Skip to Main Content
TABLE 1

Primers used for PCR analysis

GeneSense primerAntisense primerProduct size (bp)
HPRT gctggtgaaaaggacctct cacaggactagaacacctgc 249 
E-cad gcagtcagatctccctgagttcgag gttgctagagtgacctttgtatgtag 372 
Pdx1 ctatccttcaacctataccatttc gaaatcagccaggttgccttcaac 409 
Ptf1a catagagaacgaaccaccctttgag gcacggagtttcctggacagagttc 294 
Hnf6 gcaatggaagtaattcagggcag catgaagaagttgctgacagtgc 471 
Hnf4α ctcttctgattataagctgaggatg ccacaggaaggtgcagattgatctg 377 
Foxa2 cctctatgtagactactgcttctc cctggatttcaccatgtccagaatg 277 
Hnf1β gttgaaattccaagagtgacttgctc ctttaatgggaggcttcctgagatg 281 
Hlxb9 caagctcaacaagtacctgtctcg gcaccattgctgtacgggaagttg 341 
NeuroD cttggccaagaactacatctgg ggagtagggatgcaccgggaa 222 
Ngn3 ggtagcactacctagttggagactc gacaaacagtgcttcaggaaccgtc 389 
Nkx2.2 ctaaatatttatggccatgtacacg gttccaagctccgatgctcaggag 325 
Insulin1 ccagctataatcagagacca gtgtagaagaagccacgct 197 
Glucagon actcacagggcacattcacc ccagttgatgaagtccctgg 353 
GeneSense primerAntisense primerProduct size (bp)
HPRT gctggtgaaaaggacctct cacaggactagaacacctgc 249 
E-cad gcagtcagatctccctgagttcgag gttgctagagtgacctttgtatgtag 372 
Pdx1 ctatccttcaacctataccatttc gaaatcagccaggttgccttcaac 409 
Ptf1a catagagaacgaaccaccctttgag gcacggagtttcctggacagagttc 294 
Hnf6 gcaatggaagtaattcagggcag catgaagaagttgctgacagtgc 471 
Hnf4α ctcttctgattataagctgaggatg ccacaggaaggtgcagattgatctg 377 
Foxa2 cctctatgtagactactgcttctc cctggatttcaccatgtccagaatg 277 
Hnf1β gttgaaattccaagagtgacttgctc ctttaatgggaggcttcctgagatg 281 
Hlxb9 caagctcaacaagtacctgtctcg gcaccattgctgtacgggaagttg 341 
NeuroD cttggccaagaactacatctgg ggagtagggatgcaccgggaa 222 
Ngn3 ggtagcactacctagttggagactc gacaaacagtgcttcaggaaccgtc 389 
Nkx2.2 ctaaatatttatggccatgtacacg gttccaagctccgatgctcaggag 325 
Insulin1 ccagctataatcagagacca gtgtagaagaagccacgct 197 
Glucagon actcacagggcacattcacc ccagttgatgaagtccctgg 353 
Close Modal

or Create an Account

Close Modal
Close Modal