Skip to Main Content
TABLE 1

Primers used for quantitation of mRNA by real-time qPCR

GeneAccession no.5’ primer (5’–3’)3’ primer (5’–3’)
aP2 NM_053365 ATGTGTGATGCCTTTGTGGG CCCAGTTTGAAGGAAATCTC 
Acadl NM_012819 AGCTCCCACAGGAAAGGCTT CTCGAGCATCCACGTAGGCT 
ATGL XM_341960 CACTTTAGCTCCAAGGATGA TGGTTCAGTAGGCCATTCCT 
DGAT-1 NM_053437 TATTACTTCATCTTTGCTCC AAAGTAGGTGACAGACTCAG 
GyK NM_024381 CCTGTCCATTGAAATGTGTCATCC GCCATGAAGCCATGACAATTAGTG 
LPL NM_012598 AACCTTTGTGGTGATCCATGGA CGAAATCCGCATCATCAGGA 
L27 NM_022514 CTGCTCGCTGTCGAAATG CCTTGCGTTTCAGTGCTG 
mCPT-1 NM_013200 CGGAAGCACACCAGGCAGTA GCAGCTTCAGGGTTTGTCGGAATA 
PDK-2 NM_030872 GGGGTGTCCCCTTGAGGAAGAT TTCTTGGGCTCTGTGCTGGG 
PDK-4 NM_053551 TTCTACTCGGATGCTCATGA CACCTCGGTCAGAAATCTTG 
PEPCK NM_198780 TGGGTGATGACATTGCCTGG ACCTTGCCCTTATGCTCTGCAG 
PGC-1α NM_031347 TCCTGTTACTATTATGAATCAAGCC AAACCATAGCTGTCTCCATCATCC 
PPARγ 2 AF156666 GGTGAAACTCTGGGAGATCC TGAGGGAGTTTGAAGACTCTTC 
UCP-1 NM_012682 TGGTGAGTTCGACAACTTCC GTGGGCTGCCCAATGAATAC 
GeneAccession no.5’ primer (5’–3’)3’ primer (5’–3’)
aP2 NM_053365 ATGTGTGATGCCTTTGTGGG CCCAGTTTGAAGGAAATCTC 
Acadl NM_012819 AGCTCCCACAGGAAAGGCTT CTCGAGCATCCACGTAGGCT 
ATGL XM_341960 CACTTTAGCTCCAAGGATGA TGGTTCAGTAGGCCATTCCT 
DGAT-1 NM_053437 TATTACTTCATCTTTGCTCC AAAGTAGGTGACAGACTCAG 
GyK NM_024381 CCTGTCCATTGAAATGTGTCATCC GCCATGAAGCCATGACAATTAGTG 
LPL NM_012598 AACCTTTGTGGTGATCCATGGA CGAAATCCGCATCATCAGGA 
L27 NM_022514 CTGCTCGCTGTCGAAATG CCTTGCGTTTCAGTGCTG 
mCPT-1 NM_013200 CGGAAGCACACCAGGCAGTA GCAGCTTCAGGGTTTGTCGGAATA 
PDK-2 NM_030872 GGGGTGTCCCCTTGAGGAAGAT TTCTTGGGCTCTGTGCTGGG 
PDK-4 NM_053551 TTCTACTCGGATGCTCATGA CACCTCGGTCAGAAATCTTG 
PEPCK NM_198780 TGGGTGATGACATTGCCTGG ACCTTGCCCTTATGCTCTGCAG 
PGC-1α NM_031347 TCCTGTTACTATTATGAATCAAGCC AAACCATAGCTGTCTCCATCATCC 
PPARγ 2 AF156666 GGTGAAACTCTGGGAGATCC TGAGGGAGTTTGAAGACTCTTC 
UCP-1 NM_012682 TGGTGAGTTCGACAACTTCC GTGGGCTGCCCAATGAATAC 
Close Modal

or Create an Account

Close Modal
Close Modal