Skip to Main Content
TABLE 1

Target sequences of aldose reductase (AR) used for design of siRNA

Target sequencePosition in DNA sequence
AR siRNA1 AAGCAATCGGAGTCTCCAACT 502 
AR siRNA2 AAAGGAACCTGGTCGTGATCC 802 
Target sequencePosition in DNA sequence
AR siRNA1 AAGCAATCGGAGTCTCCAACT 502 
AR siRNA2 AAAGGAACCTGGTCGTGATCC 802 
Close Modal

or Create an Account

Close Modal
Close Modal