Skip to Main Content
TABLE 1

Primers used in quantitative real-time PCR

GeneSenseAntisense
Cyclophilin TGGAGAGCACCAAGACAGACA TGCCGGAGTCGACAATGAT 
ACC CCCAGCAGAATAAAGCTACTTTGG TCCTTTTGTGCAACTAGGAACGT 
Fatty acid synthase CCTGGATAGCATTCCGAACCT AGCACATCTCGAAGGCTACACA 
HMG-CoA reductase AGCCGAAGCAGCACATGAT CTTGTGGAATGCCTTGTGATTG 
SREBP-1c GGCACTAAGTGCCCTCAACCT TGCGCAGGAGATGCTATCTCCA 
SREBP-2 CAAGTCTGGCGTTCTGAGGAA ATGTTCTCCTGGCGAAGCT 
Acyl-CoA oxidase GGCCAACTATGGTGGACATCA ACCAATCTGGCTGCACGAA 
ABCA-1 CGTTTCCGGGAAGTGTCCTA GCTAGAGATGACAAGGAGGATGGA 
ChREBP CGGGACATGTTTGATGACTATGTC ACCCGCACGCTGCACAACTGG 
L-PK CTTGCTCTACCGTGAGCCTC ACCACAATCACCAGATCACC 
LXR-α TTGCACCCGACCCTCAGA AAGCCCGACAACAGCGCTTTGC 
LXR-β CGACTCCAGGACAAGAAGC TCAAGAAGACACCACCAAGG 
Farnesoid X receptor CCAACCTGGGTTTCTACCC CACACAGCTCATCCCCTTT 
PPAR-α CTGCAGAGCAACCATCCAGAT GCCGAAGGTCCACCATTTT 
PPAR-δ TCCAGAAGAAGAACCGCAACA GGATAGCGTTGTGCGACATG 
TGF-β TAGTAGACGATGGGCAGTGG TAGTAGACGATGGGCAGTGG 
VEGF AACGATGAAGCCCTGGAGTG TGAGAGGTCTGGTTCCCGA 
PAI-1 GGACACCCTCAGCATGTTCA TCTGATGAGTTCAGCATCCAAGAT 
MCP-1 GTCCCTGTCATGCTTCTGG CATCTTGCTGGTGAATGAGTAG 
TNF-α AATGGCCTCCCTCTCATCAGT GCTACAGGCTTGTCACTCGAATT 
IL-6 TATGAAGTTCCTCTCTGCAAGAGA TAGGGAAGGCCGTGGTT 
Fibronectin AGACCATACCTGCCGAATGTAG GAGAGCTTCCTGTCCTGTAGAG 
Nephrin CGA GGC ACT TCG TGA AAC GCA CTT GCT CTC CCA GGA CT 
Podocin TTT GCC TTT GCC ATT TGA CA ATG CTC CCT TGT GCT CTG TTG 
Synaptopodin GTG TTC ATC TGT GCC CAT TCC AGC TAG CCG AGG CCA TGT TA 
Type IV collagen TACCTGCCACTACTTCGCTAAC CGGATGGTGTGCTCTGGAAG 
Nox4 GTGAAGATTTGCCTGGAAGAAC GATGATTGATGACTGAGATGATGG 
Phoxp22 GCACACCGCCATCCACAC CCAGCCAACCGAGTCACG 
Phoxp47 CCATCATCCTTCAGACCTATCG CCGCTCTCGCTCTTCTCC 
RAGE CCATCCTACCTTCTCCTG AGCGACTATTCCACCTTC 
GeneSenseAntisense
Cyclophilin TGGAGAGCACCAAGACAGACA TGCCGGAGTCGACAATGAT 
ACC CCCAGCAGAATAAAGCTACTTTGG TCCTTTTGTGCAACTAGGAACGT 
Fatty acid synthase CCTGGATAGCATTCCGAACCT AGCACATCTCGAAGGCTACACA 
HMG-CoA reductase AGCCGAAGCAGCACATGAT CTTGTGGAATGCCTTGTGATTG 
SREBP-1c GGCACTAAGTGCCCTCAACCT TGCGCAGGAGATGCTATCTCCA 
SREBP-2 CAAGTCTGGCGTTCTGAGGAA ATGTTCTCCTGGCGAAGCT 
Acyl-CoA oxidase GGCCAACTATGGTGGACATCA ACCAATCTGGCTGCACGAA 
ABCA-1 CGTTTCCGGGAAGTGTCCTA GCTAGAGATGACAAGGAGGATGGA 
ChREBP CGGGACATGTTTGATGACTATGTC ACCCGCACGCTGCACAACTGG 
L-PK CTTGCTCTACCGTGAGCCTC ACCACAATCACCAGATCACC 
LXR-α TTGCACCCGACCCTCAGA AAGCCCGACAACAGCGCTTTGC 
LXR-β CGACTCCAGGACAAGAAGC TCAAGAAGACACCACCAAGG 
Farnesoid X receptor CCAACCTGGGTTTCTACCC CACACAGCTCATCCCCTTT 
PPAR-α CTGCAGAGCAACCATCCAGAT GCCGAAGGTCCACCATTTT 
PPAR-δ TCCAGAAGAAGAACCGCAACA GGATAGCGTTGTGCGACATG 
TGF-β TAGTAGACGATGGGCAGTGG TAGTAGACGATGGGCAGTGG 
VEGF AACGATGAAGCCCTGGAGTG TGAGAGGTCTGGTTCCCGA 
PAI-1 GGACACCCTCAGCATGTTCA TCTGATGAGTTCAGCATCCAAGAT 
MCP-1 GTCCCTGTCATGCTTCTGG CATCTTGCTGGTGAATGAGTAG 
TNF-α AATGGCCTCCCTCTCATCAGT GCTACAGGCTTGTCACTCGAATT 
IL-6 TATGAAGTTCCTCTCTGCAAGAGA TAGGGAAGGCCGTGGTT 
Fibronectin AGACCATACCTGCCGAATGTAG GAGAGCTTCCTGTCCTGTAGAG 
Nephrin CGA GGC ACT TCG TGA AAC GCA CTT GCT CTC CCA GGA CT 
Podocin TTT GCC TTT GCC ATT TGA CA ATG CTC CCT TGT GCT CTG TTG 
Synaptopodin GTG TTC ATC TGT GCC CAT TCC AGC TAG CCG AGG CCA TGT TA 
Type IV collagen TACCTGCCACTACTTCGCTAAC CGGATGGTGTGCTCTGGAAG 
Nox4 GTGAAGATTTGCCTGGAAGAAC GATGATTGATGACTGAGATGATGG 
Phoxp22 GCACACCGCCATCCACAC CCAGCCAACCGAGTCACG 
Phoxp47 CCATCATCCTTCAGACCTATCG CCGCTCTCGCTCTTCTCC 
RAGE CCATCCTACCTTCTCCTG AGCGACTATTCCACCTTC 

RAGE, receptor for advanced glycation end products.

Close Modal

or Create an Account

Close Modal
Close Modal