast cancer cells using SELDI-TOF mass spectrometry
.
Cell Physiol Biochem
2007
;
20
:
579
590
46.
Boom
A
,
Pochet
R
,
Authelet
M
, et al
.
Astrocytic calcium/zinc binding protein S100A6 over expression in Alzheimer’s disease and in PS1/APP transgenic mice models
.
Biochim Biophys Acta
2004
;
1742
:
161
168
47.
Tsai
MH
,
Lin
CH
,
Tsai
KW
, et al
.
S100A6 promotes B lymphocyte penetration through the blood-brain barrier in autoimmune encephalitis
.
Front Genet
2019
;
10
:
1188
Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered. More information is available at https://www.diabetesjournals.org/journals/pages/license.