Skip to Main Content
TABLE 1

Primers used for real-time PCR assays of mRNA expression of genes related to lipid metabolism in WAT, liver, and skeletal muscle

GeneAccess no.Forward primerReverse primerAmplicon (bp)
aP2 M13385 AAGGAAAGTGGCAGGCATGG CACGCCCAGTTTGAAGGAAATC 118 
C/EBPα BC028890 CAAGAACAGCAACGAGTACC AGGCGGTCATTGTCACTG 135 
PPARα X57638 CGGGAAAGACCAGCAACAAC TGGCAGCAGTGGAAGAATCG 142 
PPARγ NM011146 CGAGGACATCCAAGACAAC TGTGACGATCTGCCTGAG 124 
SREBP1c NM011480 CTGGCTGAGGCGGGATGA TACGGGCCACAAGAAGTAGA 290 
GeneAccess no.Forward primerReverse primerAmplicon (bp)
aP2 M13385 AAGGAAAGTGGCAGGCATGG CACGCCCAGTTTGAAGGAAATC 118 
C/EBPα BC028890 CAAGAACAGCAACGAGTACC AGGCGGTCATTGTCACTG 135 
PPARα X57638 CGGGAAAGACCAGCAACAAC TGGCAGCAGTGGAAGAATCG 142 
PPARγ NM011146 CGAGGACATCCAAGACAAC TGTGACGATCTGCCTGAG 124 
SREBP1c NM011480 CTGGCTGAGGCGGGATGA TACGGGCCACAAGAAGTAGA 290 
Close Modal

or Create an Account

Close Modal
Close Modal