Skip to Main Content
Table 2

Sequences of primers for amplification and sequencing of NEUROG3

Forward primer (5′–3′)Reverse primer (5′–3′)Product size (bp)
F1 GCTGCTCATCGCTCTCTATTC R1 AGGGTTGAGGCGTCATCCTAC 221 
F2 TCCCACCTAGCCTCGGAATC R2 GCTGCTTGCTCAGTGCCAACT 313 
 *CTGCGCCGTGACGGACTCAAA 
F3 GAACTGCGCAGAGGCGGAAG R3 GCGTTTGAGTCAGCGCCCAG 284 
 *CGAGGAAGCTCCGGGCACGG 
F4 CTTCCCAGACGACGCGAAGC R4 ACCCTCTACGGCTCCCGGCT 383 
 *TCACCAAGATCGAGACGCTG 
Forward primer (5′–3′)Reverse primer (5′–3′)Product size (bp)
F1 GCTGCTCATCGCTCTCTATTC R1 AGGGTTGAGGCGTCATCCTAC 221 
F2 TCCCACCTAGCCTCGGAATC R2 GCTGCTTGCTCAGTGCCAACT 313 
 *CTGCGCCGTGACGGACTCAAA 
F3 GAACTGCGCAGAGGCGGAAG R3 GCGTTTGAGTCAGCGCCCAG 284 
 *CGAGGAAGCTCCGGGCACGG 
F4 CTTCCCAGACGACGCGAAGC R4 ACCCTCTACGGCTCCCGGCT 383 
 *TCACCAAGATCGAGACGCTG 

The entire coding region was screened for mutations by PCR amplification using the primer pairs above and then direct sequencing of the PCR products.

*

Primers used for sequencing only.

Close Modal

or Create an Account

Close Modal
Close Modal